Search Results

Search found 355 results on 15 pages for 'tuple'.

Page 6/15 | < Previous Page | 2 3 4 5 6 7 8 9 10 11 12 13  | Next Page >

  • How to Convert Type in Tuples

    - by Pradeep
    how to convert a String type to a Int i have a tuple and i want to convert it to a tuple which has different types tupletotuple :: (String,String,String) ->(String,Int,Int) tupletotuple (a,b,c) = (a,read(b),read(c)) i get this Error Msg Project tupletotuple ("cha",4,3) ERROR - Cannot infer instance * Instance : Num [Char] * Expression : tupletotuple ("cha",4,3)

    Read the article

  • Generating tuples for tuples

    - by Nicola Bonelli
    Say you have a tuple and want to generate a new tuple by applying a metafunction on each type of the first one. What' the most efficient C++ metafuntion to accomplish to this task? Is it also possible to use C++0x variadic template to provide a better implementation?

    Read the article

  • Generating tuples from tuples

    - by Nicola Bonelli
    Say you have a tuple and want to generate a new tuple by applying a metafunction on each type of the first one. What' the most efficient C++ metafuntion to accomplish to this task? Is it also possible to use C++0x variadic template to provide a better implementation?

    Read the article

  • Check if Django model field choices exists

    - by Justin Lucas
    I'm attempting to check if a value exists in the choices tuple set for a model field. For example lets say I have a Model like this: class Vote(models.Model): VOTE_TYPE = ( (1, "Up"), (-1, "Down"), ) value = models.SmallIntegerField(max_length=1, choices=VOTE_TYPES) Now lets say in a view I have a variable new_value = 'Up' that I would like to use as the value field in a new Vote. How can I first check to see if the value of that variable exists in the VOTE_TYPE tuple? Thank you.

    Read the article

  • Is frozenset adequate for caching of symmetric input data in a python dict?

    - by Debilski
    The title more or less says it all: I have a function which takes symmetric input in two arguments, e.g. something like def f(a1, a2): return heavy_stuff(abs(a1 - a2)) Now, I want to introduce some caching method. Would it be correct / pythonic / reasonably efficient to do something like this: cache = {} def g(a1, a2): return cache.setdefault(frozenset((tuple(a1), tuple(a2))), f(a1, a2)) Or would there be some better way?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • searching a list of tuples in python

    - by hdx
    So I have a list of tuple like: [(1,"juca"),(22,"james"),(53,"xuxa"),(44,"delicia")] I want this list for a tuple whose number value is equal to something. So that if I do search(53) it will return 2 Is is an easy way to do that?

    Read the article

  • Efficient way to store tuples in the datastore

    - by Drew Sears
    If I have a pair of floats, is it any more efficient (computationally or storage-wise) to store them as a GeoPtProperty than it would be pickle the tuple and store it as a BlobProperty? If GeoPt is doing something more clever to keep multiple values in a single property, can it be leveraged for arbitrary data? Can I store the tuple ("Johnny", 5) in a single entity property in a similarly efficient manner?

    Read the article

  • Python combinations no repeat by constraint

    - by user2758113
    I have a tuple of tuples (Name, val 1, val 2, Class) tuple = (("Jackson",10,12,"A"), ("Ryan",10,20,"A"), ("Michael",10,12,"B"), ("Andrew",10,20,"B"), ("McKensie",10,12,"C"), ("Alex",10,20,"D")) I need to return all combinations using itertools combinations that do not repeat classes. How can I return combinations that dont repeat classes. For example, the first returned statement would be: tuple0, tuple2, tuple4, tuple5 and so on.

    Read the article

  • Getting Two items from Same table in SELECT statment

    - by mouthpiec
    Hi, I an SQL SELECT statement I need to extract the name of two teams, taking both teams from the same table. Eg Below SELECT sport_activity_id, (team A), (team B), date, time FROM sportactivity, teams WHERE competition_id_fk = 2 For (team A) and (team B) I have an team_id, which is a FK for the table 'teams' Is it possible to get the following result from these tables by SQL? 1, Barcelona, Arsenal, 01/01/2000, 20:00 the two table are the following: table sportactivity sport_activity_id, home_team_fk, away_team_fk, competition_id_fk, date, time (tuple example) - 1, 33, 41, 5, 2010-04-14, 05:40:00 table teams team_id, team_name (tuple example) - 1, Algeria

    Read the article

  • Pluggable Rules for Entity Framework Code First

    - by Ricardo Peres
    Suppose you want a system that lets you plug custom validation rules on your Entity Framework context. The rules would control whether an entity can be saved, updated or deleted, and would be implemented in plain .NET. Yes, I know I already talked about plugable validation in Entity Framework Code First, but this is a different approach. An example API is in order, first, a ruleset, which will hold the collection of rules: 1: public interface IRuleset : IDisposable 2: { 3: void AddRule<T>(IRule<T> rule); 4: IEnumerable<IRule<T>> GetRules<T>(); 5: } Next, a rule: 1: public interface IRule<T> 2: { 3: Boolean CanSave(T entity, DbContext ctx); 4: Boolean CanUpdate(T entity, DbContext ctx); 5: Boolean CanDelete(T entity, DbContext ctx); 6: String Name 7: { 8: get; 9: } 10: } Let’s analyze what we have, starting with the ruleset: Only has methods for adding a rule, specific to an entity type, and to list all rules of this entity type; By implementing IDisposable, we allow it to be cancelled, by disposing of it when we no longer want its rules to be applied. A rule, on the other hand: Has discrete methods for checking if a given entity can be saved, updated or deleted, which receive as parameters the entity itself and a pointer to the DbContext to which the ruleset was applied; Has a name property for helping us identifying what failed. A ruleset really doesn’t need a public implementation, all we need is its interface. The private (internal) implementation might look like this: 1: sealed class Ruleset : IRuleset 2: { 3: private readonly IDictionary<Type, HashSet<Object>> rules = new Dictionary<Type, HashSet<Object>>(); 4: private ObjectContext octx = null; 5:  6: internal Ruleset(ObjectContext octx) 7: { 8: this.octx = octx; 9: } 10:  11: public void AddRule<T>(IRule<T> rule) 12: { 13: if (this.rules.ContainsKey(typeof(T)) == false) 14: { 15: this.rules[typeof(T)] = new HashSet<Object>(); 16: } 17:  18: this.rules[typeof(T)].Add(rule); 19: } 20:  21: public IEnumerable<IRule<T>> GetRules<T>() 22: { 23: if (this.rules.ContainsKey(typeof(T)) == true) 24: { 25: foreach (IRule<T> rule in this.rules[typeof(T)]) 26: { 27: yield return (rule); 28: } 29: } 30: } 31:  32: public void Dispose() 33: { 34: this.octx.SavingChanges -= RulesExtensions.OnSaving; 35: RulesExtensions.rulesets.Remove(this.octx); 36: this.octx = null; 37:  38: this.rules.Clear(); 39: } 40: } Basically, this implementation: Stores the ObjectContext of the DbContext to which it was created for, this is so that later we can remove the association; Has a collection - a set, actually, which does not allow duplication - of rules indexed by the real Type of an entity (because of proxying, an entity may be of a type that inherits from the class that we declared); Has generic methods for adding and enumerating rules of a given type; Has a Dispose method for cancelling the enforcement of the rules. A (really dumb) rule applied to Product might look like this: 1: class ProductRule : IRule<Product> 2: { 3: #region IRule<Product> Members 4:  5: public String Name 6: { 7: get 8: { 9: return ("Rule 1"); 10: } 11: } 12:  13: public Boolean CanSave(Product entity, DbContext ctx) 14: { 15: return (entity.Price > 10000); 16: } 17:  18: public Boolean CanUpdate(Product entity, DbContext ctx) 19: { 20: return (true); 21: } 22:  23: public Boolean CanDelete(Product entity, DbContext ctx) 24: { 25: return (true); 26: } 27:  28: #endregion 29: } The DbContext is there because we may need to check something else in the database before deciding whether to allow an operation or not. And here’s how to apply this mechanism to any DbContext, without requiring the usage of a subclass, by means of an extension method: 1: public static class RulesExtensions 2: { 3: private static readonly MethodInfo getRulesMethod = typeof(IRuleset).GetMethod("GetRules"); 4: internal static readonly IDictionary<ObjectContext, Tuple<IRuleset, DbContext>> rulesets = new Dictionary<ObjectContext, Tuple<IRuleset, DbContext>>(); 5:  6: private static Type GetRealType(Object entity) 7: { 8: return (entity.GetType().Assembly.IsDynamic == true ? entity.GetType().BaseType : entity.GetType()); 9: } 10:  11: internal static void OnSaving(Object sender, EventArgs e) 12: { 13: ObjectContext octx = sender as ObjectContext; 14: IRuleset ruleset = rulesets[octx].Item1; 15: DbContext ctx = rulesets[octx].Item2; 16:  17: foreach (ObjectStateEntry entry in octx.ObjectStateManager.GetObjectStateEntries(EntityState.Added)) 18: { 19: Object entity = entry.Entity; 20: Type realType = GetRealType(entity); 21:  22: foreach (dynamic rule in (getRulesMethod.MakeGenericMethod(realType).Invoke(ruleset, null) as IEnumerable)) 23: { 24: if (rule.CanSave(entity, ctx) == false) 25: { 26: throw (new Exception(String.Format("Cannot save entity {0} due to rule {1}", entity, rule.Name))); 27: } 28: } 29: } 30:  31: foreach (ObjectStateEntry entry in octx.ObjectStateManager.GetObjectStateEntries(EntityState.Deleted)) 32: { 33: Object entity = entry.Entity; 34: Type realType = GetRealType(entity); 35:  36: foreach (dynamic rule in (getRulesMethod.MakeGenericMethod(realType).Invoke(ruleset, null) as IEnumerable)) 37: { 38: if (rule.CanDelete(entity, ctx) == false) 39: { 40: throw (new Exception(String.Format("Cannot delete entity {0} due to rule {1}", entity, rule.Name))); 41: } 42: } 43: } 44:  45: foreach (ObjectStateEntry entry in octx.ObjectStateManager.GetObjectStateEntries(EntityState.Modified)) 46: { 47: Object entity = entry.Entity; 48: Type realType = GetRealType(entity); 49:  50: foreach (dynamic rule in (getRulesMethod.MakeGenericMethod(realType).Invoke(ruleset, null) as IEnumerable)) 51: { 52: if (rule.CanUpdate(entity, ctx) == false) 53: { 54: throw (new Exception(String.Format("Cannot update entity {0} due to rule {1}", entity, rule.Name))); 55: } 56: } 57: } 58: } 59:  60: public static IRuleset CreateRuleset(this DbContext context) 61: { 62: Tuple<IRuleset, DbContext> ruleset = null; 63: ObjectContext octx = (context as IObjectContextAdapter).ObjectContext; 64:  65: if (rulesets.TryGetValue(octx, out ruleset) == false) 66: { 67: ruleset = rulesets[octx] = new Tuple<IRuleset, DbContext>(new Ruleset(octx), context); 68: 69: octx.SavingChanges += OnSaving; 70: } 71:  72: return (ruleset.Item1); 73: } 74: } It relies on the SavingChanges event of the ObjectContext to intercept the saving operations before they are actually issued. Yes, it uses a bit of dynamic magic! Very handy, by the way! So, let’s put it all together: 1: using (MyContext ctx = new MyContext()) 2: { 3: IRuleset rules = ctx.CreateRuleset(); 4: rules.AddRule(new ProductRule()); 5:  6: ctx.Products.Add(new Product() { Name = "xyz", Price = 50000 }); 7:  8: ctx.SaveChanges(); //an exception is fired here 9:  10: //when we no longer need to apply the rules 11: rules.Dispose(); 12: } Feel free to use it and extend it any way you like, and do give me your feedback! As a final note, this can be easily changed to support plain old Entity Framework (not Code First, that is), if that is what you are using.

    Read the article

  • Error : java.lang.NoSuchMethodError: org.objectweb.asm.ClassWriter.<init>(I)V

    - by Hitesh Solanki
    Hiii.... I am developing small spring application. I have to store the details of the student information in the database. I have develop one simpleformcontroller.I have used netbeans + hibernate mapping + spring. when I deploy the project,the following errors is occured. please help me.. Thanks in advance..... My spring-config-db-applicationContext.xml is shown below: <?xml version="1.0" encoding="UTF-8"?> ${driverClassName} ${url} ${username} ${password} WEB-INF/classes/hibernate.cfg.xml -- hibernate.cfg.xml org.hibernate.cfg.AnnotationConfiguration -- <property name="hibernateProperties"> <props> <prop key="hibernate.dialect">${dialect}</prop> <prop key="hibernate.show_sql">true</prop> <!--<prop key="hibernate.hbm2ddl.auto">create</prop>--> </props> </property> </bean> Following error is occured: ERROR (org.springframework.web.context.ContextLoader:213) - Context initialization failed org.springframework.beans.factory.BeanCreationException: Error creating bean with name 'sessionFactory' defined in URL [jndi:/localhost/Student/WEB-INF/classes/config/spring-db-applicationContext.xml]: Invocation of init method failed; nested exception is java.lang.NoSuchMethodError: org.objectweb.asm.ClassWriter.(I)V at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.initializeBean(AbstractAutowireCapableBeanFactory.java:1395) at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.doCreateBean(AbstractAutowireCapableBeanFactory.java:512) at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.createBean(AbstractAutowireCapableBeanFactory.java:450) at org.springframework.beans.factory.support.AbstractBeanFactory$1.getObject(AbstractBeanFactory.java:289) at org.springframework.beans.factory.support.DefaultSingletonBeanRegistry.getSingleton(DefaultSingletonBeanRegistry.java:222) at org.springframework.beans.factory.support.AbstractBeanFactory.doGetBean(AbstractBeanFactory.java:286) at org.springframework.beans.factory.support.AbstractBeanFactory.getBean(AbstractBeanFactory.java:188) at org.springframework.beans.factory.support.DefaultListableBeanFactory.preInstantiateSingletons(DefaultListableBeanFactory.java:526) at org.springframework.context.support.AbstractApplicationContext.finishBeanFactoryInitialization(AbstractApplicationContext.java:730) at org.springframework.context.support.AbstractApplicationContext.refresh(AbstractApplicationContext.java:387) at org.springframework.web.context.ContextLoader.createWebApplicationContext(ContextLoader.java:270) at org.springframework.web.context.ContextLoader.initWebApplicationContext(ContextLoader.java:197) at org.springframework.web.context.ContextLoaderListener.contextInitialized(ContextLoaderListener.java:47) at org.apache.catalina.core.StandardContext.listenerStart(StandardContext.java:3843) at org.apache.catalina.core.StandardContext.start(StandardContext.java:4342) at org.apache.catalina.core.ContainerBase.addChildInternal(ContainerBase.java:791) at org.apache.catalina.core.ContainerBase.addChild(ContainerBase.java:771) at org.apache.catalina.core.StandardHost.addChild(StandardHost.java:525) at org.apache.catalina.startup.HostConfig.deployDescriptor(HostConfig.java:627) at org.apache.catalina.startup.HostConfig.deployApps(HostConfig.java:511) at org.apache.catalina.startup.HostConfig.check(HostConfig.java:1231) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.tomcat.util.modeler.BaseModelMBean.invoke(BaseModelMBean.java:297) at com.sun.jmx.interceptor.DefaultMBeanServerInterceptor.invoke(DefaultMBeanServerInterceptor.java:836) at com.sun.jmx.mbeanserver.JmxMBeanServer.invoke(JmxMBeanServer.java:761) at org.apache.catalina.manager.ManagerServlet.check(ManagerServlet.java:1471) at org.apache.catalina.manager.ManagerServlet.deploy(ManagerServlet.java:824) at org.apache.catalina.manager.ManagerServlet.doGet(ManagerServlet.java:350) at javax.servlet.http.HttpServlet.service(HttpServlet.java:617) at javax.servlet.http.HttpServlet.service(HttpServlet.java:717) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:290) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:206) at org.netbeans.modules.web.monitor.server.MonitorFilter.doFilter(MonitorFilter.java:196) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:235) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:206) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:233) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:191) at org.apache.catalina.authenticator.AuthenticatorBase.invoke(AuthenticatorBase.java:525) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:128) at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:102) at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:109) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:286) at org.apache.coyote.http11.Http11Processor.process(Http11Processor.java:845) at org.apache.coyote.http11.Http11Protocol$Http11ConnectionHandler.process(Http11Protocol.java:583) at org.apache.tomcat.util.net.JIoEndpoint$Worker.run(JIoEndpoint.java:447) at java.lang.Thread.run(Thread.java:619) Caused by: java.lang.NoSuchMethodError: org.objectweb.asm.ClassWriter.(I)V at net.sf.cglib.core.DebuggingClassWriter.(DebuggingClassWriter.java:47) at net.sf.cglib.core.DefaultGeneratorStrategy.getClassWriter(DefaultGeneratorStrategy.java:30) at net.sf.cglib.core.DefaultGeneratorStrategy.generate(DefaultGeneratorStrategy.java:24) at net.sf.cglib.core.AbstractClassGenerator.create(AbstractClassGenerator.java:216) at net.sf.cglib.core.KeyFactory$Generator.create(KeyFactory.java:144) at net.sf.cglib.core.KeyFactory.create(KeyFactory.java:116) at net.sf.cglib.core.KeyFactory.create(KeyFactory.java:108) at net.sf.cglib.core.KeyFactory.create(KeyFactory.java:104) at net.sf.cglib.proxy.Enhancer.(Enhancer.java:69) at org.hibernate.proxy.pojo.cglib.CGLIBLazyInitializer.getProxyFactory(CGLIBLazyInitializer.java:117) at org.hibernate.proxy.pojo.cglib.CGLIBProxyFactory.postInstantiate(CGLIBProxyFactory.java:43) at org.hibernate.tuple.entity.PojoEntityTuplizer.buildProxyFactory(PojoEntityTuplizer.java:162) at org.hibernate.tuple.entity.AbstractEntityTuplizer.(AbstractEntityTuplizer.java:135) at org.hibernate.tuple.entity.PojoEntityTuplizer.(PojoEntityTuplizer.java:55) at org.hibernate.tuple.entity.EntityEntityModeToTuplizerMapping.(EntityEntityModeToTuplizerMapping.java:56) at org.hibernate.tuple.entity.EntityMetamodel.(EntityMetamodel.java:302) at org.hibernate.persister.entity.AbstractEntityPersister.(AbstractEntityPersister.java:434) at org.hibernate.persister.entity.SingleTableEntityPersister.(SingleTableEntityPersister.java:108) at org.hibernate.persister.PersisterFactory.createClassPersister(PersisterFactory.java:61) at org.hibernate.impl.SessionFactoryImpl.(SessionFactoryImpl.java:238) at org.hibernate.cfg.Configuration.buildSessionFactory(Configuration.java:1304) at org.springframework.orm.hibernate3.LocalSessionFactoryBean.newSessionFactory(LocalSessionFactoryBean.java:813) at org.springframework.orm.hibernate3.LocalSessionFactoryBean.buildSessionFactory(LocalSessionFactoryBean.java:731) at org.springframework.orm.hibernate3.AbstractSessionFactoryBean.afterPropertiesSet(AbstractSessionFactoryBean.java:211) at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.invokeInitMethods(AbstractAutowireCapableBeanFactory.java:1454) at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.initializeBean(AbstractAutowireCapableBeanFactory.java:1392) ... 48 more Mar 12, 2010 5:32:28 PM org.apache.catalina.core.StandardContext start SEVERE: Error listenerStart

    Read the article

  • (Fluent) NHibernate Security Exception - ReflectionPermission

    - by PeterEysermans
    I've upgraded an ASP.Net Web application to the latest build of Fluent NHibernate (1.0.0.636) and the newest version of NHibernate (v2.1.2.4000). I've checked a couple of times that the application is running in Full trust. But I keep getting the following error: Security Exception Description: The application attempted to perform an operation not allowed by the security policy. To grant this application the required permission please contact your system administrator or change the application's trust level in the configuration file. Exception Details: System.Security.SecurityException: Request for the permission of type 'System.Security.Permissions.ReflectionPermission, mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089' failed. Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Stack Trace: [SecurityException: Request for the permission of type 'System.Security.Permissions.ReflectionPermission, mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089' failed.] System.Security.CodeAccessSecurityEngine.Check(Object demand, StackCrawlMark& stackMark, Boolean isPermSet) +0 System.Security.CodeAccessPermission.Demand() +54 System.Reflection.Emit.DynamicMethod.PerformSecurityCheck(Type owner, StackCrawlMark& stackMark, Boolean skipVisibility) +269 System.Reflection.Emit.DynamicMethod..ctor(String name, Type returnType, Type[] parameterTypes, Type owner, Boolean skipVisibility) +81 NHibernate.Bytecode.Lightweight.ReflectionOptimizer.CreateDynamicMethod(Type returnType, Type[] argumentTypes) +165 NHibernate.Bytecode.Lightweight.ReflectionOptimizer.GenerateGetPropertyValuesMethod(IGetter[] getters) +383 NHibernate.Bytecode.Lightweight.ReflectionOptimizer..ctor(Type mappedType, IGetter[] getters, ISetter[] setters) +108 NHibernate.Bytecode.Lightweight.BytecodeProviderImpl.GetReflectionOptimizer(Type mappedClass, IGetter[] getters, ISetter[] setters) +52 NHibernate.Tuple.Component.PocoComponentTuplizer..ctor(Component component) +231 NHibernate.Tuple.Component.ComponentEntityModeToTuplizerMapping..ctor(Component component) +420 NHibernate.Tuple.Component.ComponentMetamodel..ctor(Component component) +402 NHibernate.Mapping.Component.BuildType() +38 NHibernate.Mapping.Component.get_Type() +32 NHibernate.Mapping.SimpleValue.IsValid(IMapping mapping) +39 NHibernate.Mapping.RootClass.Validate(IMapping mapping) +61 NHibernate.Cfg.Configuration.ValidateEntities() +220 NHibernate.Cfg.Configuration.Validate() +16 NHibernate.Cfg.Configuration.BuildSessionFactory() +39 FluentNHibernate.Cfg.FluentConfiguration.BuildSessionFactory() in d:\Builds\FluentNH\src\FluentNHibernate\Cfg\FluentConfiguration.cs:93 Anyone had a similar error? I've seach the web / stackoverflow / NHibernate forums but only found people who had a problem when running in medium trust mode, not full trust. I've been developing for several months on this application on this machine with previous versions of Fluent NHibernate and NHibernate. The machine I'm running this on is 64-bit, you never know that this is relevant.

    Read the article

  • C# Random Number Generator getting stuck in a cycle

    - by Jean Azzopardi
    Hi, I am using .NET to create an artificial life program and I am using C#'s pseudo random class defined in a Singleton. The idea is that if I use the same random number generator throughout the application, I could merely save the seed and then reload from the seed to recompute a certain interesting run. public sealed class RandomNumberGenerator : Random { private static readonly RandomNumberGenerator instance = new RandomNumberGenerator(); RandomNumberGenerator() { } public static RandomNumberGenerator Instance { get { return instance; } } } I also wanted a method that could give me two different random numbers. public static Tuple<int, int> TwoDifferentRandomNumbers(this Random rnd, int minValue, int maxValue) { if (minValue >= maxValue) throw new ArgumentOutOfRangeException("maxValue", "maxValue must be greater than minValue"); if (minValue + 1 == maxValue) return Tuple.Create<int, int>(minValue, maxValue); int rnd1 = rnd.Next(minValue, maxValue); int rnd2 = rnd.Next(minValue, maxValue); while (rnd1 == rnd2) { rnd2 = rnd.Next(minValue, maxValue); } return Tuple.Create<int, int>(rnd1, rnd2); } The problem is that sometimes rnd.Next(minValue,maxValuealways returns minValue. If I breakpoint at this point and try creating a double and setting it to rnd.NextDouble(), it returns 0.0. Anyone know why this is happening? I know that it is a pseudo random number generator, but frankly, I hadn't expected it to lock at 0. The random number generator is being accessed from multiple threads... could this be the source of the problem?

    Read the article

  • Finding subsets that can be completed to tuples without duplicates

    - by Jules
    We have a collection of sets A_1,..,A_n. The goal is to find new sets for each of the old sets. newA_i = {a_i in A_i such that there exist (a_1,..,a_n) in (A1,..,An) with no a_k = a_j for all k and j} So in words this says that we remove all the elements from A_i that can't be used to form a tuple (a_1,..a_n) from the sets (A_1,..,A_n) such that the tuple doesn't contain duplicates. My question is how to compute these new sets quickly. If you just implement this definition by generating all possible v's this will take exponential time. Do you know a better algorithm? Edit: here's an example. Take A_1 = {1,2,3,4} A_2 = {2}. Now the new sets look like this: newA_1 = {1,3,4} newA_2 = {2} The 2 has been removed from A_1 because if you choose it the tuple will always be (2,2) which is invalid because it contains duplicates. On the other hand 1,3,4 are valid because (1,2), (3,2) and (4,2) are valid tuples. Another example: A_1 = {1,2,3} A_2 = {1,4,5} A_3 = {2,4,5} A_4 = {1,2,3} A_5 = {1,2,3} Now the new sets are: newA_1 = {1,2,3} newA_2 = {4,5} newA_3 = {4,5} newA_4 = {1,2,3} newA_5 = {1,2,3} The 1 and 2 are removed from sets 2 and 3 because if you choose the 1 or 2 from these sets you'll only have 2 values left for sets 1, 4 and 5, so you will always have duplicates in tuples that look like (_,1,_,_,_) or like (_,_,2,_,_).

    Read the article

  • Why is PLINQ slower than LINQ for this code?

    - by Rob Packwood
    First off, I am running this on a dual core 2.66Ghz processor machine. I am not sure if I have the .AsParallel() call in the correct spot. I tried it directly on the range variable too and that was still slower. I don't understand why... Here are my results: Process non-parallel 1000 took 146 milliseconds Process parallel 1000 took 156 milliseconds Process non-parallel 5000 took 5187 milliseconds Process parallel 5000 took 5300 milliseconds using System; using System.Collections.Generic; using System.Diagnostics; using System.Linq; namespace DemoConsoleApp { internal class Program { private static void Main() { ReportOnTimedProcess( () => GetIntegerCombinations(), "non-parallel 1000"); ReportOnTimedProcess( () => GetIntegerCombinations(runAsParallel: true), "parallel 1000"); ReportOnTimedProcess( () => GetIntegerCombinations(5000), "non-parallel 5000"); ReportOnTimedProcess( () => GetIntegerCombinations(5000, true), "parallel 5000"); Console.Read(); } private static List<Tuple<int, int>> GetIntegerCombinations( int iterationCount = 1000, bool runAsParallel = false) { IEnumerable<int> range = Enumerable.Range(1, iterationCount); IEnumerable<Tuple<int, int>> integerCombinations = from x in range from y in range select new Tuple<int, int>(x, y); return runAsParallel ? integerCombinations.AsParallel().ToList() : integerCombinations.ToList(); } private static void ReportOnTimedProcess( Action process, string processName) { var stopwatch = new Stopwatch(); stopwatch.Start(); process(); stopwatch.Stop(); Console.WriteLine("Process {0} took {1} milliseconds", processName, stopwatch.ElapsedMilliseconds); } } }

    Read the article

  • What is the fastest (to access) struct-like object in Python?

    - by DNS
    I'm optimizing some code whose main bottleneck is running through and accessing a very large list of struct-like objects. Currently I'm using namedtuples, for readability. But some quick benchmarking using 'timeit' shows that this is really the wrong way to go where performance is a factor: Named tuple with a, b, c: >>> timeit("z = a.c", "from __main__ import a") 0.38655471766332994 Class using __slots__, with a, b, c: >>> timeit("z = b.c", "from __main__ import b") 0.14527461047146062 Dictionary with keys a, b, c: >>> timeit("z = c['c']", "from __main__ import c") 0.11588272541098377 Tuple with three values, using a constant key: >>> timeit("z = d[2]", "from __main__ import d") 0.11106188992948773 List with three values, using a constant key: >>> timeit("z = e[2]", "from __main__ import e") 0.086038238242508669 Tuple with three values, using a local key: >>> timeit("z = d[key]", "from __main__ import d, key") 0.11187358437882722 List with three values, using a local key: >>> timeit("z = e[key]", "from __main__ import e, key") 0.088604143037173344 First of all, is there anything about these little timeit tests that would render them invalid? I ran each several times, to make sure no random system event had thrown them off, and the results were almost identical. It would appear that dictionaries offer the best balance between performance and readability, with classes coming in second. This is unfortunate, since, for my purposes, I also need the object to be sequence-like; hence my choice of namedtuple. Lists are substantially faster, but constant keys are unmaintainable; I'd have to create a bunch of index-constants, i.e. KEY_1 = 1, KEY_2 = 2, etc. which is also not ideal. Am I stuck with these choices, or is there an alternative that I've missed?

    Read the article

  • Best practice for Python & Django constants

    - by Dylan Klomparens
    I have a Django model that relies on a tuple. I'm wondering what the best practice is for refering to constants within that tuple for my Django program. Here, for example, I'd like to specify "default=0" as something that is more readable and does not require commenting. Any suggestions? Status = ( (-1, 'Cancelled'), (0, 'Requires attention'), (1, 'Work in progress'), (2, 'Complete'), ) class Task(models.Model): status = models.IntegerField(choices=Status, default=0) # Status is 'Requires attention' (0) by default. EDIT: If possible I'd like to avoid using a number altogether. Somehow using the string 'Requires attention' instead would be more readable.

    Read the article

  • AvalonDock + UserControl + DataGrid + ContextMenu command routing issue

    - by repka
    I have this kind of layout: <Window x:Class="DockAndMenuTest.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:ad="clr-namespace:AvalonDock;assembly=AvalonDock" Title="MainWindow" Height="350" Width="525"> <ad:DockingManager> <ad:DocumentPane> <ad:DockableContent Title="Doh!"> <UserControl> <UserControl.CommandBindings> <CommandBinding Command="Zoom" Executed="ExecuteZoom" CanExecute="CanZoom"/> </UserControl.CommandBindings> <DataGrid Name="_evilGrid"> <DataGrid.Resources> <Style TargetType="DataGridRow"> <Setter Property="ContextMenu"> <Setter.Value> <ContextMenu> <MenuItem Command="Zoom"/> </ContextMenu> </Setter.Value> </Setter> </Style> </DataGrid.Resources> </DataGrid> </UserControl> </ad:DockableContent> </ad:DocumentPane> </ad:DockingManager> </Window> Briefly: ContextMenu is set for each DataGridRow of DataGrid inside UserControl, which in its turn is inside DockableContent of AvalonDock. Code-behind is trivial as well: public partial class MainWindow { public MainWindow() { InitializeComponent(); _evilGrid.ItemsSource = new[] { Tuple.Create(1, 2, 3), Tuple.Create(4, 4, 3), Tuple.Create(6, 7, 1), }; } private void ExecuteZoom(object sender, ExecutedRoutedEventArgs e) { MessageBox.Show("zoom !"); } private void CanZoom(object sender, CanExecuteRoutedEventArgs e) { e.CanExecute = true; } } So here's the problem: right-clicking on the selected row (if it it was selected before the right click) my command comes out disabled. The command is "Zoom" in this case, but can be any other, including a custom one. If I get rid of either docking or UserControl around my grid there are no problems. ListBox doesn't have this issue either. So I don't know what's at fault here. SNOOP shows that in cases when this propagation fails, instead of UserControl, CanExecute is handled by PART_ShowContextMenuButton (Button), which is part of docking header. I've had other issues with UI command propagation within UserControls hosted inside AvalonDock, but this one is the easiest to reproduce.

    Read the article

  • boost::asio buffer impossible to convert parameter from char to const mutable_buffer&

    - by Ekyo777
    visual studio tells me "error C2664: 'boost::asio::mutable_buffer::mutable_buffer(const boost::asio::mutable_buffer&)': impossible to convert parameter 1 from 'char' to 'const boost::asio::mutable_buffer&' at line 163 of consuming_buffers.hpp" I am unsure of why this happen nor how to solve it(otherwise I wouldn't ask this ^^') but I think it could be related to those functions.. even tough I tried them in another project and everything worked fine... but I can hardly find what's different so... here comes code that could be relevant, if anything useful seems to be missing I'll be glad to send it. packets are all instances of this class. class CPacketBase { protected: const unsigned short _packet_type; const size_t _size; char* _data; public: CPacketBase(unsigned short packet_type, size_t size); ~CPacketBase(); size_t get_size(); const unsigned short& get_type(); virtual char* get(); virtual void set(char*); }; this sends a given packet template <typename Handler> void async_write(CPacketBase* packet, Handler handler) { std::string outbuf; outbuf.resize(packet->get_size()); outbuf = packet->get(); boost::asio::async_write( _socket , boost::asio::buffer(outbuf, packet->get_size()) , handler); } this enable reading packets and calls a function that decodes the packet's header(unsigned short) and resize the buffer to send it to another function that reads the real data from the packet template <typename Handler> void async_read(CPacketBase* packet, Handler handler) { void (CTCPConnection::*f)( const boost::system::error_code& , CPacketBase*, boost::tuple<Handler>) = &CTCPConnection::handle_read_header<Handler>; boost::asio::async_read(_socket, _buffer_data , boost::bind( f , this , boost::asio::placeholders::error , packet , boost::make_tuple(handler))); } and this is called by async_read once a packet is received template <typename Handler> void handle_read_header(const boost::system::error_code& error, CPacketBase* packet, boost::tuple<Handler> handler) { if (error) { boost::get<0>(handler)(error); } else { // Figures packet type unsigned short packet_type = *((unsigned short*) _buffer_data.c_str()); // create new packet according to type delete packet; ... // read packet's data _buffer_data.resize(packet->get_size()-2); // minus header size void (CTCPConnection::*f)( const boost::system::error_code& , CPacketBase*, boost::tuple<Handler>) = &CTCPConnection::handle_read_data<Handler>; boost::asio::async_read(_socket, _buffer_data , boost::bind( f , this , boost::asio::placeholders::error , packet , handler)); } }

    Read the article

  • Python Vector Class

    - by sfjedi
    I'm coming from a C# background where this stuff is super easy—trying to translate into Python for Maya. There's gotta' be a better way to do this. Basically, I'm looking to create a Vector class that will simply have x, y and z coordinates, but it would be ideal if this class returned a tuple with all 3 coordinates and if you could edit the values of this tuple through x, y and z properties, somehow. This is what I have so far, but there must be a better way to do this than using an exec statement, right? I hate using exec statements. class Vector(object): '''Creates a Maya vector/triple, having x, y and z coordinates as float values''' def __init__(self, x=0, y=0, z=0): self.x, self.y, self.z = x, y, z def attrsetter(attr): def set_float(self, value): setattr(self, attr, float(value)) return set_float for xyz in 'xyz': exec("%s = property(fget=attrgetter('_%s'), fset=attrsetter('_%s'))" % (xyz, xyz, xyz))

    Read the article

  • Tuples of unknown size/parameter types

    - by myahya
    I need to create a map, from integers to sets of tuples, the tuples in a single set have the same size. The problem is that the size of a tuple and its parameter types can be determined at runtime, not compile time. I am imagining something like: std::map<int, std::set<boost::tuple> > but not exctly sure how to exactly do this, bossibly using pointers. The purpose of this is to create temporary relations (tables), each with a unique identifier (key), maybe you have another approach.

    Read the article

  • Can I create object names from a text file in Python 2.7?

    - by user560100
    I'm working on a game project. I've created an object, Star(Object). I want to assign the name of the variables, dynamically, from a text file. If I have a text file with: Sol Centauri Vega I want the program to create the Star(Object) with variable names from the text file. I want the process automated, because I'm looking to create hundreds of stars. I could write the code out by hand: Sol = Star(Sol) Centauri = Star(Centauri) Vega = Star(Vega) But isn't there a way to automate this? Essentially, what I eventually want is a tuple with the list of stars, as their own objects. Then, when I am doing game maintenance, I can just iterate over all the objects in the tuple.

    Read the article

< Previous Page | 2 3 4 5 6 7 8 9 10 11 12 13  | Next Page >