Search Results

Search found 57986 results on 2320 pages for 'breadth first search'.

Page 620/2320 | < Previous Page | 616 617 618 619 620 621 622 623 624 625 626 627  | Next Page >

  • Mootools accordion inside another...

    - by jimbo
    Hi all, This is a funny one... I have created a mootools accordion with tabs, each section appears when clicked. This works fine. Now within the first accordion that shows, I have another accordion that displays more data. This was to keep the area small with the mass of information that is needed on the page. All works fine, the problem come when the information hidden is larger than the area that is worked our for the first tabs accordion, and it wont display. does any-one either understand what i'm trying to say, or have an idea of a fix or workaround? Hope this makes sense!

    Read the article

  • Can I have different name and id attributes on a form element?

    - by ewitkows
    Hi all, I have a web form with usual elements (first name, last name, etc). The Postback URL is a different website altogether as the form is intented to post lead information to another website. The site that accepts the lead is expecting First Name to come over as "FName", and Last Name to come over as "LName". Is there any way I can set the ID of a textbox to "txtFName", but submit it over the wire as "FName"? I tried changing the name attribute, but at runtime it sets the name = id.

    Read the article

  • Passing parameters among views in a navigation frame INSIDE a custom control

    - by NetWriter
    I created a silverlight 3 application with a navigation frame and 3 views: search, add and edit. I used the app file to pass parameters among the 3 pages, eg: ((App)Application.Current).SNIPSELECTED = currentSnip; Then in the receiving page: currentSnip = ((App)Application.Current).SNIPSELECTED; currentSnip is a SnipItem object: public class SnipItem { public string itemID {get;set;} public string category {get;set;} public string itemDescription {get;set;} public string codeSnip {get;set;} } This worked fine until I decided to make this entire application into a user control and put that inside a second silverlight application with its own navigation frame and app file. The app files are getting confused. The first app file with all my parameter passing is not being read. I know how to pass a simple parameter between views in the first application without the app file (in a query string), but how about these custom types like my currentSnip above?

    Read the article

  • DWORD to bytes using bitwise shift operators

    - by Dave18
    I can't get it to work correctly. #include <windows.h> int main() { DWORD i = 6521; BYTE first = i >> 32; BYTE second = i >> 24; BYTE third = i >> 16; BYTE fourth = i >> 8; i = (((DWORD)fourth) << 24) | (((DWORD)third) << 16) | (((DWORD)second) << 8) | first; }

    Read the article

  • Rewriting Live TCP/IP (Layer 4) Streams

    - by user213060
    I want to rewrite TCP/IP streams. Ettercap's etterfilter command lets you perform simple live replacements of TCP/IP data based on fixed strings or regexes. Example: if (ip.proto == TCP && tcp.dst == 80) { if (search(DATA.data, "gzip")) { replace("gzip", " "); msg("whited out gzip\n"); } } if (ip.proto == TCP && tcp.dst == 80) { if (search(DATA.data, "deflate")) { replace("deflate", " "); msg("whited out deflate\n"); } } http://ettercap.sourceforge.net/forum/viewtopic.php?t=2833 I would like to rewrite streams based on my own filter program instead of just simple string replacements. Anyone have an idea of how to do this? Is there anything other than Ettercap that can do live replacement like this, maybe as a plugin to a VPN software or something? The rewriting should occur at the transport layer (Layer 4) as it does in this example, instead of a lower layer packet-based approach. Thanks!

    Read the article

  • Why is it when I set "closeOnEscape" to false and then "closeOnEscape" to true jquery dialog escape

    - by chobo2
    Hi I am using jquery ui 1.8 and I have a model dialog that popups up and if a user clicks on a checkbox another one comes up. This requires them to say "yes" or "no" so I removed the "X" on the dialog and put closeOnEscape to false. However I noticed when I did that the model dialog underneath it would close when they hit escape. So now when the one that pops up when the checkbox is checked I disable closeOnEscape on the first dialog box. When they close it I enable again yet it does not work. I am not sure why $("#Dialog").dialog( "option", "closeOnEscape", true); I even do this in firebug. I just open my first dialog up Do this in firebugs console $("#Dialog").dialog( "option", "closeOnEscape", false); Then verify that escape is now disabled. I then try to enable it again $("#Dialog").dialog( "option", "closeOnEscape", true); Yet it never enables.

    Read the article

  • Qt hide QLayout (switch between two layouts)

    - by Lodhart
    I didn't find solution for my problem with two QLayouts. I need app with QHBoxLayout with possible expandind when I will add new widgets, push buttons, .... So what I have: One QDialog and two layouts. Now I know that I can't hide the layout. So I tray just : layout()->removeItem(firstlayout); layout()->addLayout(secondLayout); But when I did this, I saw all items in first layout on possition [0,0]. So next step I try: for (all items in first layout) if (widget) widget->hide(); But this is working only with QWidget and I have many different items in layouts. Simply way is use the widget, because there is possibole to use hide/show, but I need auto expanding window when I add new items.

    Read the article

  • AudioOutputUnitStart takes time

    - by tokentoken
    Hello, I'm making an iPhone game application using Core Audio, Extended Audio File Services. It works OK, but when I first call AudioOutputUnitStart, it takes about 1-2 seconds. After the second call, no problem. For a game application, 1-2 seconds is very noticeable. (I tested this on iPhone simulator, and iPhone 3GS) Also, if I leave the game for about 10 seconds, first call of AudioOutputUnitStart also takes time. Maybe I have to call AudioOutputUnitStart beginning of the application to prevent the start-up time?

    Read the article

  • jQuery Load MySQL Fetch Array

    - by Robert Hanson
    I'm a beginner in jQuery area and I have simple question like this : I want to load (AJAX) MySQL result in array, let's say : $row[0] = first name $row[1] = last name $row[2] = phone number I have no problem with PHP part, but I have difficulties to display each of that array content on different id. because syntax I found loads everything processed by PHP : <script type="text/javascript"> $(document).ready(function(){ $('#mysql-result').load('ajax.php'); }); </script> how to get 'First Name', 'Last Name' and 'Phone Number' from PHP with only one time load and still I can put the result in different . thank you.

    Read the article

  • JQuery within a partial view not being called

    - by XN16
    I have a view that has some jQuery to load a partial view (via a button click) into a div in the view. This works without a problem. However within the partial view I have a very similar bit of jQuery that will load another partial view into a div in the first partial view, but this isn't working, it almost seems like the jQuery in the first partial view isn't being loaded. I have tried searching for solutions, but I haven't managed to find an answer. I have also re-created the jQuery function in a @Ajax.ActionLink which works fine, however I am trying to avoid the Microsoft helpers as I am trying to learn jQuery. Here is the first partial view which contains the jQuery that doesn't seem to work, it also contains the @Ajax.ActionLink that does work: @model MyProject.ViewModels.AddressIndexViewModel <script> $(".viewContacts").click(function () { $.ajax({ url: '@Url.Action("CustomerAddressContacts", "Customer")', type: 'POST', data: { addressID: $(this).attr('data-addressid') }, cache: false, success: function (result) { $("#customerAddressContactsPartial-" + $(this).attr('data-addressid')) .html(result); }, error: function () { alert("error"); } }); return false; }); </script> <table class="customers" style="width: 100%"> <tr> <th style="width: 25%"> Name </th> <th style="width: 25%"> Actions </th> </tr> </table> @foreach (Address item in Model.Addresses) { <table style="width: 100%; border-top: none"> <tr id="[email protected]"> <td style="width: 25%; border-top: none"> @Html.DisplayFor(modelItem => item.Name) </td> <td style="width: 25%; border-top: none"> <a href="#" class="viewContacts standardbutton" data-addressid="@item.AddressID">ContactsJQ</a> @Ajax.ActionLink("Contacts", "CustomerAddressContacts", "Customer", new { addressID = item.AddressID }, new AjaxOptions { UpdateTargetId = "customerAddressContactsPartial-" + @item.AddressID, HttpMethod = "POST" }, new { @class = "standardbutton"}) </td> </tr> </table> <div id="[email protected]"></div> } If someone could explain what I am doing wrong here and how to fix it then I would be very grateful. Thanks very much.

    Read the article

  • SSIS - user variable used in derived column transform is not available - in some cases

    - by soo
    Unfortunately I don't have a repro for my issue, but I thought I would try to describe it in case it sounds familiar to someone... I am using SSIS 2005, SP2. My package has a package-scope user variable - let's call it user_var first step in the control flow is an Execute SQL task which runs a stored procedure. All that SP does is insert a record in a SQL table (with an identity column) and then go back and get the max ID value. The Execute SQL task saves this output into user_var the control flow then has a Data Flow Task - it goes and gets some source data, has a derived column which sets a column called run_id to user_var - and saves the data to a SQL destination In most cases (this template is used for many packages, running every day) this all works great. All of the destination records created get set with a correct run_id. However, in some cases, there is a set of the destination data that does not get run_id equal to user_var, but instead gets a value of 0 (0 is the default value for user_var). I have 2 instances where this has happened, but I can't make it happen. In both cases, it was just less that 10,000 records that have run_id = 0. Since SSIS writes data out in 10,000 record blocks, this really makes me think that, for the first set of data written out, user_var was not yet set. Then, after that first block, for the rest of the data, run_id is set to a correct value. But control passed on to my data flow from the Execute SQL task - it would have seemed reasonable to me that it wouldn't go on until the SP has completed and user_var is set. Maybe it just runs the SP, but doesn't wait for it to complete? In both cases where this has happened there seemed to be a few packages hitting the table to get a new user_var at about the same time. And in both cases lots of data was written (40 million rows, 60 million rows) - my thinking is that that means the writes were happening for a while. Sorry to be both long-winded AND vague. A winning combination! Does this sound familiar to anyone? Thanks.

    Read the article

  • Find Lines with N occurrences of a char

    - by Martín Marconcini
    I have a txt file that I’m trying to import as flat file into SQL2008 that looks like this: “123456”,”some text” “543210”,”some more text” “111223”,”other text” etc… The file has more than 300.000 rows and the text is large (usually 200-500 chars), so scanning the file by hand is very time consuming and prone to error. Other similar (and even more complex files) were successfully imported. The problem with this one, is that “some lines” contain quotes in the text… (this came from an export from an old SuperBase DB that didn’t let you specify a text quantifier, there’s nothing I can do with the file other than clear it and try to import it). So the “offending” lines look like this: “123456”,”this text “contains” a quote” “543210”,”And the “above” text is bad” etc… You can see the problem here. Now, 300.000 is not too much if I could perform a search using a text editor that can use regex, I’d manually remove the quotes from each line. The problem is not the number of offending lines, but the impossibility to find them with a simple search. I’m sure there are less than 500, but spread those in a 300.000 lines txt file and you know what I mean. Based upon that, what would be the best regex I could use to identify these lines? My first thought is: Tell me which lines contain more than 4 quotes (“). But I couldn’t come up with anything (I’m not good at Regex beyond the basics).

    Read the article

  • (conditional) Multiple Event Handlers C#

    - by gjk
    A portion of my program requires a "flag" retrieval, that is I am fetching a value that is either True or False, and based on this return value two things could follow. 1) The flag is true, aka "go ahead", and I retrieve data from a database. 2) The flag is false, and I want to prevent the data from being retrieved. Now, this check has to be performed before any function that would call upon the database in question. I decided to implement this check in the form of an event handler attached to GUI objects that would trigger this data inquiry. This check event handler is called first upon necessary events, and my question is: How do I stop subsequent event handlers from firing if the FIRST event handler (my flag checker) comes up FALSE? Thanks

    Read the article

  • Mercurial: Recommended way of sending a whole repository to someone

    - by Svish
    I have done some programming and I have used Mercurial for source control. I now need to send all of my code to someone else (because they are going to take over). Since all copies of a mercurial repository is a full and real repository my first thought is to first do a clone of my repository without an update and then zipping and emailing that clone. Is this a good way, or is there a better way? For example when using the TortoiseHg Repository Explorer I can right-click on a changeset and under Export there are various options that looks like they could be doing something interesting, but I don't quite understand them or know which one to use.

    Read the article

  • Image error with wordpress and php

    - by bubdada
    It may seem stupid question, but i've a serious problem... if you could check out orcik.net the thumbnail images does not appear. I figured out the reason but I don't know how to solve.. http://orcik.net/projects/thumb/orcikthumb.php?src=http://orcik.net/wp-content/uploads/2010/05/mac-safari-search-cache.png If you go to the above link you will get page not found error. However, if you go to the link below you'll get the thumbnail version of the image... http://orcik.net/projects/thumb/orcikthumb.php?src=/wp-content/uploads/2010/05/mac-safari-search-cache.png I'm using this piece of code on wordpress and the line appears like <a href="<?php the_permalink() ?>" rel="bookmark"> <img src="<?php bloginfo('template_directory'); ?>/includes/orcikthumb.php?src=<?php get_thumbnail($post->ID, 'full'); ?>&amp;h=<?php echo get_theme_mod($height); ?>&amp;w=<?php echo get_theme_mod($width); ?>&amp;zc=1" alt="<?php the_title(); ?>" /> </a> Thus, I believe I can't change the directory of image. But I could not figure out why I am getting page not found error. Is that might be CHMOD'es??? or something else?? Thanks

    Read the article

  • Shared memory of same DLL in different 32 bit processes is sometimes different in a terminal session

    - by KBrusing
    We have an 32 bit application consisting of some processes. They communicate with shared memory of a DLL used by every process. Shared memory is build with global variables in C++ by "#pragma data_seg ("Shared")". When running this application sometime during starting a new process in addition to an existing (first) process we observe that the shared memory of both processes is not the same. All new started processes cannot communicate with the first process. After stopping all of our processes and restarting the application (with some processes) everything works fine. But sometime or other after successfully starting and finishing new processes the problem occurs again. Running on all other Windows versions or terminal sessions on Windows server 2003 our application never got this problem. Is there any new "feature" on Windows server 2008 that might disturb the hamony of our application?

    Read the article

  • Given a 2d array sorted in increasing order from left to right and top to bottom, what is the best w

    - by Phukab
    I was recently given this interview question and I'm curious what a good solution to it would be. Say I'm given a 2d array where all the numbers in the array are in increasing order from left to right and top to bottom. What is the best way to search and determine if a target number is in the array? Now, my first inclination is to utilize a binary search since my data is sorted. I can determine if a number is in a single row in O(log N) time. However, it is the 2 directions that throw me off. Another solution I could use, if I could be sure the matrix is n x n, is to start at the middle. If the middle value is less than my target, then I can be sure it is in the left square portion of the matrix from the middle. I then move diagnally and check again, reducing the size of the square that the target could potentially be in until I have honed in on the target number. Does anyone have any good ideas on solving this problem? Example array: Sorted left to right, top to bottom. 1 2 4 5 6 2 3 5 7 8 4 6 8 9 10 5 8 9 10 11

    Read the article

  • ontouch - Switching positions of two views(images) in Android

    - by idish
    I've been looking for that 2 days long and haven't found anything related to it. I'll give an example for my goal. Let's say I have 2 images positioned side by side horizontally. I want the user to be able to switch their positions onlongtouch listener. so let's say that the first image was on the left and the second was on the right side, after switching positions between them, the first image would be in the right and the second would be on the left side. Basically, it is just like in the launcher where you can switch apps positions. Please, if anything is not clear for you, I would like to know, and I'll try to explain it better, thank you.

    Read the article

  • xsl:variable xsl:copy-of select

    - by user1901345
    I have the following XML: Picture 1 Picture 2 Picture 3 While this XSL does what is expected (output the attr of the first picture): It seems to be not possible to do the same inside the variable declaration using xsl:copy-of: Curious: If I just select "$FirstPicture" instead of "$FirstPicture/@attr" in the second example, it outputs the text node of Picture 1 as expected... Before you all suggest me to rewrite the code: This is just a simplified test, my real aim is to use a named template to select a node into the variable FirstPicture and reuse it for further selections. I hope someone could help me to understand the behavior or could suggest me a proper way to select a node with code which could be easily reused (the decission which node is the first one is complex in my real application). Thanks.

    Read the article

  • Background loading javascript into iframe without using jQuery/Ajax?

    - by user210099
    I'm working on an offline only help system which requires loading a large amount of search-related data into an iframe before the search functionality can be used. Due to the folder structure of the project, I am unable to use Ajax-related background load methods, since the files I need are loaded a few directories "up and over." I have written some code which delays the loading of the help data until the rest of the webpage is loaded. The help data consists of a bunch of javascript files which have information about the terms, ect that exist in the help books which are installed on the system. The webpage works fine, until I start to load this help data into a hidden iframe. While the javascript files are loading, I can not use any of the webpage. Links that require a small files be downloaded for hover over effects don't show up, javascript (switching tabs on the page) has no effect. I'm wondering if this is just a limitation of the way javascript works, or if there's something else going on here. Once all the files are loaded for the help system, the webpage works as expected. function test(){ var MGCFrame = eval("parent.parent"); if((ALLFRAMESLOADED == true)){ t2 = MGCFrame.setTimeout("this.IHHeader.frames[0].loadData()",1); } else{ t1 = MGCFrame.setTimeout("this.IHHeader.frames[0].test()",1000); } } Load data simply starts the data loading process. Thanks for any help you can provide.

    Read the article

  • How do customize the g:sortableColumn?

    - by kakaotalk
    Well, I have one column in my list that I need to customize, the thing is grails' own g:sortable doesn't work. For instance, my first column shows employee ids, then my second column, shows the employees full name where full name is a combination of first name and last name. I got it to work, sorting and all, but when I try to place it in a table with g:sortable, the g:sortable just wouldn't work. I'm thinking about passing params around but it's a bit tricky. Any suggestions? I've looked around the internet, and seems like nothing. :\

    Read the article

  • Shall I optimize or let compiler to do that?

    - by Knowing me knowing you
    What is the preferred method of writing loops according to efficiency: Way a) /*here I'm hoping that compiler will optimize this code and won't be calling size every time it iterates through this loop*/ for (unsigned i = firstString.size(); i < anotherString.size(), ++i) { //do something } or maybe should I do it this way: Way b) unsigned first = firstString.size(); unsigned second = anotherString.size(); and now I can write: for (unsigned i = first; i < second, ++i) { //do something } the second way seems to me like worse option for two reasons: scope polluting and verbosity but it has the advantage of being sure that size() will be invoked once for each object. Looking forward to your answers.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

< Previous Page | 616 617 618 619 620 621 622 623 624 625 626 627  | Next Page >