Search Results

Search found 16927 results on 678 pages for 'little child'.

Page 631/678 | < Previous Page | 627 628 629 630 631 632 633 634 635 636 637 638  | Next Page >

  • How to replicate this button in CSS

    - by jasondavis
    I am trying to create a CSS theme switcher button like below. The top image shows what I have so far and the bottom image shows what I am trying to create. I am not the best at this stuff I am more of a back-end coder. I could really use some help. I have a live demo of the code here http://dabblet.com/gist/2230656 Just looking at what I have and the goal image, some differences. I need to add a gradient The border is not right on mine Radius is a little off Possibly some other stuff? Also here is the code...it can be changed anyway to improve this, the naming and stuff could be improved I am sure but I can use any help I can get. HTML <div class="switch-wrapper"> <div class="switcher left selected"> <span id="left">....</span> </div> <div class="switcher right"> <span id="right">....</span> </div> </div> CSS /* begin button styles */ .switch-wrapper{ width:400px; margin:220px; } .switcher { background:#507190; display: inline-block; max-width: 100%; box-shadow: 1px 1px 1px rgba(0,0,0,.3); position:relative; } #left, #right{ width:17px; height:11px; overflow:hidden; position:absolute; top:50%; left:50%; margin-top:-5px; margin-left:-8px; font: 0/0 a; } #left{ background-image: url(http://www.codedevelopr.com/assets/images/switcher.png); background-position: 0px px; } #right{ background-image: url(http://www.codedevelopr.com/assets/images/switcher.png); background-position: -0px -19px; } .left, .right{ width: 30px; height: 25px; border: 1px solid #3C5D7E; } .left{ border-radius: 6px 0px 0px 6px; } .right{ border-radius: 0 6px 6px 0; margin: 0 0 0 -6px } .switcher:hover, .selected { background: #27394b; box-shadow: -1px 1px 0px rgba(255,255,255,.4), inset 0 4px 5px rgba(0,0,0,.6), inset 0 1px 2px rgba(0,0,0,.6); }

    Read the article

  • Why the parent page get refreshed when I click the link to open thickbox-styled form?

    - by user333205
    Hi, all: I'm using Thickbox 3.1 to show signup form. The form content comes from jquery ajax post. The jquery lib is of version 1.4.2. I placed a "signup" link into a div area, which is a part of my other large pages, and the whole content of that div area is ajax+posted from my server. To make thickbox can work in my above arangement, I have modified the thickbox code a little like that: //add thickbox to href & area elements that have a class of .thickbox function tb_init(domChunk){ $(domChunk).live('click', function(){ var t = this.title || this.name || null; var a = this.href || this.alt; var g = this.rel || false; tb_show(t,a,g); this.blur(); return false; });} This modification is the only change against the original version. Beacause the "signup" link is placed in ajaxed content, so I Use live instead of binding the click event directly. When I tested on my pc, the thickbox works well. I can see the signup form quickly, without feeling the content of the parent page(here, is the other large pages) get refreshed. But after transmiting my site files into VHost, when I click the "signup" link, the signup form get presented very slowly. The large pages get refreshed evidently, because the borwser(ie6) are reloading images from server incessantly. These images are set as background images in CSS files. I think that's because the slow connection of network. But why the parent pages get refreshed? and why the browser reloads those images one more time? Havn't those images been placed in local computer's disk? Is there one way to stop that reloadding? Because the signup form can't get displayed sometimes due to slow connection of network. To verified the question, you can access http://www.juliantec.info/track-the-source.html and click the second link in left grey area, that is the "signup" link mentioned above. Thinks!

    Read the article

  • Recommended ASP.NET Shared Hosting

    - by coffeeaddict
    Ok, I have to admit I'm getting fed up with www.discountasp.net's pricing model and this annoyance has built up over the past 8 years or so. I've been with them for years and absolutely love them on the technical side, however it's getting ridiculously expensive for so little that you get. I mean here's my scenario: 1) I am running 2 SQL Server databases which costs me $10/ea per month so that's $20/month for 2 and I only get 500 mb disk space which is horrible 2) I am paying $10/mo just for the hosting itself which I only get 1 gig of disk space! I mean common! 3) I am simply running 2 small apps (Screwturn Wiki & Subtext Blog)...so I don't really care if it's up 99% or not, it's not worth paying a total of $300 just to keep these 2 apps running over discountasp.net Anyone else feel the same? Yes, I know they have great support, probably have great servers running behind this but in the end I really don't care as long as my site is up 95% or better. Yes, the hosting toolset rocks. But you know I bet you I can find a similar set somewhere else. I like how I can totally control IIS 7 at discountasp and I can control my own app pool etc. That's very powerful and essential. But anyone have any good alternatives to discountasp that gives me close to the same at a much more reasonable cost point? I mean http://www.m6.net/prices.aspx gives you 10 SQL Databases for $7 and 200 gigs disk space! I don't know about their tools or support but just looking at those numbers and some other hosts I've seen, I feel that discountasp.net is way out of line. They don't even offer any purchasing discounts such as it would be nice if my 2nd SQL Server is only $5/month not $10...stuff like this, to make it much more realistic and fair. Opinions (people who do have discountasp.net, people who have left them, or people who have another host they like)??? But geez $300 just to host a couple DBs and lightweight open source apps? Not worth the price they are charging. I'm almost at a price point that enables me to get a decent dedicated server! I really don't care about beta support. Not a big deal to me.

    Read the article

  • PHP echo query result in Class??

    - by Jerry
    Hi all I have a question about PHP Class. I am trying to get the result from Mysql via PHP. I would like to know if the best practice is to display the result inside the Class or store the result and handle it in html. For example, display result inside the Class class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); } while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ //display the result..ex: echo $row['winner']; } mysql_close($scheduleQuery); //no returns } } Or return the query result as a variable and handle in php class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); // create an array } $ret = array(); while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ $ret[]=$row; } mysql_close($scheduleQuery); return $ret; // and handle the return value in php } } Two things here: I found that returned variable in php is a little bit complex to play with since it is two dimension array. I am not sure what the best practice is and would like to ask you experts opinions. Every time I create a new method, I have to recreate the $connection variable: see below $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } It seems like redundant to me. Can I only do it once instead of calling it anytime I need a query? I am new to php class. hope you guys can help me. thanks.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Image animation problem in silverlight

    - by Jak
    Hi followed " http://www.switchonthecode.com/tutorials/silverlight-3-tutorial-planeprojection-and-perspective-3d#comment-4688 ".. the animation is working fine. I am new to silver light. when i use dynamic image from xml instead of static image as in tutorial,.. it is not working fine, please help me on this. i used list box.. for this animation effect do i need to change listbox to some other arrangement ? if your answer yes means, pls give me some sample code. Thanks in advance. Xaml code: <ListBox Name="listBox1"> <ListBox.ItemTemplate> <DataTemplate> <StackPanel> <Image Source="{Binding imgurl}" HorizontalAlignment="Left" Name="image1" Stretch="Fill" VerticalAlignment="Top" MouseLeftButtonUp="FlipImage" /> </StackPanel> </DataTemplate> </ListBox.ItemTemplate> </ListBox> My C# code: //getting image URL from xml XElement xmlads = XElement.Parse(e.Result); //i bind the url in to listBox listBox1.ItemsSource = from ads in xmlads.Descendants("ad") select new zestItem { imgurl = ads.Element("picture").Value }; public class zestItem { public string imgurl { get; set; } } private int _zIndex = 10; private void FlipImage(object sender, MouseButtonEventArgs e) { Image image = sender as Image; // Make sure the image is on top of all other images. image.SetValue(Canvas.ZIndexProperty, _zIndex++); // Create the storyboard. Storyboard flip = new Storyboard(); // Create animation and set the duration to 1 second. DoubleAnimation animation = new DoubleAnimation() { Duration = new TimeSpan(0, 0, 1) }; // Add the animation to the storyboard. flip.Children.Add(animation); // Create a projection for the image if it doesn't have one. if (image.Projection == null) { // Set the center of rotation to -0.01, which will put a little space // between the images when they're flipped. image.Projection = new PlaneProjection() { CenterOfRotationX = -0.01 }; } PlaneProjection projection = image.Projection as PlaneProjection; // Set the from and to properties based on the current flip direction of // the image. if (projection.RotationY == 0) { animation.To = 180; } else { animation.From = 180; animation.To = 0; } // Tell the animation to animation the image's PlaneProjection object. Storyboard.SetTarget(animation, projection); // Tell the animation to animation the RotationYProperty. Storyboard.SetTargetProperty(animation, new PropertyPath(PlaneProjection.RotationYProperty)); flip.Begin(); }

    Read the article

  • A question about making a C# class persistent during a file load

    - by Adam
    Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

    Read the article

  • .NET Extension Objects with XSLT -- how to iterate over a collection?

    - by Pandincus
    Help me, Stackoverflow! I have a simple .NET 3.5 console app that reads some data and sends emails. I'm representing the email format in an XSLT stylesheet so that we can easily change the wording of the email without needing to recompile the app. We're using Extension Objects to pass data to the XSLT when we apply the transformation: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" xmlns:EmailNotification="ext:EmailNotification"> -- this way, we can have statements like: <p> Dear <xsl:value-of select="EmailNotification:get_FullName()" />: </p> The above works fine. I pass the object via code like this (some irrelevant code omitted for brevity): // purely an example structure public struct EmailNotification { public string FullName { get; set; } } // Somewhere in some method ... var notification = new Notification("John Smith"); // ... XsltArgumentList xslArgs = new XsltArgumentList(); xslArgs.AddExtensionObject("ext:EmailNotification", notification); // ... // The part where it breaks! (This is where we do the transformation) xslt.Transform(fakeXMLDocument.CreateNavigator(), xslArgs, XmlWriter.Create(transformedXMLString)); So, all of the above code works. However, I wanted to get a little fancy (always my downfall) and pass a collection, so that I could do something like this: <p>The following accounts need to be verified:</p> <xsl:for-each select="EmailNotification:get_SomeCollection()"> <ul> <li> <xsl:value-of select="@SomeAttribute" /> </li> </ul> <xsl:for-each> When I pass the collection in the extension object and attempt to transform, I get the following error: "Extension function parameters or return values which have Clr type 'String[]' are not supported." or List, or IEnumerable, or whatever I try to pass in. So, my questions are: How can I pass in a collection to my XSLT? What do I put for the xsl:value-of select="" inside the xsl:for-each ? Is what I am trying to do impossible?

    Read the article

  • text in textbox shows up as circles instead of regular characters?

    - by BlueMonster
    When i type in either of the textboxes i get little circles appearing instead of text. Why is this happening and how do i stop it? Code is as follows: HTML: <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="MainPage.aspx.cs" Inherits="Foods.MainPage" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <link id="Link1" rel="stylesheet" type="text/css" href="Styles/mainStyle.css"/> </head> <body> <form id="form1" runat="server"> <div class = "userIDTboxDiv"> <div class = "userIDTboxText"> &nbsp;&nbsp;&nbsp; Enter User ID: </div> <asp:TextBox id="userIDBox" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> <div class = "passwordTboxDiv"> <div class = "passwordTboxText"> &nbsp;&nbsp;&nbsp; Enter User Password: </div> <asp:TextBox id="TextBox1" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> </form> </body> CSS: body { text-decoration:none; background: white; } input { margin-left: 0px; margin-top: 7px; } .userIDTboxDiv { padding-top: 20%; padding-left: 45%; width: 15%; height: 30%; } .userIDTboxText { padding-left: 17%; height: auto; width:203px; } .passwordTboxDiv { padding-top: 2%; padding-left: 45%; width: 15%; height: 111px; } .passwordTboxText { padding-left: 10%; height: auto; width:203px; }

    Read the article

  • Jumping into argv?

    - by jth
    Hi, I`am experimenting with shellcode and stumbled upon the nop-slide technique. I wrote a little tool that takes buffer-size as a parameter and constructs a buffer like this: [ NOP | SC | RET ], with NOP taking half of the buffer, followed by the shellcode and the rest filled with the (guessed) return address. Its very similar to the tool aleph1 described in his famous paper. My vulnerable test-app is the same as in his paper: int main(int argc, char **argv) { char little_array[512]; if(argc>1) strcpy(little_array,argv[1]); return 0; } I tested it and well, it works: jth@insecure:~/no_nx_no_aslr$ ./victim $(./exploit 604 0) $ exit But honestly, I have no idea why. Okay, the saved eip was overwritten as intended, but instead of jumping somewhere into the buffer, it jumped into argv, I think. gdb showed up the following addresses before strcpy() was called: (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x80483ed in main (victim.c:7); saved eip 0x154b56 source language c. Arglist at 0xbffff1e8, args: argc=2, argv=0xbffff294 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec Address of little_array: (gdb) print &little_array[0] $1 = 0xbfffefe8 "\020" After strcpy(): (gdb) i f Stack level 0, frame at 0xbffff1f0: eip = 0x804840d in main (victim.c:10); saved eip 0xbffff458 source language c. Arglist at 0xbffff1e8, args: argc=-1073744808, argv=0xbffff458 Locals at 0xbffff1e8, Previous frame's sp is 0xbffff1f0 Saved registers: ebp at 0xbffff1e8, eip at 0xbffff1ec So, what happened here? I used a 604 byte buffer to overflow little_array, so he certainly overwrote saved ebp, saved eip and argc and also argv with the guessed address 0xbffff458. Then, after returning, EIP pointed at 0xbffff458. But little_buffer resides at 0xbfffefe8, that`s a difference of 1136 byte, so he certainly isn't executing little_array. I followed execution with the stepi command and well, at 0xbffff458 and onwards, he executes NOPs and reaches the shellcode. I'am not quite sure why this is happening. First of all, am I correct that he executes my shellcode in argv, not little_array? And where does the loader(?) place argv onto the stack? I thought it follows immediately after argc, but between argc and 0xbffff458, there is a gap of 620 bytes. How is it possible that he successfully "lands" in the NOP-Pad at Address 0xbffff458, which is way above the saved eip at 0xbffff1ec? Can someone clarify this? I have actually no idea why this is working. My test-machine is an Ubuntu 9.10 32-Bit Machine without ASLR. victim has an executable stack, set with execstack -s. Thanks in advance.

    Read the article

  • PHP - JSON Steam API query

    - by Hunter
    First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

    Read the article

  • Coping with feelings of technical mediocrity

    - by Karim
    As I've progressed as a programmer, I noticed more nuance and areas I could study in depth. In part, I've come to think of myself from, at one point, a "guru" to now much less, even mediocre or inadequate. Is this normal, or is it a sign of a destructive excessive ambition? Background I started to program when I was still a kid, I had about 10 or 11 years. I really enjoy my work and never get bored from it. It's amazing how somebody could be paid for what he really likes to do and would be doing it anyway even for free. When I first started to program, I was feeling proud of what I was doing, each application I built was for me a success and after 2-3 year I had a feeling that I'm a coding guru. It was a nice feeling. ;-) But the more I was in the field and the more types of software I started to develop, I was starting to have a feeling that I'm completely wrong in thinking I'm a guru. I felt that I'm not even a mediocre developer. Each new field I start to work on is giving me this feeling. Like when I once developed a device driver for a client, I saw how much I need to learn about device drivers. When I developed a video filter for an application, I saw how much do I still need to learn about DirectShow, Color Spaces, and all the theory behind that. The worst thing was when I started to learn algorithms. It was several years ago. I knew then the basic structures and algorithms like the sorting, some types of trees, some hashtables, strings, etc. and when I really wanted to learn a group of structures I learned about 5-6 new types and saw that in fact even this small group has several hundred subtypes of structures. It's depressing how little time people have in their lives to learn all this stuff. I'm now a software developer with about 10 years of experience and I still feel that I'm not a proficient developer when I think about things that others do in the industry.

    Read the article

  • How can I improve the recursion capabilities of my ECMAScript implementation?

    - by ChaosPandion
    After some resent tests I have found my implementation cannot handle very much recursion. Although after I ran a few tests in Firefox I found that this may be more common than I originally thought. I believe the basic problem is that my implementation requires 3 calls to make a function call. The first call is made to a method named Call that makes sure the call is being made to a callable object and gets the value of any arguments that are references. The second call is made to a method named Call which is defined in the ICallable interface. This method creates the new execution context and builds the lambda expression if it has not been created. The final call is made to the lambda that the function object encapsulates. Clearly making a function call is quite heavy but I am sure that with a little bit of tweaking I can make recursion a viable tool when using this implementation. public static object Call(ExecutionContext context, object value, object[] args) { var func = Reference.GetValue(value) as ICallable; if (func == null) { throw new TypeException(); } if (args != null && args.Length > 0) { for (int i = 0; i < args.Length; i++) { args[i] = Reference.GetValue(args[i]); } } var reference = value as Reference; if (reference != null) { if (reference.IsProperty) { return func.Call(reference.Value, args); } else { return func.Call(((EnviromentRecord)reference.Value).ImplicitThisValue(), args); } } return func.Call(Undefined.Value, args); } public object Call(object thisObject, object[] arguments) { var lexicalEnviroment = Scope.NewDeclarativeEnviroment(); var variableEnviroment = Scope.NewDeclarativeEnviroment(); var thisBinding = thisObject ?? Engine.GlobalEnviroment.GlobalObject; var newContext = new ExecutionContext(Engine, lexicalEnviroment, variableEnviroment, thisBinding); Engine.EnterContext(newContext); var result = Function.Value(newContext, arguments); Engine.LeaveContext(); return result; }

    Read the article

  • How to properly preload images, js and css files?

    - by Kenny Bones
    Hi, I'm creating a website from scratch and I was really into this in the late 90's but the web has changed alot since then! And I'm more of a designer so when I started putting this site together, I basically did a system of php includes to make the site more "dynamic" When you first visit the site, you'll be presented to a logon screen, if you're not already logged on (cookies). If you're not logged on, a page called access.php is introdused. I thought I'd preload the most heavy images at this point. So that when the user is done logging on, the images are already cached. And this is working as I want. But I still notice that the biggest image still isn't rendered immediatly anyway. So it's seems kinda pointless. All of this has made me rethink how the site is structured and how scripts and css files are loaded. Using FireBug and YSlow with Firefox I see a few pointers like expires headers and reducing the size of each script. But is this really the culprit? For example, would this be really really stupid in the main index.php? The entire site is basically structured like this <?php require("dbconnect.php"); ?> <?php include ("head.php"); ?> And below this is basically just the body and the content of the site. Head.php however consists of the doctype, head portions, linking of two css style sheets, jQuery library, jQuery validation engine, Cufon and Cufon font file, and then the small Cufon.Replace snippet. The rest of the body comes with the index.php file, but at the bottom of this again is an include of a file called "footer.php" which basically consists of loading of a couple of jsLoader scripts and a slidepanel and then a js function. All of this makes the end page source look like a typical complete webpage, but I'm wondering if any of you can see immediatly that "this is really really stupid" and "don't do that, do this instead" etc. :) Are includes a bad way to go? This site is also pretty image intensive and I can probably do a little more optimization. But I don't think that's its the primary culprit. YSlow gives me a report of what takes up the most space: doc(1) - 5.8K js(5) - 198.7K css(2) - 5.6K cssimage(8) - 634.7K image(6) - 110.8K I know it looks like it's cssimage(8) that weighs the most, but I've already preloaded these images from before and it doesn't really affect the rendering.

    Read the article

  • CSS selectors : should I minimise my use of the class attribute in the HTML or optimise the speed

    - by Laurent Bourgault-Roy
    As I was working on a small website, I decided to use the PageSpeed extension to check if their was some improvement I could do to make the site load faster. However I was quite surprise when it told me that my use of CSS selector was "inefficient". I was always told that you should keep the usage of the class attribute in the HTML to a minimum, but if I understand correctly what PageSpeed tell me, it's much more efficient for the browser to match directly against a class name. It make sense to me, but it also mean that I need to put more CSS classes in my HTML. It also make my .css file a little harder to read. I usually tend to mark my CSS like this : #mainContent p.productDescription em.priceTag { ... } Which make it easy to read : I know this will affect the main content and that it affect something in a paragraph tag (so I wont start to put all sort of layout code in it) that describe a product and its something that need emphasis. However it seem I should rewrite it as .priceTag { ... } Which remove all context information about the style. And if I want to use differently formatted price tag (for example, one in a list on the sidebar and one in a paragraph), I need to use something like that .paragraphPriceTag { ... } .listPriceTag { ... } Which really annoy me since I seem to duplicate the semantic of the HTML in my classes. And that mean I can't put common style in an unqualified .priceTag { ... } and thus I need to replicate the style in both CSS rule, making it harder to make change. (Altough for that I could use multiple class selector, but IE6 dont support them) I believe making code harder to read for the sake of speed has never been really considered a very good practice . Except where it is critical, of course. This is why people use PHP/Ruby/C# etc. instead of C/assembly to code their site. It's easier to write and debug. So I was wondering if I should stick with few CSS classes and complex selector or if I should go the optimisation route and remove my fancy CSS selectors for the sake of speed? Does PageSpeed make over the top recommandation? On most modern computer, will it even make a difference?

    Read the article

  • Running OpenMPI on Windows XP

    - by iamweird
    Hi there. I'm trying to build a simple cluster based on Windows XP. I compiled OpenMPI-1.4.2 successfully, and tools like mpicc and ompi_info work too, but I can't get my mpirun working properly. The only output I can see is Z:\orterun --hostfile z:\hosts.txt -np 2 hostname [host0:04728] Failed to initialize COM library. Error code = -2147417850 [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\mca\ess\hnp\ess_hnp_module.c at line 218 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_plm_init failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\runtime\orte_init.c at line 132 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_ess_set_name failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\..\..\openmpi -1.4.2\orte\tools\orterun\orterun.c at line 543 Where z:\hosts.txt appears as follows: host0 host1 Z: is a shared network drive available to both host0 and host1. What my problem is and how do I fix it? Upd: Ok, this problem seems to be fixed. It seems to me that WideCap driver and/or software components causes this error to appear. A "clean" machine runs local task successfully. Anyway, I still cannot run a task within at least 2 machines, I'm getting following message: Z:\mpirun --hostfile z:\hosts.txt -np 2 hostname connecting to host1 username:cluster password:******** Save Credential?(Y/N) y [host0:04728] This feature hasn't been implemented yet. [host0:04728] Could not connect to namespace cimv2 on node host1. Error code =-2147024891 -------------------------------------------------------------------------- mpirun was unable to start the specified application as it encountered an error. More information may be available above. -------------------------------------------------------------------------- I googled a little and did all the things as described here: http://www.open-mpi.org/community/lists/users/2010/03/12355.php but I'm still getting the same error. Can anyone help me? Upd2: Error code -2147024891 might be WMI error WBEM_E_INVALID_PARAMETER (0x80041008) which occures when one of the parameters passed to the WMI call is not correct. Does this mean that the problem is in OpenMPI source code itself? Or maybe it's because of wrong/outdated wincred.h and credui.lib I used while building OpenMPI from the source code?

    Read the article

  • How do I remove elements from a jQuery wrapped set

    - by Bungle
    I'm a little confused about which jQuery method and/or selectors to use when trying to select an element, and then remove certain descendant elements from the wrapped set. For example, given the following HTML: <div id="article"> <div id="inset"> <ul> <li>This is bullet point #1.</li> <li>This is bullet point #2.</li> <li>This is bullet point #3.</li> </ul> </div> <p>This is the first paragraph of the article</p> <p>This is the second paragraph of the article</p> <p>This is the third paragraph of the article</p> </div> I want to select the article: var $article = $('#article'); but then remove <div id="inset"></div> and its descendants from the wrapped set. I tried the following: var $article = $('#article').not('#inset'); but that didn't work, and in retrospect, I think I can see why. I also tried using remove() unsuccessfully. What would be the correct way to do this? Ultimately, I need to set this up in such a way that I can define a configuration array, such as: var selectors = [ { select: '#article', exclude: ['#inset'] } ]; where select defines a single element that contains text content, and exclude is an optional array that defines one or more selectors to disregard text content from. Given the final wrapped set with the excluded elements removed, I would like to be able to call jQuery's text() method to end up with the following text: This is the first paragraph of the article.This is the second paragraph of the article.This is the third paragraph of the article. The configuration array doesn't need to work exactly like that, but it should provide roughly equivalent configuration potential. Thanks for any help you can provide!

    Read the article

  • PHP script causes segmentation fault then the browser asks me to download the .php file with nothing in it?

    - by John
    I've noticed an unusual problem with some of my php programs. Sometimes when visiting a page like profile.edit.php, the browser throws a dialogue box asking to download profile.edit.php page. When I download it, there's nothing in the file. profile.edit.php is supposed to be a web form that edits user information. I've noticed this on some of my other php pages as well. I look in my apache error logs, and I see a segmentation fault message: [Mon Mar 08 15:40:10 2010] [notice] child pid 480 exit signal Segmentation fault (11) And also, the issue may or may not appear depending on which server I deploy my application too. Additonal Details This doesn't happen all the time though. It only happens sometimes. For example, profile.edit.php will load properly. But as soon as I hit the save button (form action="profile.edit.php?save=true"), then the page asks me to download profile.edit.php. Could it be that sometimes my php scripts consume too much resources? Sample code Upon save action, my profile.edit.php includes a data_access_object.php file. I traced the code in data_access_object.php to this line here if($params[$this->primaryKey]) { $q = "UPDATE $this->tableName SET ".implode(', ', $fields)." WHERE ".$this->primaryKey." = ?$this->primaryKey"; $this->bind($this->primaryKey, $params[$this->primaryKey], $this->tblFields[$this->primaryKey]['mysqlitype']); } else { $q = "INSERT $this->tableName SET ".implode(', ', $fields); } // Code executes perfectly up to this point // echo 'print this'; exit; // if i uncomment this line, profile.edit.php will actually show 'print this'. If I leave it commented, the browser will ask me to download profile.edit.php if(!$this->execute($q)){ $this->errorSave = -3; return false;} // When I jumped into the function execute(), every line executed as expected, right up to the return statement. And if it helps, here's the function execute($sql) in data_access_object.php function execute($sql) { // find all list types and explode them // eg. turn ?listId into ?listId0,?listId1,?listId2 $arrListParam = array_bubble_up('arrayName', $this->arrBind); foreach($arrListParam as $listName) if($listName) { $explodeParam = array(); $arrList = $this->arrBind[$listName]['value']; foreach($arrList as $key=>$val) { $newParamName = $listName.$key; $this->bind($newParamName,$val,$this->arrBind[$listName]['type']); $explodeParam[] = '?'.$newParamName; } $sql = str_replace("?$listName", implode(',',$explodeParam), $sql); } // replace all ?varName with ? for syntax compliance $sqlParsed = preg_replace('/\?[\w\d_\.]+/', '?', $sql); $this->stmt->prepare($sqlParsed); // grab all the parameters from the sql to create bind conditions preg_match_all('/\?[\w\d_\.]+/', $sql, $matches); $matches = $matches[0]; // store bind conditions $types = ''; $params = array(); foreach($matches as $paramName) { $types .= $this->arrBind[str_replace('?', '', $paramName)]['type']; $params[] = $this->arrBind[str_replace('?', '', $paramName)]['value']; } $input = array('types'=>$types) + $params; // bind it if(!empty($types)) call_user_func_array(array($this->stmt, 'bind_param'), $input); $stat = $this->stmt->execute(); if($GLOBALS['DEBUG_SQL']) echo '<p style="font-weight:bold;">SQL error after execution:</p> ' . $this->stmt->error.'<p>&nbsp;</p>'; $this->arrBind = array(); return $stat; }

    Read the article

  • How to get a physics engine like Nape working?

    - by Glacius
    Introduction: I think Nape is a relatively new engine so some of you may not know it. It's supposedly faster than box2d and I like that there is decent documentation. Here's the site: http://code.google.com/p/nape/ I'm relatively new to programming. I am decent at AS3's basic functionality, but every time I try to implement some kind of engine or framework I can't even seem to get it to work. With Nape I feel I got a little further than before but I still got stuck. My problem: I'm using Adobe CS5, I managed to import the SWC file like described here. Next I tried to copy the source of one of the demo's like this one and get it to work but I keep getting errors. I made a new class file, copied the demo source to it, and tried to add it to the stage. My stage code basically looks like this: import flash.Boot; // these 2 lines are as described in the tutorial new Boot(); var demo = new Main(); // these 2 are me guessing what I'm supposed to do addChild(demo); Well, it seems the source code is not even being recognized by flash as a valid class file. I tried editing it, but even if I get it recognized (give a package name and add curly brackets) but I still get a bunch of errors. Is it psuedo code or something? What is going on? My goal: I can imagine I'm going about this the wrong way. So let me explain what I'm trying to achieve. I basically want to learn how to use the engine by starting from a simple basic example that I can edit and mess around with. If I can't even get a working example then I'm unable to learn anything. Preferably I don't want to start using something like FlashDevelop (as I'd have to learn how to use the program) but if it can't be helped then I can give it a try. Thank you.

    Read the article

  • Backbone.js (model instanceof Model) via Chrome Extension

    - by Leoncelot
    Hey guys, This is my first time ever posting on this site and the problem I'm about to pose is difficult to articulate due to the set of variables required to arrive at it. Let me just quickly explain the framework I'm working with. I'm building a Chrome Extension using jQuery, jQuery-ui, and Backbone The entire JS suite for the extension is written in CoffeeScript and I'm utilizing Rails and the asset pipeline to manage it all. This means that when I want to deploy my extension code I run rake assets:precompile and copy the resulting compressed JS to my extensions Directory. The nice thing about this approach is that I can actually run the extension js from inside my Rails app by including the library. This is basically the same as my extensions background.js file which injects the js as a content script. Anyway, the problem I've recently encountered was when I tried testing my extension on my buddy's site, whiskeynotes.com. What I was noticing is that my backbone models were being mangled upon adding them to their respective collections. So something like this.collection.add(new SomeModel) created some nonsense version of my model. This code eventually runs into Backbone's prepareModel code _prepareModel: function(model, options) { options || (options = {}); if (!(model instanceof Model)) { var attrs = model; options.collection = this; model = new this.model(attrs, options); if (!model._validate(model.attributes, options)) model = false; } else if (!model.collection) { model.collection = this; } return model; }, Now, in most of the sites on which I've tested the extension, the result is normal, however on my buddy's site the !(model instance Model) evaluates to true even though it is actually an instance of the correct class. The consequence is a super messed up version of the model where the model's attributes is a reference to the models collection (strange right?). Needless to say, all kinds of crazy things were happening afterward. Why this is occurring is beyond me. However changing this line (!(model instanceof Model)) to (!(model instanceof Backbone.Model)) seems to fix the problem. I thought maybe it had something to do with the Flot library (jQuery graph library) creating their own version of 'Model' but looking through the source yielded no instances of it. I'm just curious as to why this would happen. And does it make sense to add this little change to the Backbone source? Update: I just realized that the "fix" doesn't actually work. I can also add that my backbone Models are namespaced in a wrapping object so that declaration looks something like class SomeNamespace.SomeModel extends Backbone.Model

    Read the article

  • Unit Testing - Am I doing it right?

    - by baron
    Hi everyone, Basically I have been programing for a little while and after finishing my last project can fully understand how much easier it would have been if I'd have done TDD. I guess I'm still not doing it strictly as I am still writing code then writing a test for it, I don't quite get how the test becomes before the code if you don't know what structures and how your storing data etc... but anyway... Kind of hard to explain but basically lets say for example I have a Fruit objects with properties like id, color and cost. (All stored in textfile ignore completely any database logic etc) FruitID FruitName FruitColor FruitCost 1 Apple Red 1.2 2 Apple Green 1.4 3 Apple HalfHalf 1.5 This is all just for example. But lets say I have this is a collection of Fruit (it's a List<Fruit>) objects in this structure. And my logic will say to reorder the fruitids in the collection if a fruit is deleted (this is just how the solution needs to be). E.g. if 1 is deleted, object 2 takes fruit id 1, object 3 takes fruit id2. Now I want to test the code ive written which does the reordering, etc. How can I set this up to do the test? Here is where I've got so far. Basically I have fruitManager class with all the methods, like deletefruit, etc. It has the list usually but Ive changed hte method to test it so that it accepts a list, and the info on the fruit to delete, then returns the list. Unit-testing wise: Am I basically doing this the right way, or have I got the wrong idea? and then I test deleting different valued objects / datasets to ensure method is working properly. [Test] public void DeleteFruit() { var fruitList = CreateFruitList(); var fm = new FruitManager(); var resultList = fm.DeleteFruitTest("Apple", 2, fruitList); //Assert that fruitobject with x properties is not in list ? how } private static List<Fruit> CreateFruitList() { //Build test data var f01 = new Fruit {Name = "Apple",Id = 1, etc...}; var f02 = new Fruit {Name = "Apple",Id = 2, etc...}; var f03 = new Fruit {Name = "Apple",Id = 3, etc...}; var fruitList = new List<Fruit> {f01, f02, f03}; return fruitList; }

    Read the article

  • how to change color of text following function in javascript

    - by OVERTONE
    Ok before i make spaghetti of this code i thought id ask around here. ive made a quiz for an online site. The answers are stored in an array, and ive a function that checks the answers array to what youve clicked. then it counts them and gives you your score. but i want to change the clor of the right answer wen the user clicks the score button. so the correct answers are highlighted. something like this https://www.shutterpoint.com/Home-Quiz.cfm (just hit submit at the bottom, no need to do the quiz). the little answer icon at the side looks flashy but id rather just have the text change color. heres how my questions are formatted <p>Depth of field is controlled by :?</p> <p id = "question2"><input type="radio" name="question2" id="Answer1" value = "a" onClick ="recordAnswer(2,this.value)"/> The focal length of the lens. <br/> <input type="radio" name="question2" id="Answer2" value = "b" onClick = "recordAnswer(2,this.value)"/> The size of the aperture opening. <br/> <input type="radio" name="question2" id="Answer3" value = "c" onClick = "recordAnswer(2,this.value)"/> The distance between the camera and lens. <br/> <input type="radio" name="question2" id="Answer4" value = "d" onClick = "recordAnswer(2,this.value)"/> All of these. <br/></p> and these are the two functions that are called throughout. record answer is called every time the user clicks a button function recordAnswer(question,answer) { answers[question-1] = answer; } this is the final button which calculates the score function scoreQuiz() { var totalCorrect = 0; for(var count = 0; count<correctAnswers.length;count++) { if(answers[count]== correctAnswers[count]) totalCorrect++; } <!-- alert("You scored " + totalCorrect + " out of 12 correct!"); --> } another function is best i think. ive already made attemots at it and know i have to set the color using document.getElementById('question2').style.color = '#0000ff'; question2 being the p id i think if i take in the value part of (input type....) ill be able to compare it to the answers array. but im not quite sure how to do this. any helpers? maybe something like this document.getElementById("Answer1").style.color = '#0000ff'; using the id part of the (input type line) i think i got it actually. ill post my answer in a sec

    Read the article

  • How do you place an Excel Sheet/Workbook onto a C# .NET Winform?

    - by incognick
    I am trying to create a stand alone application in Visual Studio 2008 C# .Net that will house Excel Workbooks (2007). I am using Office.Interop in order to create the Excel application and I open the workbooks via Workbooks.Open(...). The Interop does not provide any functionality to "move" the workbooks onto a form so I turned to P/Invoke Win32 library. I am able to move the entire excel application onto a WinForm with great success: // pseudo code to give you the idea excel = new Excel.ApplicationClass(); SetParent(excel.Hwnd, form.handle); This allows me to customize the form and control user input. All right click commands and formula editing work properly. Now, the issue I run into is when I want to open two workbooks in two separate forms. I do this by creating two excel application classes and placing each of those in their own form. When I try to reference one workbook to another workbook via =[Book2]Sheet1!A1, for example, it does not update. This is expected as each application is running under its own thread/process. Here are the alternatives I have tried. If you have any suggestions I would be greatly appreciative.(OLE is not an option. VSTO must be available) Create a single application class and move the workbook window into my form. Results: The window moves into my form and displays correctly, however, no right click or left click works on the form and it never gains focus. (I have tried to manually set focus and it does not work either). My guess is, by moving the window outside of the XLDESK application (viewable in Spy++ for Excel Application), the workbook application (EXCEL7) does not receive the correct window messages to gain focus and to behave properly. This leads me to: Move the XLDESK window handle into my form. Results: This allows the workbook to be click-able again but also has an undesired result of moving all child windows into the same form. Create a main excel application that creates workbooks. Create a new excel application for each new window. Move the workbook under the new excel application XLDESK window. Results: This also has the same effect of the 1st option. Unable to click in the workbook. This must mean that the thread that created the workbook is also responsible for the events. Create a windows hook that watches the WndProc procedure. Results: No events watched. The targeted thread must export the hook proc in a DLL export call. Excel does not do this and thus you cannot inject into it's DLL (unless someone can prove me wrong). I am able to watch all threads within my own process but not from an outside process. Excel is created as a separate process. Subclass NativeWindow. Results: Same as #4. After I move the window into my form, all events are captured up until the mouse is directly over the excel sheet making the sheet seem unclickable. One idea I haven't tried yet is just to continually save the excel sheet as the user edits it. This should update all references but I would feel this would cause poor system performance. There will be numerous chart references as well and I'm not sure if this solution would cause problems further down the road. I think in the end, all the workbooks need to be created by the same Excel Application and then moved to get the desired results but I can't seem to find the correct way to move the windows without disabling the user input in the process. Any suggestions?

    Read the article

  • thread management in nbody code of cuda-sdk

    - by xnov
    When I read the nbody code in Cuda-SDK, I went through some lines in the code and I found that it is a little bit different than their paper in GPUGems3 "Fast N-Body Simulation with CUDA". My questions are: First, why the blockIdx.x is still involved in loading memory from global to share memory as written in the following code? for (int tile = blockIdx.y; tile < numTiles + blockIdx.y; tile++) { sharedPos[threadIdx.x+blockDim.x*threadIdx.y] = multithreadBodies ? positions[WRAP(blockIdx.x + q * tile + threadIdx.y, gridDim.x) * p + threadIdx.x] : //this line positions[WRAP(blockIdx.x + tile, gridDim.x) * p + threadIdx.x]; //this line __syncthreads(); // This is the "tile_calculation" function from the GPUG3 article. acc = gravitation(bodyPos, acc); __syncthreads(); } isn't it supposed to be like this according to paper? I wonder why sharedPos[threadIdx.x+blockDim.x*threadIdx.y] = multithreadBodies ? positions[WRAP(q * tile + threadIdx.y, gridDim.x) * p + threadIdx.x] : positions[WRAP(tile, gridDim.x) * p + threadIdx.x]; Second, in the multiple threads per body why the threadIdx.x is still involved? Isn't it supposed to be a fix value or not involving at all because the sum only due to threadIdx.y if (multithreadBodies) { SX_SUM(threadIdx.x, threadIdx.y).x = acc.x; //this line SX_SUM(threadIdx.x, threadIdx.y).y = acc.y; //this line SX_SUM(threadIdx.x, threadIdx.y).z = acc.z; //this line __syncthreads(); // Save the result in global memory for the integration step if (threadIdx.y == 0) { for (int i = 1; i < blockDim.y; i++) { acc.x += SX_SUM(threadIdx.x,i).x; //this line acc.y += SX_SUM(threadIdx.x,i).y; //this line acc.z += SX_SUM(threadIdx.x,i).z; //this line } } } Can anyone explain this to me? Is it some kind of optimization for faster code?

    Read the article

  • Calculate minimum moves to solve a puzzle

    - by Luke
    I'm in the process of creating a game where the user will be presented with 2 sets of colored tiles. In order to ensure that the puzzle is solvable, I start with one set, copy it to a second set, then swap tiles from one set to another. Currently, (and this is where my issue lies) the number of swaps is determined by the level the user is playing - 1 swap for level 1, 2 swaps for level 2, etc. This same number of swaps is used as a goal in the game. The user must complete the puzzle by swapping a tile from one set to the other to make the 2 sets match (by color). The order of the tiles in the (user) solved puzzle doesn't matter as long as the 2 sets match. The problem I have is that as the number of swaps I used to generate the puzzle approaches the number of tiles in each set, the puzzle becomes easier to solve. Basically, you can just drag from one set in whatever order you need for the second set and solve the puzzle with plenty of moves left. What I am looking to do is after I finish building the puzzle, calculate the minimum number of moves required to solve the puzzle. Again, this is almost always less than the number of swaps used to create the puzzle, especially as the number of swaps approaches the number of tiles in each set. My goal is to calculate the best case scenario and then give the user a "fudge factor" (i.e. 1.2 times the minimum number of moves). Solving the puzzle in under this number of moves will result in passing the level. A little background as to how I currently have the game configured: Levels 1 to 10: 9 tiles in each set. 5 different color tiles. Levels 11 to 20: 12 tiles in each set. 7 different color tiles. Levels 21 to 25: 15 tiles in each set. 10 different color tiles. Swapping within a set is not allowed. For each level, there will be at least 2 tiles of a given color (one for each set in the solved puzzle). Is there any type of algorithm anyone could recommend to calculate the minimum number of moves to solve a given puzzle?

    Read the article

< Previous Page | 627 628 629 630 631 632 633 634 635 636 637 638  | Next Page >