Search Results

Search found 16794 results on 672 pages for 'memory usage'.

Page 636/672 | < Previous Page | 632 633 634 635 636 637 638 639 640 641 642 643  | Next Page >

  • Why an object declared in method is subject to garbage collection before the method returns?

    - by SiLent SoNG
    Consider an object declared in a method: public void foo() { final Object obj = new Object(); // A long run job that consumes tons of memory and // triggers garbage collection } Will obj be subject to garbage collection before foo() returns? UPDATE: Previously I thought obj is not subject to garbage collection until foo() returns. However, today I find myself wrong. I have spend several hours in fixing a bug and finally found the problem is caused by obj garbage collected! Can anyone explain why this happens? And if I want obj to be pinned how to achieve it? Here is the code that has problem. public class Program { public static void main(String[] args) throws Exception { String connectionString = "jdbc:mysql://<whatever>"; // I find wrap is gc-ed somewhere SqlConnection wrap = new SqlConnection(connectionString); Connection con = wrap.currentConnection(); Statement stmt = con.createStatement(ResultSet.TYPE_FORWARD_ONLY, ResultSet.CONCUR_READ_ONLY); stmt.setFetchSize(Integer.MIN_VALUE); ResultSet rs = stmt.executeQuery("select instance_id, doc_id from crawler_archive.documents"); while (rs.next()) { int instanceID = rs.getInt(1); int docID = rs.getInt(2); if (docID % 1000 == 0) { System.out.println(docID); } } rs.close(); //wrap.close(); } } After running the Java program, it will print the following message before it crashes: 161000 161000 ******************************** Finalizer CALLED!! ******************************** ******************************** Close CALLED!! ******************************** 162000 Exception in thread "main" com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: And here is the code of class SqlConnection: class SqlConnection { private final String connectionString; private Connection connection; public SqlConnection(String connectionString) { this.connectionString = connectionString; } public synchronized Connection currentConnection() throws SQLException { if (this.connection == null || this.connection.isClosed()) { this.closeConnection(); this.connection = DriverManager.getConnection(connectionString); } return this.connection; } protected void finalize() throws Throwable { try { System.out.println("********************************"); System.out.println("Finalizer CALLED!!"); System.out.println("********************************"); this.close(); } finally { super.finalize(); } } public void close() { System.out.println("********************************"); System.out.println("Close CALLED!!"); System.out.println("********************************"); this.closeConnection(); } protected void closeConnection() { if (this.connection != null) { try { connection.close(); } catch (Throwable e) { } finally { this.connection = null; } } } }

    Read the article

  • No improvement in speed when using Ehcache with Hibernate

    - by paddydub
    I'm getting no improvement in speed when using Ehcache with Hibernate Here are the results I get when i run the test below. The test is reading 80 Stop objects and then the same 80 Stop objects again using the cache. On the second read it is hitting the cache, but there is no improvement in speed. Any idea's on what I'm doing wrong? Speed Test: First Read: Reading stops 1-80 : 288ms Second Read: Reading stops 1-80 : 275ms Cache Info: elementsInMemory: 79 elementsInMemoryStore: 79 elementsInDiskStore: 0 JunitCacheTest public class JunitCacheTest extends TestCase { static Cache stopCache; public void testCache() { ApplicationContext context = new ClassPathXmlApplicationContext("beans-hibernate.xml"); StopDao stopDao = (StopDao) context.getBean("stopDao"); CacheManager manager = new CacheManager(); stopCache = (Cache) manager.getCache("ie.dataStructure.Stop.Stop"); //First Read for (int i=1; i<80;i++) { Stop toStop = stopDao.findById(i); } //Second Read for (int i=1; i<80;i++) { Stop toStop = stopDao.findById(i); } System.out.println("elementsInMemory " + stopCache.getSize()); System.out.println("elementsInMemoryStore " + stopCache.getMemoryStoreSize()); System.out.println("elementsInDiskStore " + stopCache.getDiskStoreSize()); } public static Cache getStopCache() { return stopCache; } } HibernateStopDao @Repository("stopDao") public class HibernateStopDao implements StopDao { private SessionFactory sessionFactory; @Transactional(readOnly = true) public Stop findById(int stopId) { Cache stopCache = JunitCacheTest.getStopCache(); Element cacheResult = stopCache.get(stopId); if (cacheResult != null){ return (Stop) cacheResult.getValue(); } else{ Stop result =(Stop) sessionFactory.getCurrentSession().get(Stop.class, stopId); Element element = new Element(result.getStopID(),result); stopCache.put(element); return result; } } } ehcache.xml <cache name="ie.dataStructure.Stop.Stop" maxElementsInMemory="1000" eternal="false" timeToIdleSeconds="5200" timeToLiveSeconds="5200" overflowToDisk="true"> </cache> stop.hbm.xml <class name="ie.dataStructure.Stop.Stop" table="stops" catalog="hibernate3" mutable="false" > <cache usage="read-only"/> <comment></comment> <id name="stopID" type="int"> <column name="STOPID" /> <generator class="assigned" /> </id> <property name="coordinateID" type="int"> <column name="COORDINATEID" not-null="true"> <comment></comment> </column> </property> <property name="routeID" type="int"> <column name="ROUTEID" not-null="true"> <comment></comment> </column> </property> </class> Stop public class Stop implements Comparable<Stop>, Serializable { private static final long serialVersionUID = 7823769092342311103L; private Integer stopID; private int routeID; private int coordinateID; }

    Read the article

  • Class template specializations with shared functionality

    - by Thomas
    I'm writing a simple maths library with a template vector type: template<typename T, size_t N> class Vector { public: Vector<T, N> &operator+=(Vector<T, N> const &other); // ... more operators, functions ... }; Now I want some additional functionality specifically for some of these. Let's say I want functions x() and y() on Vector<T, 2> to access particular coordinates. I could create a partial specialization for this: template<typename T> class Vector<T, 3> { public: Vector<T, 3> &operator+=(Vector<T, 3> const &other); // ... and again all the operators and functions ... T x() const; T y() const; }; But now I'm repeating everything that already existed in the generic template. I could also use inheritance. Renaming the generic template to VectorBase, I could do this: template<typename T, size_t N> class Vector : public VectorBase<T, N> { }; template<typename T> class Vector<T, 3> : public VectorBase<T, 3> { public: T x() const; T y() const; }; However, now the problem is that all operators are defined on VectorBase, so they return VectorBase instances. These cannot be assigned to Vector variables: Vector<float, 3> v; Vector<float, 3> w; w = 5 * v; // error: no conversion from VectorBase<float, 3> to Vector<float, 3> I could give Vector an implicit conversion constructor to make this possible: template<typename T, size_t N> class Vector : public VectorBase<T, N> { public: Vector(VectorBase<T, N> const &other); }; However, now I'm converting from Vector to VectorBase and back again. Even though the types are the same in memory, and the compiler might optimize all this away, it feels clunky and I don't really like to have potential run-time overhead for what is essentially a compile-time problem. Is there any other way to solve this?

    Read the article

  • Perl MiniWebserver

    - by snikolov
    hey guys i have config this miniwebserver, however i require the server to download a file in the local directory i am getting a problem can you please fix my issue thanks !/usr/bin/perl use strict; use Socket; use IO::Socket; my $buffer; my $file; my $length; my $output; Simple web server in Perl Serves out .html files, echos form data sub parse_form { my $data = $_[0]; my %data; foreach (split /&/, $data) { my ($key, $val) = split /=/; $val =~ s/+/ /g; $val =~ s/%(..)/chr(hex($1))/eg; $data{$key} = $val;} return %data; } Setup and create socket my $port = shift; defined($port) or die "Usage: $0 portno\n"; my $DOCUMENT_ROOT = $ENV{'HOME'} . "public"; my $server = new IO::Socket::INET(Proto = 'tcp', LocalPort = $port, Listen = SOMAXCONN, Reuse = 1); $server or die "Unable to create server socket: $!" ; Await requests and handle them as they arrive while (my $client = $server-accept()) { $client-autoflush(1); my %request = (); my %data; { -------- Read Request --------------- local $/ = Socket::CRLF; while (<$client>) { chomp; # Main http request if (/\s*(\w+)\s*([^\s]+)\s*HTTP\/(\d.\d)/) { $request{METHOD} = uc $1; $request{URL} = $2; $request{HTTP_VERSION} = $3; } # Standard headers elsif (/:/) { (my $type, my $val) = split /:/, $_, 2; $type =~ s/^\s+//; foreach ($type, $val) { s/^\s+//; s/\s+$//; } $request{lc $type} = $val; } # POST data elsif (/^$/) { read($client, $request{CONTENT}, $request{'content-length'}) if defined $request{'content-length'}; last; } } } -------- SORT OUT METHOD --------------- if ($request{METHOD} eq 'GET') { if ($request{URL} =~ /(.*)\?(.*)/) { $request{URL} = $1; $request{CONTENT} = $2; %data = parse_form($request{CONTENT}); } else { %data = (); } $data{"_method"} = "GET"; } elsif ($request{METHOD} eq 'POST') { %data = parse_form($request{CONTENT}); $data{"_method"} = "POST"; } else { $data{"_method"} = "ERROR"; } ------- Serve file ---------------------- my $localfile = $DOCUMENT_ROOT.$request{URL}; Send Response if (open(FILE, "<$localfile")) { print $client "HTTP/1.0 200 OK", Socket::CRLF; print $client "Content-type: text/html", Socket::CRLF; print $client Socket::CRLF; my $buffer; while (read(FILE, $buffer, 4096)) { print $client $buffer; } $data{"_status"} = "200"; } else { $file = 'a.pl'; open(INFILE, $file); while (<INFILE>) { $output .= $_; ##output of the file } $length = length($output); print $client "'HTTP/1.0 200 OK", Socket::CRLF; print $client "Content-type: application/octet-stream", Socket::CRLF; print $client "Content-Length:".$length, Socket::CRLF; print $client "Accept-Ranges: bytes", Socket::CRLF; print $client 'Content-Disposition: attachment; filename="test.zip"', Socket::CRLF; print $client $output, Socket::CRLF; print $client 'Content-Transfer-Encoding: binary"', Socket::CRLF; print $client "Connection: Keep-Alive", Socket::CRLF; # #$data{"_status"} = "404"; # } close(FILE); Log Request print ($DOCUMENT_ROOT.$request{URL},"\n"); foreach (keys(%data)) { print (" $_ = $data{$_}\n"); } ----------- Close Connection and loop ------------------ close $client; } END

    Read the article

  • Few iPhone noob questions

    - by mshsayem
    Why should I declare local variables as 'static' inside a method? Like: static NSString *cellIdentifier = @"Cell"; Is it a performance advantage? (I know what 'static' does; in C context) What does this syntax mean?[someObj release], someObj = nil; Two statements? Why should I assign nil again? Is not 'release' enough? Should I do it for all objects I allocate/own? Or for just view objects? Why does everyone copy NSString, but retains other objects (in property declaration)? Yes, NSStrings can be changed, but other objects can be changed also, right? Then why 'copy' for just NSString, not for all? Is it just a defensive convention? Shouldn't I release constant NSString? Like here:NSString *CellIdentifier = @"Cell"; Why not? Does the compiler allocate/deallocate it for me? In some tutorial application I observed these (Built with IB): Properties(IBOutlet, with same ivar name): window, someLabel, someTextField, etc etc... In the dealloc method, although the window ivar was released, others were not. My question is: WHY? Shouldn't I release other ivars(labels, textField) as well? Why not? Say, I have 3 cascaded drop-down lists. I mean, based on what is selected on the first list, 2nd list is populated and based on what is selected on the second list, 3rd list is populated. What UI components can reflect this best? How is drop-down list presented in iPhone UI? Tableview with UIPicker? When should I update the 2nd, 3rd list? Or just three labels which have touch events? Can you give me some good example tutorials about Core-Data? (Not just simple data fetching and storing on 2/3 tables with 1/2 relationship) How can I know whether my app is leaking memory? Any tools?

    Read the article

  • writing XML with Xerces 3.0.1 and C++ on windows

    - by Jon
    Hi, i have the following function i wrote to create an XML file using Xerces 3.0.1, if i call this function with a filePath of "foo.xml" or "../foo.xml" it works great, but if i pass in "c:/foo.xml" then i get an exception on this line XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); can someone explain why my code works for relative paths, but not absolute paths please? many thanks. const int ABSOLUTE_PATH_FILENAME_PREFIX_SIZE = 9; void OutputXML(xercesc::DOMDocument* pmyDOMDocument, std::string filePath) { //Return the first registered implementation that has the desired features. In this case, we are after a DOM implementation that has the LS feature... or Load/Save. DOMImplementation *implementation = DOMImplementationRegistry::getDOMImplementation(L"LS"); // Create a DOMLSSerializer which is used to serialize a DOM tree into an XML document. DOMLSSerializer *serializer = ((DOMImplementationLS*)implementation)->createLSSerializer(); // Make the output more human readable by inserting line feeds. if (serializer->getDomConfig()->canSetParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true)) serializer->getDomConfig()->setParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true); // The end-of-line sequence of characters to be used in the XML being written out. serializer->setNewLine(XMLString::transcode("\r\n")); // Convert the path into Xerces compatible XMLCh*. XMLCh *tempFilePath = XMLString::transcode(filePath.c_str()); // Calculate the length of the string. const int pathLen = XMLString::stringLen(tempFilePath); // Allocate memory for a Xerces string sufficent to hold the path. XMLCh *targetPath = (XMLCh*)XMLPlatformUtils::fgMemoryManager->allocate((pathLen + ABSOLUTE_PATH_FILENAME_PREFIX_SIZE) * sizeof(XMLCh)); // Fixes a platform dependent absolute path filename to standard URI form. XMLString::fixURI(tempFilePath, targetPath); // Specify the target for the XML output. XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); //XMLFormatTarget *myFormTarget = new StdOutFormatTarget(); // Create a new empty output destination object. DOMLSOutput *output = ((DOMImplementationLS*)implementation)->createLSOutput(); // Set the stream to our target. output->setByteStream(formatTarget); // Write the serialized output to the destination. serializer->write(pmyDOMDocument, output); // Cleanup. serializer->release(); XMLString::release(&tempFilePath); delete formatTarget; output->release(); }

    Read the article

  • How to make a jQuery plugin (the right way)?

    - by macek
    I know there are jQuery cookie plugins out there, but I wanted to write one for the sake of better learning the jQuery plugin pattern. I like the separation of "work" in small, manageable functions, but I feel like I'm passing name, value, and options arguments around too much. Is there a way this can be refactored? I'm looking for snippets of code to help illustrate examples provided with in answers. Any help is appreciated. Thanks :) example usage $.cookie('foo', 'bar', {expires:7}); $.cookie('foo'); //=> bar $.cookie('foo', null); $.cookie('foo'); //=> undefined Edit: I did a little bit of work on this. You can view the revision history to see where this has come from. It still feels like more refactoring can be done to optimize the flow a bit. Any ideas? the plugin (function($){ $.cookie = function(name, value, options) { if (typeof value == 'undefined') { return get(name); } else { options = $.extend({}, $.cookie.defaults, options || {}); return (value != null) ? set(name, value, options) : unset(name, options); } }; $.cookie.defaults = { expires: null, path: '/', domain: null, secure: false }; var set = function(name, value, options){ console.log(options); return document.cookie = options_string(name, value, options); }; var get = function(name){ var cookies = {}; $.map(document.cookie.split(';'), function(pair){ var c = $.trim(pair).split('='); cookies[c[0]] = c[1]; }); return decodeURIComponent(cookies[name]); }; var unset = function(name, options){ value = ''; options.expires = -1; set(name, value, options); }; var options_string = function(name, value, options){ var pairs = [param.name(name, value)]; $.each(options, function(k,v){ pairs.push(param[k](v)); }); return $.map(pairs, function(p){ return p === null ? null : p; }).join(';'); }; var param = { name: function(name, value){ return name + "=" + encodeURIComponent(value); }, expires: function(value){ // no expiry if(value === null){ return null; } // number of days else if(typeof value == "number"){ d = new Date(); d.setTime(d.getTime() + (value * 24 * 60 * 60 * 1000)); } // date object else if(typeof value == "object" && value instanceof "Date") { d = value; } return "expires=" + d.toUTCString(); }, path: function(value){ return "path="+value; }, domain: function(value){ return value === null ? null : "domain=" + value; }, secure: function(bool){ return bool ? "secure" : null; } }; })(jQuery);

    Read the article

  • Saving data in custom class via AppDelegate

    - by redspike
    I can't seem to save data to a custom instance object in my AppDelegate. My custom class is very simple and is as follows: Person.h ... @interface Person : NSObject { int _age; } - (void) setAge: (int) age; - (int) age; @end Person.m #import "Person.h" @implementation Person - (void) setAge:(int) age { _age = age; } - (int) age { return _age; } @end I then create an instance of Person in the AppDelegate class: AppDelegate.h @class Person; @interface AccuTaxAppDelegate : NSObject <UIApplicationDelegate> { ... Person *person; } ... @property (nonatomic, retain) Person *person; @end AppDelegate.m ... #import "Person.h" @implementation AccuTaxAppDelegate ... @synthesize person; - (void)applicationDidFinishLaunching:(UIApplication *)application { // Override point for customization after app launch [window addSubview:[navigationController view]]; [window makeKeyAndVisible]; } - (void)applicationWillTerminate:(UIApplication *)application { // Save data if appropriate } #pragma mark - #pragma mark Memory management - (void)dealloc { [navigationController release]; [window release]; [person release]; [super dealloc]; } @end Finally, in my ViewController code I grab a handle on AppDelegate and then grab the person instance, but when I try to save the age it doesn't seem to work: MyViewController ... - (void)textFieldDidEndEditing:(UITextField *)textField { NSString *textAge = [textField text]; int age = [textAge intValue]; NSLog(@"Age from text field::%i", age); AppDelegate *appDelegate = (AppDelegate *)[UIApplication sharedApplication].delegate; Person *myPerson = (Person *)[appDelegate person]; NSLog(@"Age before setting: %i", [myPerson age]); [myPerson setAge:age]; NSLog(@"Age after setting: %i", [myPerson age]); [textAge release]; } ... The output of the above NSLogs are: [Session started at 2010-05-04 18:29:22 +0100.] 2010-05-04 18:29:28.260 AccuTax[16235:207] Age in text field:25 2010-05-04 18:29:28.262 AccuTax[16235:207] Age before setting: 0 2010-05-04 18:29:28.263 AccuTax[16235:207] Age after setting: 0 Any ideas why 'age' isn't being stored? I'm relatively new to Obj-C so please forgive me if I'm missing something very simple!

    Read the article

  • Do You Really Know Your Programming Languages?

    - by Kristopher Johnson
    I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

    Read the article

  • Optimizing Vector elements swaps using CUDA

    - by Orion Nebula
    Hi all, Since I am new to cuda .. I need your kind help I have this long vector, for each group of 24 elements, I need to do the following: for the first 12 elements, the even numbered elements are multiplied by -1, for the second 12 elements, the odd numbered elements are multiplied by -1 then the following swap takes place: Graph: because I don't yet have enough points, I couldn't post the image so here it is: http://www.freeimagehosting.net/image.php?e4b88fb666.png I have written this piece of code, and wonder if you could help me further optimize it to solve for divergence or bank conflicts .. //subvector is a multiple of 24, Mds and Nds are shared memory _shared_ double Mds[subVector]; _shared_ double Nds[subVector]; int tx = threadIdx.x; int tx_mod = tx ^ 0x0001; int basex = __umul24(blockDim.x, blockIdx.x); Mds[tx] = M.elements[basex + tx]; __syncthreads(); // flip the signs if (tx < (tx/24)*24 + 12) { //if < 12 and even if ((tx & 0x0001)==0) Mds[tx] = -Mds[tx]; } else if (tx < (tx/24)*24 + 24) { //if >12 and < 24 and odd if ((tx & 0x0001)==1) Mds[tx] = -Mds[tx]; } __syncthreads(); if (tx < (tx/24)*24 + 6) { //for the first 6 elements .. swap with last six in the 24elements group (see graph) Nds[tx] = Mds[tx_mod + 18]; Mds [tx_mod + 18] = Mds [tx]; Mds[tx] = Nds[tx]; } else if (tx < (tx/24)*24 + 12) { // for the second 6 elements .. swp with next adjacent group (see graph) Nds[tx] = Mds[tx_mod + 6]; Mds [tx_mod + 6] = Mds [tx]; Mds[tx] = Nds[tx]; } __syncthreads(); Thanks in advance ..

    Read the article

  • Getting instance crashes on IntelliJ IDEA with scala plugin.

    - by egervari
    I am building a scala web project using scala test, lift, jpa, hibernate, mercurial plugin, etc. I am getting instant crashes, where the ide just bombs, the window shuts down, and it gives no error messages whatsoever when I am doing any amount of copy/pasting of code. This started happening once my project got to about 100 unit tests. This problem is incredibly annoying, because when the crash happens, 30-60 seconds of activity is not saved. Even IDEA will forget which files were last opened and will forget where the cursor was, which makes it really hard to continue where you left off after the crash. A lot can happen in 60 seconds! Now, I've given up, because it seems like all sorts of things cause the IntelliJ IDEA to crash over and over. For example, if I were to copy and paste this code, to write a similar test for another collection type, it would crash shortly after: it should "cascade save and delete status messages" in { val statusMessage = new StatusMessage("message") var user = userDao.find(1).get user.addToStatusMessages(statusMessage) userDao.save(user) statusMessage.isPersistent should be (true) userDao.delete(user) statusMessageDao.find(statusMessage.id) should equal (None) } There is nothing special about this piece of code. It's code that is working just fine. However, IDEA bombs shortly after I paste something like this. For example, I might change StatusMessage to the new class I want to test cascading on... and then have to import that class into the test... and BOOM... it crashed. On windows 7, the IDEA window literally just minimizes and crashes with no warning. The next time I startup IDEA, it has no memory of what happened. Now, I've had this problem before. I posted it way back on IDEA's YouTrack. I was told to invalidate my caches. That never fixed it then, and it's not fixing it now. Please help. This error is fairly random, but it's happening constantly now. I could program for hours and not see it before... and the fact that my work just gets destroyed and I can't remember what I did during the last minute causes me to swear at my monitor at a db level higher than my stereo can go.

    Read the article

  • Differences between matrix implementation in C

    - by tempy
    I created two 2D arrays (matrix) in C in two different ways. I don't understand the difference between the way they're represented in the memory, and the reason why I can't refer to them in the same way: scanf("%d", &intMatrix1[i][j]); //can't refer as &intMatrix1[(i * lines)+j]) scanf("%d", &intMatrix2[(i * lines)+j]); //can't refer as &intMatrix2[i][j]) What is the difference between the ways these two arrays are implemented and why do I have to refer to them differently? How do I refer to an element in each of the arrays in the same way (?????? in my printMatrix function)? int main() { int **intMatrix1; int *intMatrix2; int i, j, lines, columns; lines = 3; columns = 2; /************************* intMatrix1 ****************************/ intMatrix1 = (int **)malloc(lines * sizeof(int *)); for (i = 0; i < lines; ++i) intMatrix1[i] = (int *)malloc(columns * sizeof(int)); for (i = 0; i < lines; ++i) { for (j = 0; j < columns; ++j) { printf("Type a number for intMatrix1[%d][%d]\t", i, j); scanf("%d", &intMatrix1[i][j]); } } /************************* intMatrix2 ****************************/ intMatrix2 = (int *)malloc(lines * columns * sizeof(int)); for (i = 0; i < lines; ++i) { for (j = 0; j < columns; ++j) { printf("Type a number for intMatrix2[%d][%d]\t", i, j); scanf("%d", &intMatrix2[(i * lines)+j]); } } /************** printing intMatrix1 & intMatrix2 ****************/ printf("intMatrix1:\n\n"); printMatrix(*intMatrix1, lines, columns); printf("intMatrix2:\n\n"); printMatrix(intMatrix2, lines, columns); } /************************* printMatrix ****************************/ void printMatrix(int *ptArray, int h, int w) { int i, j; printf("Printing matrix...\n\n\n"); for (i = 0; i < h; ++i) for (j = 0; j < w; ++j) printf("array[%d][%d] ==============> %d\n, i, j, ??????); }

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • Wireshark does not see interfaces (winXP)

    - by bua
    Short story: Wireshark is working....on my winXP-32b ... usage .... Long long time later Wireshark does not work It can't find any usefull interface (just VPN) ipconfig /all Ethernet adapter Wireless Network Connection: Media State . . . . . . . . . . . : Media disconnected Description . . . . . . . . . . . : Dell Wireless 1490 Dual Band WLAN Mini-Card Physical Address. . . . . . . . . : SOME VALID MAC Ethernet adapter eth0: Connection-specific DNS Suffix . : xxxx Description . . . . . . . . . . . : Broadcom 440x 10/100 Integrated Controller Physical Address. . . . . . . . . : SOME VALID MAC Dhcp Enabled. . . . . . . . . . . : Yes Autoconfiguration Enabled . . . . : Yes IP Address. . . . . . . . . . . . : 192.168.12.68 Subnet Mask . . . . . . . . . . . : 255.255.255.0 Default Gateway . . . . . . . . . : 192.168..... ..... Ethernet adapter Local Area Connection: Media State . . . . . . . . . . . : Media disconnected Description . . . . . . . . . . . : Fortinet virtual adapter Physical Address. . . . . . . . . : SOME VALID MAC Following steps didn't help: Several Wireshark re-installation Several LIBPCAP re installation SP3 for winXP Any ideas welcome.

    Read the article

  • Multi-tier applications using L2S, WCF and Base Class

    - by Gena Verdel
    Hi all. One day I decided to build this nice multi-tier application using L2S and WCF. The simplified model is : DataBase-L2S-Wrapper(DTO)-Client Application. The communication between Client and Database is achieved by using Data Transfer Objects which contain entity objects as their properties. abstract public class BaseObject { public virtual IccSystem.iccObjectTypes ObjectICC_Type { get { return IccSystem.iccObjectTypes.unknownType; } } [global::System.Data.Linq.Mapping.ColumnAttribute(Storage = "_ID", AutoSync = AutoSync.OnInsert, DbType = "BigInt NOT NULL IDENTITY", IsPrimaryKey = true, IsDbGenerated = true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order = 1)] public virtual long ID { //get; //set; get { return _ID; } set { _ID = value; } } } [DataContract] public class BaseObjectWrapper<T> where T : BaseObject { #region Fields private T _DBObject; #endregion #region Properties [DataMember] public T Entity { get { return _DBObject; } set { _DBObject = value; } } #endregion } Pretty simple, isn't it?. Here's the catch. Each one of the mapped classes contains ID property itself so I decided to override it like this [global::System.Data.Linq.Mapping.TableAttribute(Name="dbo.Divisions")] [global::System.Runtime.Serialization.DataContractAttribute()] public partial class Division : INotifyPropertyChanging, INotifyPropertyChanged { [global::System.Data.Linq.Mapping.ColumnAttribute(Storage="_ID", AutoSync=AutoSync.OnInsert, DbType="BigInt NOT NULL IDENTITY", IsPrimaryKey=true, IsDbGenerated=true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order=1)] public override long ID { get { return this._ID; } set { if ((this._ID != value)) { this.OnIDChanging(value); this.SendPropertyChanging(); this._ID = value; this.SendPropertyChanged("ID"); this.OnIDChanged(); } } } } Wrapper for division is pretty straightforward as well: public class DivisionWrapper : BaseObjectWrapper<Division> { } It worked pretty well as long as I kept ID values at mapped class and its BaseObject class the same(that's not very good approach, I know, but still) but then this happened: private CentralDC _dc; public bool UpdateDivision(ref DivisionWrapper division) { DivisionWrapper tempWrapper = division; if (division.Entity == null) { return false; } try { Table<Division> table = _dc.Divisions; var q = table.Where(o => o.ID == tempWrapper.Entity.ID); if (q.Count() == 0) { division.Entity._errorMessage = "Unable to locate entity with id " + division.Entity.ID.ToString(); return false; } var realEntity = q.First(); realEntity = division.Entity; _dc.SubmitChanges(); return true; } catch (Exception ex) { division.Entity._errorMessage = ex.Message; return false; } } When trying to enumerate over the in-memory query the following exception occurred: Class member BaseObject.ID is unmapped. Although I'm stating the type and overriding the ID property L2S fails to work. Any suggestions?

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • Using XmlDiffPatch when writing to stream

    - by Mark Smith
    I am trying to use xmldiffpatch when comparing two Xmls(one from a stream, the other from a file) and writing the diff patch to a stream. The first method is to write my xml to a memory stream. The second method loads an xml from a file and creates a stream for the patched file to be written into. The third method actually compares the two files and writes the third. The xmldiff.Compare(originalFile, finalFile, dgw); method takes (XmlReader, XmlReader, XmlWriter). I'm always getting that both files are identical, even though they are not, so I know that I am missing something. Any help is appreciated! public MemoryStream FirstXml() { string[] names = { "John", "Mohammed", "Marc", "Tamara", "joy" }; MemoryStream ms = new MemoryStream(); XmlTextWriter xtw= new XmlTextWriter(ms, Encoding.UTF8); xtw.WriteStartDocument(); xtw.WriteStartElement("root"); foreach (string s in names) { xtw.WriteStartElement(s); xtw.WriteEndElement(); } xtw.WriteEndElement(); xtw.WriteEndDocument(); return ms; } public Stream SecondXml() { XmlReader finalFile =XmlReader.Create(@"c:\......\something.xml"); MemoryStream ms = FirstXml(); XmlReader originalFile = XmlReader.Create(ms); MemoryStream ms2 = new MemoryStream(); XmlTextWriter dgw = new XmlTextWriter(ms2, Encoding.UTF8); GenerateDiffGram(originalFile, finalFile, dgw); return ms2; } public void GenerateDiffGram(XmlReader originalFile, XmlReader finalFile, XmlWriter dgw) { XmlDiff xmldiff = new XmlDiff(); bool bIdentical = xmldiff.Compare(originalFile, finalFile, dgw); dgw.Close(); StreamReader sr = new StreamReader(SecondXml()); string xmlOutput = sr.ReadToEnd(); if(xmlOutput.Contains("</xd:xmldiff>")) {Console.WriteLine("Xml files are not identical"); Console.Read();} else {Console.WriteLine("Xml files are identical");Console.Read();} }

    Read the article

  • Remote Postgresql - extremely slow

    - by Muffinbubble
    Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

    Read the article

  • Primary language - C++/Qt, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • Merge entries in XMLfile (SimpleXML in PHP)

    - by Cudos
    Hello. I have this in my XML file: <product name="iphone"> <variant name="iphone" product_number="12345" price="500" picture="iphone.jpg"> <description><![CDATA[iphone]]></description> <short_description><![CDATA[]]></short_description> <deliverytime><![CDATA[]]></deliverytime> <options> <option group="Color" option="Black" /> </options> </variant> </product> <product name="iphone"> <variant name="iphone" product_number="12345" price="500" picture="iphone.jpg"> <description><![CDATA[iphone]]></description> <short_description><![CDATA[]]></short_description> <deliverytime><![CDATA[]]></deliverytime> <options> <option group="Color" option="White" /> </options> </variant> </product> I want to merge it into this (Note that I merge the options tag): <product name="iphone"> <variant name="iphone" product_number="12345" price="500" picture="iphone.jpg"> <description><![CDATA[iphone]]></description> <short_description><![CDATA[]]></short_description> <deliverytime><![CDATA[]]></deliverytime> <options> <option group="Color" option="Black" /> <option group="Color" option="White" /> </options> </variant> </product> Preferably I want to do it all in the memory since I will process it further afterwards.

    Read the article

  • (Ordered) Set Partitions in fixed-size Blocks

    - by Eugen
    Here is a function I would like to write but am unable to do so. Even if you don't / can't give a solution I would be grateful for tips. For example, I know that there is a correlation between the ordered represantions of the sum of an integer and ordered set partitions but that alone does not help me in finding the solution. So here is the description of the function I need: The Task Create an efficient* function List<int[]> createOrderedPartitions(int n_1, int n_2,..., int n_k) that returns a list of arrays of all set partions of the set {0,...,n_1+n_2+...+n_k-1} in number of arguments blocks of size (in this order) n_1,n_2,...,n_k (e.g. n_1=2, n_2=1, n_3=1 -> ({0,1},{3},{2}),...). Here is a usage example: int[] partition = createOrderedPartitions(2,1,1).get(0); partition[0]; // -> 0 partition[1]; // -> 1 partition[2]; // -> 3 partition[3]; // -> 2 Note that the number of elements in the list is (n_1+n_2+...+n_n choose n_1) * (n_2+n_3+...+n_n choose n_2) * ... * (n_k choose n_k). Also, createOrderedPartitions(1,1,1) would create the permutations of {0,1,2} and thus there would be 3! = 6 elements in the list. * by efficient I mean that you should not initially create a bigger list like all partitions and then filter out results. You should do it directly. Extra Requirements If an argument is 0 treat it as if it was not there, e.g. createOrderedPartitions(2,0,1,1) should yield the same result as createOrderedPartitions(2,1,1). But at least one argument must not be 0. Of course all arguments must be = 0. Remarks The provided pseudo code is quasi Java but the language of the solution doesn't matter. In fact, as long as the solution is fairly general and can be reproduced in other languages it is ideal. Actually, even better would be a return type of List<Tuple<Set>> (e.g. when creating such a function in Python). However, then the arguments wich have a value of 0 must not be ignored. createOrderedPartitions(2,0,2) would then create [({0,1},{},{2,3}),({0,2},{},{1,3}),({0,3},{},{1,2}),({1,2},{},{0,3}),...] Background I need this function to make my mastermind-variation bot more efficient and most of all the code more "beautiful". Take a look at the filterCandidates function in my source code. There are unnecessary / duplicate queries because I'm simply using permutations instead of specifically ordered partitions. Also, I'm just interested in how to write this function. My ideas for (ugly) "solutions" Create the powerset of {0,...,n_1+...+n_k}, filter out the subsets of size n_1, n_2 etc. and create the cartesian product of the n subsets. However this won't actually work because there would be duplicates, e.g. ({1,2},{1})... First choose n_1 of x = {0,...,n_1+n_2+...+n_n-1} and put them in the first set. Then choose n_2 of x without the n_1 chosen elements beforehand and so on. You then get for example ({0,2},{},{1,3},{4}). Of course, every possible combination must be created so ({0,4},{},{1,3},{2}), too, and so on. Seems rather hard to implement but might be possible. Research I guess this goes in the direction I want however I don't see how I can utilize it for my specific scenario. http://rosettacode.org/wiki/Combinations

    Read the article

  • Is it Bad Practice to use C++ only for the STL containers?

    - by gmatt
    First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how to update an Android ListActivity on changing data of the connected SimpleCursorAdapter

    - by 4485670
    I have the following code. What I want to achieve is to update the shown list when I click an entry so I can traverse through the list. I found the two uncommented ways to do it here on stackoverflow, but neither works. I also got the advice to create a new ListActivity on the data update, but that sounds like wasting resources? EDIT: I found the solution myself. All you need to do is call "SimpleCursorAdapter.changeCursor(new Cursor);". No notifying, no things in UI-Thread or whatever. import android.app.ListActivity; import android.database.Cursor; import android.os.Bundle; import android.util.Log; import android.view.View; import android.widget.ListView; import android.widget.SimpleCursorAdapter; public class MyActivity extends ListActivity { private DepartmentDbAdapter mDbHelper; private Cursor cursor; private String[] from = new String[] { DepartmentDbAdapter.KEY_NAME }; private int[] to = new int[] { R.id.text1 }; private SimpleCursorAdapter notes; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.departments_list); mDbHelper = new DepartmentDbAdapter(this); mDbHelper.open(); // Get all of the departments from the database and create the item list cursor = mDbHelper.fetchSubItemByParentId(1); this.startManagingCursor(cursor); // Now create an array adapter and set it to display using our row notes = new SimpleCursorAdapter(this, R.layout.department_row, cursor, from, to); this.setListAdapter(notes); } @Override protected void onListItemClick(ListView l, View v, int position, long id) { super.onListItemClick(l, v, position, id); // get new data and update the list this.updateData(safeLongToInt(id)); } /** * update data for the list * * @param int departmentId id of the parent department */ private void updateData(int departmentId) { // close the old one, get a new one cursor.close(); cursor = mDbHelper.fetchSubItemByParentId(departmentId); // change the cursor of the adapter to the new one notes.changeCursor(cursor); } /** * safely convert long to in to save memory * * @param long l the long variable * * @return integer */ public static int safeLongToInt(long l) { if (l < Integer.MIN_VALUE || l > Integer.MAX_VALUE) { throw new IllegalArgumentException (l + " cannot be cast to int without changing its value."); } return (int) l; } }

    Read the article

  • Function returning MYSQL_ROW

    - by Gabe
    I'm working on a system using lots of MySQL queries and I'm running into some memory problems I'm pretty sure have to do with me not handling pointers right... Basically, I've got something like this: MYSQL_ROW function1() { string query="SELECT * FROM table limit 1;"; MYSQL_ROW return_row; mysql_init(&connection); // "connection" is a global variable if (mysql_real_connect(&connection,HOST,USER,PASS,DB,0,NULL,0)){ if (mysql_query(&connection,query.c_str())) cout << "Error: " << mysql_error(&connection); else{ resp = mysql_store_result(&connection); //"resp" is also global if (resp) return_row = mysql_fetch_row(resp); mysql_free_result(resp); } mysql_close(&connection); }else{ cout << "connection failed\n"; if (mysql_errno(&connection)) cout << "Error: " << mysql_errno(&connection) << " " << mysql_error(&connection); } return return_row; } And function2(): MYSQL_ROW function2(MYSQL_ROW row) { string query = "select * from table2 where code = '" + string(row[2]) + "'"; MYSQL_ROW retorno; mysql_init(&connection); if (mysql_real_connect(&connection,HOST,USER,PASS,DB,0,NULL,0)){ if (mysql_query(&connection,query.c_str())) cout << "Error: " << mysql_error(&conexao); else{ // My "debugging" shows me at this point `row[2]` is already fubar resp = mysql_store_result(&connection); if (resp) return_row = mysql_fetch_row(resp); mysql_free_result(resp); } mysql_close(&connection); }else{ cout << "connection failed\n"; if (mysql_errno(&connection)) cout << "Error : " << mysql_errno(&connection) << " " << mysql_error(&connection); } return return_row; } And main() is an infinite loop basically like this: int main( int argc, char* args[] ){ MYSQL_ROW row = NULL; while (1) { row = function1(); if(row != NULL) function2(row); } } (variable and function names have been generalized to protect the innocent) But after the 3rd or 4th call to function2, that only uses row for reading, row starts losing its value coming to a segfault error... Anyone's got any ideas why? I'm not sure the amount of global variables in this code is any good, but I didn't design it and only got until tomorrow to fix and finish it, so workarounds are welcome! Thanks!

    Read the article

< Previous Page | 632 633 634 635 636 637 638 639 640 641 642 643  | Next Page >