Search Results

Search found 16838 results on 674 pages for 'writing patterns dita cms'.

Page 637/674 | < Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >

  • Chrome extension - Localstorage not working

    - by Bjarki Jonasson
    I'm writing a Chrome extension that uses a content script to modify certain parts of a website. The content script worked fine until I tried to add an options page to my extension. Right now I'm using an options.html file to save user preferences to localstorage, as you can see here: <html> <head><title>Options</title></head> <script type="text/javascript"> function save_options() { var select = document.getElementById("width"); var width = select.children[select.selectedIndex].value; localStorage["site_width"] = width; } function restore_options() { var fwidth = localStorage["site_width"]; if (!fwidth) { return; } var select = document.getElementById("width"); for (var i = 0; i < select.children.length; i++) { var child = select.children[i]; if (child.value == fwidth) { child.selected = "true"; break; } } } </script> <body onload="restore_options()"> Width: <select id="width"> <option value="100%">100%</option> <option value="90%">90%</option> <option value="80%">80%</option> <option value="70%">70%</option> </select> <br> <button onclick="save_options()">Save</button> </body> </html> I also have a background.html file to handle the communication between the content script and the localstorage: <html> <script type="text/javascript"> chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { if (request.method == "siteWidth") sendResponse({status: localStorage["site_width"]}); else sendResponse({}); }); </script> </html> Then there's the actual content script that looks like this: var Width; chrome.extension.sendRequest({method: "siteWidth"}, function(response) { width = response.status; }); None of that code actually works. It looks solid enough to me but I'm not a very experienced programmer so I might be wrong. Could someone explain localstorage to me in layman's terms?

    Read the article

  • IEnumerable<T> ToArray usage, is it a copy or a pointer?

    - by Daniel
    I am parsing an arbitrary length byte array that is going to be passed around to a few different layers of parsing. Each parser creates a Header and a Packet payload just like any ordinary encapsulation. And my problem lies in how the encapsulation holds its packet byte array payload. Say i have a 100 byte array, and it has 3 levels of encapsulation. 3 packet objects will be created and i want to set the payload of these packets to the corresponding position in the byte array of the packet. For example lets say the payload size is 20 for all levels, then imagine it has a public byte[] Payload on each object. However the problem is that this byte[] Payload is a copy of the original 100 bytes. So i'm going to end up with 160 bytes in memory instead of 100. If it were in c++ i could just easily use a pointer however i'm writing this in c#. So i created the following class: public class PayloadSegment<T> : IEnumerable<T> { public readonly T[] Array; public readonly int Offset; public readonly int Count; public PayloadSegment(T[] array, int offset, int count) { this.Array = array; this.Offset = offset; this.Count = count; } public T this[int index] { get { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else return Array[Offset + index]; } set { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else Array[Offset + index] = value; } } public IEnumerator<T> GetEnumerator() { for (int i = Offset; i < Offset + Count; i++) yield return Array[i]; } System.Collections.IEnumerator System.Collections.IEnumerable.GetEnumerator() { IEnumerator<T> enumerator = this.GetEnumerator(); while (enumerator.MoveNext()) { yield return enumerator.Current; } } } This way i can simply reference a position inside the original byte array but use positional indexing. However if i do something like: PayloadSegment<byte> something = new PayloadSegment<byte>(someArray, 5, 10); byte[] somethingArray = something.ToArray(); Will the somethingArray be a copy of the bytes, or a reference to the original PayloadSegment which in turn is a reference to the original byte array? Sorry it was hard to word this lol _<

    Read the article

  • how to get $form_state outside of FAPI's functions?

    - by logii
    I'm writing a custom module and I'd like to use $form_state of the current form in another non-form api function - custom_facet_view_build(). any help is appreciated :) <?php /** * Implementation of hook_perm(). */ function custom_facet_perm() { return array( 'access foo content', 'access baz content', ); } /** * Implementation of hook_menu(). */ function custom_facet_menu() { $items['faceted-search'] = array( 'title' => 'Faceted Search', 'page callback' => 'drupal_get_form', 'access arguments' => array(), ); $items['facet-search-test'] = array( 'page callback' => 'drupal_get_form', 'page arguments' => array('custom_facet_form'), 'access callback' => TRUE, 'type' => MENU_CALLBACK, ); return $items; } /** * Form definition; ahah_helper_demo form. */ function custom_facet_form($form_state) { $form = array(); ahah_helper_register($form, $form_state); if (isset($form_state['storage']['categories'])) { $categories_default_value = $form_state['storage']['categories']["#value"]; } $form['facet_search_form'] = array( '#type' => 'fieldset', '#title' => t('Faceted Search'), '#prefix' => '<div id="billing-info-wrapper">', // This is our wrapper div. '#suffix' => '</div>', '#tree' => TRUE, // Don't forget to set #tree! ); $form['facet_search_form']['categories'] = array( '#type' => 'select', '#title' => t('Category'), '#options' => _custom_facet_taxonomy_query(1), '#multiple' => TRUE, '#default_value' => $categories_default_value, ); $form['save'] = array( '#type' => 'submit', '#value' => t('Save'), ); return $form; } /** * Validate callback for the form. */ function custom_facet_form_validate($form, &$form_state) { } /** * Submit callback for the form. */ function custom_facet_form_submit($form, &$form_state) { drupal_set_message('nothing done'); $form_state['storage']['categories'] = $form['facet_search_form']['categories']; // dpm($form_state); // There's a value returned in form_state['storage] within this function } /** * Implementation of hook_views_api(). */ function custom_facet_views_api() { return array( 'api' => 2, ); } function custom_facet_view_build(&$view) { dpm($form_state); // form_state['storage] remains NULL even though there's a value on previous submission }

    Read the article

  • How to measure a canvas that has auto height and width

    - by Wymmeroo
    Hi Folks, I'm a beginner in silverlight so i hope i can get an answer that brings me some more light in the measure process of silverlight. I found an interessting flap out control from silverlight slide control and now I try to use it in my project. So that the slide out is working proper, I have to place the user control on a canvas. The user control then uses for itself the height of its content. I just wanna change that behavior so that the height is set to the available space from the parent canvas. You see the uxBorder where the height is set. How can I measure the actual height and set it to the border? I tried it with Height={Binding ElementName=notificationCanvas, Path=ActualHeight} but this dependency property has no callback, so the actualHeight is never set. What I want to achieve is a usercontrol like the tweetboard per example on Jesse Liberty's blog Sorry for my English writing, I hope you understand my question. <Canvas x:Name="notificationCanvas" Background="Red"> <SlideEffectEx:SimpleSlideControl GripWidth="20" GripTitle="Task" GripHeight="100"> <Border x:Name="uxBorder" BorderThickness="2" CornerRadius="5" BorderBrush="DarkGray" Background="DarkGray" Padding="5" Width="300" Height="700" > <StackPanel> <TextBlock Text="Tasks"></TextBlock> <Button x:Name="btn1" Margin="5" Content="{Binding ElementName=MainBorder, Path=Height}"></Button> <Button x:Name="btn2" Margin="5" Content="Second Button"></Button> <Button x:Name="btn3" Margin="5" Content="Third Button"></Button> <Button x:Name="btn1_Copy" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy1" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy2" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy3" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy4" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy5" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy6" Margin="5" Content="First Button"/> </StackPanel> </Border> </SlideEffectEx:SimpleSlideControl>

    Read the article

  • Arbitrary Form Processing with Drupal

    - by Aaron
    I am writing a module for my organization to cache XML feeds to static files to an arbitrary place on our webserver. I am new at Drupal development, and would like to know if I am approaching this the right way. Basically I: Expose a url via the menu hook, where a user can enter in a an output directory on the webserver and press the "dump" button and then have PHP go to drupal and get the feed xml. I don't need help with that functionality, because I actually have a prototype working in Python (outside of Drupal).. Provide a callback for the form where I can do my logic, using the form parameters. Here's the menu hook: function ncbi_cache_files_menu() { $items = array(); $items['admin/content/ncbi_cache_files'] = array( 'title' => 'NCBI Cache File Module', 'description' => 'Cache Guide static content to files', 'page callback' => 'drupal_get_form', 'page arguments' => array( 'ncbi_cache_files_show_submit'), 'access arguments' => array( 'administer site configuration' ), 'type' => MENU_NORMAL_ITEM, ); return $items; } I generate the form in: function ncbi_cache_files_show_submit() { $DEFAULT_OUT = 'http://myorg/foo'; $form[ 'ncbi_cache_files' ] = array( '#type' => 'textfield', '#title' => t('Output Directory'), '#description' => t('Where you want the static files to be dumped. This should be a directory that www has write access to, and should be accessible from the foo server'), '#default_value' => t( $DEFAULT_OUT ), '#size' => strlen( $DEFAULT_OUT ) + 5, ); $form['dump'] = array( '#type' => 'submit', '#value' => 'Dump', '#submit' => array( 'ncbi_cache_files_dump'), ); return system_settings_form( $form ); } Then the functionality is in the callback: function ncbi_cache_files_dump( $p, $q) { //dpm( get_defined_vars() ); $outdir = $p['ncbi_cache_files']['#post']['ncbi_cache_files']; drupal_set_message('outdir: ' . $outdir ); } The question: Is this a decent way of processing an arbitrary form in Drupal? I not really need to listen for any drupal hooks, because I am basically just doing some URL and file processing. What are those arguments that I'm getting in the callback ($q)? That's the form array I guess, with the post values? Is this the best way to get the form parameters to work on? Thanks for any advice.

    Read the article

  • ActionResult - Service

    - by cem
    I bored, writing same code for service and ui. Then i tried to write a converter for simple actions. This converter, converting Service Results to MVC result, seems like good solution for me but anyway i think this gonna opposite MVC pattern. So here, I need help, what you think about algorithm - is this good or not? Thanks ServiceResult - Base: public abstract class ServiceResult { public static NoPermissionResult Permission() { return new NoPermissionResult(); } public static SuccessResult Success() { return new SuccessResult(); } public static SuccessResult<T> Success<T>(T result) { return new SuccessResult<T>(result); } protected ServiceResult(ServiceResultType serviceResultType) { _resultType = serviceResultType; } private readonly ServiceResultType _resultType; public ServiceResultType ResultType { get { return _resultType; } } } public class SuccessResult<T> : ServiceResult { public SuccessResult(T result) : base(ServiceResultType.Success) { _result = result; } private readonly T _result; public T Result { get { return _result; } } } public class SuccessResult : SuccessResult<object> { public SuccessResult() : this(null) { } public SuccessResult(object o) : base(o) { } } Service - eg. ForumService: public ServiceResult Delete(IVUser user, int id) { Forum forum = Repository.GetDelete(id); if (!Permission.CanDelete(user, forum)) { return ServiceResult.Permission(); } Repository.Delete(forum); return ServiceResult.Success(); } Controller: public class BaseController { public ActionResult GetResult(ServiceResult result) { switch (result.ResultType) { case ServiceResultType.Success: var successResult = (SuccessResult)result; return View(successResult.Result); break; case ServiceResultType.NoPermission: return View("Error"); break; default: return View(); break; } } } [HandleError] public class ForumsController : BaseController { [ValidateAntiForgeryToken] [Transaction] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Delete(int id) { ServiceResult result = ForumService.Delete(WebUser.Current, id); /* Custom result */ if (result.ResultType == ServiceResultType.Success) { TempData[ControllerEnums.GlobalViewDataProperty.PageMessage.ToString()] = "The forum was successfully deleted."; return this.RedirectToAction(ec => Index()); } /* Custom result */ /* Execute Permission result etc. */ TempData[ControllerEnums.GlobalViewDataProperty.PageMessage.ToString()] = "A problem was encountered preventing the forum from being deleted. " + "Another item likely depends on this forum."; return GetResult(result); } }

    Read the article

  • Class template specializations with shared functionality

    - by Thomas
    I'm writing a simple maths library with a template vector type: template<typename T, size_t N> class Vector { public: Vector<T, N> &operator+=(Vector<T, N> const &other); // ... more operators, functions ... }; Now I want some additional functionality specifically for some of these. Let's say I want functions x() and y() on Vector<T, 2> to access particular coordinates. I could create a partial specialization for this: template<typename T> class Vector<T, 3> { public: Vector<T, 3> &operator+=(Vector<T, 3> const &other); // ... and again all the operators and functions ... T x() const; T y() const; }; But now I'm repeating everything that already existed in the generic template. I could also use inheritance. Renaming the generic template to VectorBase, I could do this: template<typename T, size_t N> class Vector : public VectorBase<T, N> { }; template<typename T> class Vector<T, 3> : public VectorBase<T, 3> { public: T x() const; T y() const; }; However, now the problem is that all operators are defined on VectorBase, so they return VectorBase instances. These cannot be assigned to Vector variables: Vector<float, 3> v; Vector<float, 3> w; w = 5 * v; // error: no conversion from VectorBase<float, 3> to Vector<float, 3> I could give Vector an implicit conversion constructor to make this possible: template<typename T, size_t N> class Vector : public VectorBase<T, N> { public: Vector(VectorBase<T, N> const &other); }; However, now I'm converting from Vector to VectorBase and back again. Even though the types are the same in memory, and the compiler might optimize all this away, it feels clunky and I don't really like to have potential run-time overhead for what is essentially a compile-time problem. Is there any other way to solve this?

    Read the article

  • Should I skip authorization, with CanCan, of an action that instantiates a resource?

    - by irkenInvader
    I am writing a web app to pick random lists of cards from larger, complete sets of cards. I have a Card model and a CardSet model. Both models have a full RESTful set of 7 actions (:index, :new, :show, etc). The CardSetsController has an extra action for creating random sets: :random. # app/models/card_set.rb class CardSet < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :cards, :through => :memberships # app/models/card.rb class Card < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :card_sets, :through => :memberships I have added Devise for authentication and CanCan for authorizations. I have users with an 'editor' role. Editors are allowed to create new CardSets. Guest users (Users who have not logged in) can only use the :index and :show actions. These authorizations are working as designed. Editors can currently use both the :random and the :new actions without any problems. Guest users, as expected, cannot. # app/controllers/card_sets_controller.rb class CardSetsController < ApplicationController before_filter :authenticate_user!, :except => [:show, :index] load_and_authorize_resource I want to allow guest users to use the :random action, but not the :new action. In other words, they can see new random sets, but not save them. The "Save" button on the :random action's view is hidden (as designed) from the guest users. The problem is, the first thing the :random action does is build a new instance of the CardSet model to fill out the view. When cancan tries to load_and_authorize_resource a new CardSet, it throws a CanCan::AccessDenied exception. Therefore, the view never loads and the guest user is served a "You need to sign in or sign up before continuing" message. # app/controllers/card_sets_controllers.rb def random @card_set = CardSet.new( :name => "New Set of 10", :set_type => "Set of 10" ) I realize that I can tell load_and_authorize_resource to skip the :random action by passing :except => :random to the call, but that just feels "wrong" for some reason. What's the "right" way to do this? Should I create the new random set without instantiating a new CardSet? Should I go ahead and add the exception?

    Read the article

  • Methodology for a Rails app

    - by Aaron Vegh
    I'm undertaking a rather large conversion from a legacy database-driven Windows app to a Rails app. Because of the large number of forms and database tables involved, I want to make sure I've got the right methodology before getting too far. My chief concern is minimizing the amount of code I have to write. There are many models that interact together, and I want to make sure I'm using them correctly. Here's a simplified set of models: class Patient < ActiveRecord::Base has_many :PatientAddresses has_many :PatientFileStatuses end class PatientAddress < ActiveRecord::Base belongs_to :Patient end class PatientFileStatus < ActiveRecord::Base belongs_to :Patient end The controller determines if there's a Patient selected; everything else is based on that. In the view, I will be needing data from each of these models. But it seems like I have to write an instance variable in my controller for every attribute that I want to use. So I start writing code like this: @patient = Patient.find(session[:patient]) @patient_addresses = @patient.PatientAddresses @patient_file_statuses = @patient.PatientFileStatuses @enrollment_received_when = @patient_file_statuses[0].EnrollmentReceivedWhen @consent_received = @patient_file_statuses[0].ConsentReceived @consent_received_when = @patient_file_statuses[0].ConsentReceivedWhen The first three lines grab the Patient model and its relations. The next three lines are examples of my providing values to the view from one of those relations. The view has a combination of text fields and select fields to show the data above. For example: <%= select("patientfilestatus", "ConsentReceived", {"val1"="val1", "val2"="val2", "Written"="Written"}, :include_blank=true )% <%= calendar_date_select_tag "patient_file_statuses[EnrollmentReceivedWhen]", @enrollment_complete_when, :popup=:force % (BTW, the select tag isn't really working; I think I have to use collection_select?) My questions are: Do I have to manually declare the value of every instance variable in the controller, or can/should I do it within the view? What is the proper technique for displaying a select tag for data that's not the primary model? When I go to save changes to this form, will I have to manually pick out the attributes for each model and save them individually? Or is there a way to name the fields such that ActiveRecord does the right thing? Thanks in advance, Aaron.

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • JavaScript regular expression literal persists between function calls

    - by Charles Anderson
    I have this piece of code: function func1(text) { var pattern = /([\s\S]*?)(\<\?(?:attrib |if |else-if |else|end-if|search |for |end-for)[\s\S]*?\?\>)/g; var result; while (result = pattern.exec(text)) { if (some condition) { throw new Error('failed'); } ... } } This works, unless the throw statement is executed. In that case, the next time I call the function, the exec() call starts where it left off, even though I am supplying it with a new value of 'text'. I can fix it by writing var pattern = new RegExp('.....'); instead, but I don't understand why the first version is failing. How is the regular expression persisting between function calls? (This is happening in the latest versions of Firefox and Chrome.) Edit Complete test case: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-type" content="text/html;charset=UTF-8"> <title>Test Page</title> <style type='text/css'> body { font-family: sans-serif; } #log p { margin: 0; padding: 0; } </style> <script type='text/javascript'> function func1(text, count) { var pattern = /(one|two|three|four|five|six|seven|eight)/g; log("func1"); var result; while (result = pattern.exec(text)) { log("result[0] = " + result[0] + ", pattern.index = " + pattern.index); if (--count <= 0) { throw "Error"; } } } function go() { try { func1("one two three four five six seven eight", 3); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } try { func1("one two three four five six seven eight", 99); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } } function log(msg) { var log = document.getElementById('log'); var p = document.createElement('p'); p.innerHTML = msg; log.appendChild(p); } </script> </head> <body><div> <input type='button' id='btnGo' value='Go' onclick='go();'> <hr> <div id='log'></div> </div></body> </html> The regular expression continues with 'four' as of the second call on FF and Chrome, not on IE7 or Opera.

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • Error with connection in my database servlet

    - by Zerobu
    Hello, I am writing a Database servlet, all seems well except that there seems to be an error in my connection import java.io.IOException; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.Statement; import java.util.ArrayList; import javax.servlet.RequestDispatcher; import javax.servlet.ServletContext; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; public class DBServlet3 extends HttpServlet { private static final long serialVersionUID = 1L; @Override public void init() throws ServletException { super.init(); try { String jdbcDriverClass= getServletContext().getInitParameter( "jdbcDriverClass" ); if (jdbcDriverClass == null) throw new ServletException( "Could not find jdbcDriverClass initialization parameter" ); Class.forName( jdbcDriverClass ); } catch (ClassNotFoundException e) { throw new ServletException( "Could not load JDBC driver class", e ); } } @Override protected void doGet( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { RequestDispatcher dispatcher= request.getRequestDispatcher( "/db.jsp" ); ServletContext application= getServletContext(); ArrayList<String> names= new ArrayList<String>(); try { Connection connection= null; Statement statement= null; ResultSet results= null; try { String jdbcUrl= application.getInitParameter( "jdbcUrl" ); String jdbcUser= application.getInitParameter( "jdbcUser" ); String jdbcPassword= application.getInitParameter( "jdbcPassword" ); connection= DriverManager.getConnection( jdbcUrl, jdbcUser, jdbcPassword ); statement= connection.createStatement(); results= statement.executeQuery( "SELECT * FROM students" ); while (results.next()) { String name= results.getString( "name" ); names.add( name ); } } finally { if (results != null) results.close(); if (statement != null) statement.close(); if (connection != null) connection.close(); } } catch (SQLException e) { throw new ServletException( e ); } request.setAttribute( "names", names ); dispatcher.forward( request, response ); } @Override protected void doPost( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { String sql= "INSERT INTO students VALUES (" + request.getParameter( "id" ) + ", '" + request.getParameter( "name" ) + "')"; sql= "INSERT INTO students VALUES (?, ?, ?, ?)"; PreparedStatement statement= connection.prepareStatement( sql ); //error on this line statement.setString( 1, request.getParameter( "id" ) ); statement.setString( 2, request.getParameter( "name" ) ); } }

    Read the article

  • Can I avoid a threaded UDP socket in Python dropping data?

    - by 666craig
    First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

    Read the article

  • Inserting checkbox values

    - by rabeea
    hey i have registration form that has checkboxes along with other fields. i cant insert the selected checkbox values into the data base. i have made one field in the database for storing all checked values. this is the code for checkbox part in the form: Websites, IT and Software Writing and Content <pre><input type="checkbox" name="expertise[]" value="Design and Media"> Design and Media <input type="checkbox" name="expertise[]" value="Data entry and Admin"> Data entry and Admin </pre> <pre><input type="checkbox" name="expertise[]" value="Engineering and Skills"> Engineering and Science <input type="checkbox" name="expertise[]" value="Seles and Marketing"> Sales and Marketing </pre> <pre><input type="checkbox" name="expertise[]" value="Business and Accounting"> Business and Accounting <input type="checkbox" name="expertise[]" value="Others"> Others </pre> and this is the corresponding php code for inserting data $checkusername=mysql_query("SELECT * FROM freelancer WHERE fusername='{$_POST['username']}'"); if (mysql_num_rows($checkusername)==1) { echo "username already exist"; } else { $query = "insert into freelancer(ffname,flname,fgender,femail,fusername,fpwd,fphone,fadd,facc,facc_name,fbank_details,fcity,fcountry,fexpertise,fprofile,fskills,fhourly_rate,fresume) values ('".$_POST['first_name']."','".$_POST['last_name']."','".$_POST['gender']."','".$_POST['email']."','".$_POST['username']."','".$_POST['password']."','".$_POST['phone']."','".$_POST['address']."','".$_POST['acc_num']."','".$_POST['acc_name']."','".$_POST['bank']."','".$_POST['city']."','".$_POST['country']."','".implode(',',$_POST['expertise'])."','".$_POST['profile']."','".$_POST['skills']."','".$_POST['rate']."','".$_POST['resume']."')"; $result = ($query) or die (mysql_error()); this code inserts data for all fields but the checkbox value field remains empty???

    Read the article

  • Is this BlockingQueue susceptible to deadlock?

    - by unforgiven3
    I've been using this code as a queue that blocks on Dequeue() until an element is enqueued. I've used this code for a few years now in several projects, all with no issues... until now. I'm seeing a deadlock in some code I'm writing now, and in investigating the problem, my 'eye of suspicion' has settled on this BlockingQueue<T>. I can't prove it, so I figured I'd ask some people smarter than me to review it for potential issues. Can you guys see anything that might cause a deadlock in this code? public class BlockingQueue<T> { private readonly Queue<T> _queue; private readonly ManualResetEvent _event; /// <summary> /// Constructor /// </summary> public BlockingQueue() { _queue = new Queue<T>(); _event = new ManualResetEvent(false); } /// <summary> /// Read-only property to get the size of the queue /// </summary> public int Size { get { int count; lock (_queue) { count = _queue.Count; } return count; } } /// <summary> /// Enqueues element on the queue /// </summary> /// <param name="element">Element to enqueue</param> public void Enqueue(T element) { lock (_queue) { _queue.Enqueue(element); _event.Set(); } } /// <summary> /// Dequeues an element from the queue /// </summary> /// <returns>Dequeued element</returns> public T Dequeue() { T element; while (true) { if (Size == 0) { _event.Reset(); _event.WaitOne(); } lock (_queue) { if (_queue.Count == 0) continue; element = _queue.Dequeue(); break; } } return element; } /// <summary> /// Clears the queue /// </summary> public void Clear() { lock (_queue) { _queue.Clear(); } } }

    Read the article

  • MySQL LEFT OUTER JOIN virtual table

    - by user1707323
    I am working on a pretty complicated query let me try to explain it to you. Here is the tables that I have in my MySQL database: students Table --- `students` --- student_id first_name last_name current_status status_change_date ------------ ------------ ----------- ---------------- -------------------- 1 John Doe Active NULL 2 Jane Doe Retread 2012-02-01 students_have_courses Table --- `students_have_courses` --- students_student_id courses_course_id s_date e_date int_date --------------------- ------------------- ---------- ---------- ----------- 1 1 2012-01-01 2012-01-04 2012-01-05 1 2 2012-01-05 NULL NULL 2 1 2012-01-10 2012-01-11 NULL students_have_optional_courses Table --- `students_have_optional_courses` --- students_student_id optional_courses_opcourse_id s_date e_date --------------------- ------------------------------ ---------- ---------- 1 1 2012-01-02 2012-01-03 1 1 2012-01-06 NULL 1 5 2012-01-07 NULL Here is my query so far SELECT `students_and_courses`.student_id, `students_and_courses`.first_name, `students_and_courses`.last_name, `students_and_courses`.courses_course_id, `students_and_courses`.s_date, `students_and_courses`.e_date, `students_and_courses`.int_date, `students_have_optional_courses`.optional_courses_opcourse_id, `students_have_optional_courses`.s_date, `students_have_optional_courses`.e_date FROM ( SELECT `c_s_a_s`.student_id, `c_s_a_s`.first_name, `c_s_a_s`.last_name, `c_s_a_s`.courses_course_id, `c_s_a_s`.s_date, `c_s_a_s`.e_date, `c_s_a_s`.int_date FROM ( SELECT `students`.student_id, `students`.first_name, `students`.last_name, `students_have_courses`.courses_course_id, `students_have_courses`.s_date, `students_have_courses`.e_date, `students_have_courses`.int_date FROM `students` LEFT OUTER JOIN `students_have_courses` ON ( `students_have_courses`.`students_student_id` = `students`.`student_id` AND (( `students_have_courses`.`s_date` >= `students`.`status_change_date` AND `students`.current_status = 'Retread' ) OR `students`.current_status = 'Active') ) WHERE `students`.current_status = 'Active' OR `students`.current_status = 'Retread' ) `c_s_a_s` ORDER BY `c_s_a_s`.`courses_course_id` DESC ) `students_and_courses` LEFT OUTER JOIN `students_have_optional_courses` ON ( `students_have_optional_courses`.students_student_id = `students_and_courses`.student_id AND `students_have_optional_courses`.s_date >= `students_and_courses`.s_date AND `students_have_optional_courses`.e_date IS NULL ) GROUP BY `students_and_courses`.student_id; What I want to be returned is the student_id, first_name, and last_name for all Active or Retread students and then LEFT JOIN the highest course_id, s_date, e_date, and int_date for the those students where the s_date is since the status_change_date if status is 'Retread'. Then LEFT JOIN the highest optional_courses_opcourse_id, s_date, and e_date from the students_have_optional_courses TABLE where the students_have_optional_courses.s_date is greater or equal to the students_have_courses.s_date and the students_have_optional_courses.e_date IS NULL Here is what is being returned: student_id first_name last_name courses_course_id s_date e_date int_date optional_courses_opcourse_id s_date_1 e_date_1 ------------ ------------ ----------- ------------------- ---------- ---------- ------------ ------------------------------ ---------- ---------- 1 John Doe 2 2012-01-05 NULL NULL 1 2012-01-06 NULL 2 Jane Doe NULL NULL NULL NULL NULL NULL NULL Here is what I want being returned: student_id first_name last_name courses_course_id s_date e_date int_date optional_courses_opcourse_id s_date_1 e_date_1 ------------ ------------ ----------- ------------------- ---------- ---------- ------------ ------------------------------ ---------- ---------- 1 John Doe 2 2012-01-05 NULL NULL 5 2012-01-07 NULL 2 Jane Doe NULL NULL NULL NULL NULL NULL NULL Everything is working except one thing, I cannot seem to get the highest students_have_optional_courses.optional_courses_opcourse_id no matter how I form the query Sorry, I just solved this myself after writing this all out I think it helped me think of the solution. Here is the solution query: SELECT `students_and_courses`.student_id, `students_and_courses`.first_name, `students_and_courses`.last_name, `students_and_courses`.courses_course_id, `students_and_courses`.s_date, `students_and_courses`.e_date, `students_and_courses`.int_date, `students_optional_courses`.optional_courses_opcourse_id, `students_optional_courses`.s_date, `students_optional_courses`.e_date FROM ( SELECT `c_s_a_s`.student_id, `c_s_a_s`.first_name, `c_s_a_s`.last_name, `c_s_a_s`.courses_course_id, `c_s_a_s`.s_date, `c_s_a_s`.e_date, `c_s_a_s`.int_date FROM ( SELECT `students`.student_id, `students`.first_name, `students`.last_name, `students_have_courses`.courses_course_id, `students_have_courses`.s_date, `students_have_courses`.e_date, `students_have_courses`.int_date FROM `students` LEFT OUTER JOIN `students_have_courses` ON ( `students_have_courses`.`students_student_id` = `students`.`student_id` AND (( `students_have_courses`.`s_date` >= `students`.`status_change_date` AND `students`.current_status = 'Retread' ) OR `students`.current_status = 'Active') ) WHERE `students`.current_status = 'Active' OR `students`.current_status = 'Retread' ) `c_s_a_s` ORDER BY `c_s_a_s`.`courses_course_id` DESC ) `students_and_courses` LEFT OUTER JOIN ( SELECT * FROM `students_have_optional_courses` ORDER BY `students_have_optional_courses`.optional_courses_opcourse_id DESC ) `students_optional_courses` ON ( `students_optional_courses`.students_student_id = `students_and_courses`.student_id AND `students_optional_courses`.s_date >= `students_and_courses`.s_date AND `students_optional_courses`.e_date IS NULL ) GROUP BY `students_and_courses`.student_id;

    Read the article

  • How do I write sql data into a textbox after a submit type event

    - by Matt
    Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

    Read the article

  • How to change button's image in visual c++ at run time?

    - by karikari
    After trying and error for many times, I decided to ask here. My objective is I wanted to change the feature of my IE toolbar button. The button is firstly setup by IE at IE startup using the function CRebarHandler::onSetRedraw and CRebarHandler::setButtonMenu2(). And then, I create a call from another cpp file, to call CRebarHandler::setButtonMenu2(). I intent to change just the button's image. I assigned the ID of the image correctly. But somehow it does not work. When I put other code inside this function,like a code for writing to file, it is proven work. Means, it is properly being called from the other file. But the thing is, the code for the button inside CRebarHandler::setButtonMenu2() seems does not work. Need help. Here is the code I am working on (I modify John Lister's button code): LRESULT CRebarHandler::onSetRedraw(UINT uMsg, WPARAM wParam, LPARAM lParam, BOOL& bHandled){ bHandled=false; if (m_ieVer==6){ if (!m_hWndToolbar) scanForToolbarSlow(); if (m_hWndToolbar){ findButton(m_hWndToolbar); if (m_buttonID>0) setButtonMenu(); } } return S_OK; } void CRebarHandler::setButtonMenu(){ HIMAGELIST hImageList = ImageList_Create(32, 32,ILC_COLOR16 | ILC_MASK,1, 0); HINSTANCE module = _AtlBaseModule.GetResourceInstance(); TBBUTTONINFO inf; inf.cbSize=sizeof(inf); inf.dwMask = TBIF_IMAGE; char psBuffer[128]; FILE *pPipe; float f = 0; pPipe = _popen("javaw -jar c:\\simmetrics.jar c:\\chtml.txt c:\\thtml.txt", "rt" ); char* p = fgets(psBuffer, 128, pPipe); std::istringstream iss(p); iss >> f; if (f > 0.9) { inf.iImage = 1; SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); iss.clear(); f = 0; } else { inf.iImage = 2; SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); iss.clear(); f = 0; } iss.clear(); f = 0; } void CRebarHandler::setButtonMenu2(){ TBBUTTONINFO inf; inf.cbSize=sizeof(inf); inf.dwMask = TBIF_IMAGE; inf.iImage = 1; //green SendMessage(NULL, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); }

    Read the article

  • error with passing my object with serializable?

    - by Jony Scherman
    i was trying to send my object class GastronomyElement to another activity but i have got this error java.lang.RuntimeException: Parcelable encountered IOException writing serializable object (name = com.example.despegarteproject.classes.GastronomyElement) i have seen another posts like this but i couldn not solve it. this is my class code public class GastronomyElement implements Serializable { String id, name, formattedAddress, formattedPhoneNumber, reference, photo; List<String> photos; Boolean openNow; Horarios horarios; List<Review> reviews; String priceLevel; double latitude, longitude; Double rating; public String getName () { return name; } public void setName (String name) { this.name = name; } public String getId () { return id; } public void setId (String id) { this.id = id; } public String getFormattedAddress () { return formattedAddress; } public void setFormattedAddress (String formattedAddress) { this.formattedAddress = formattedAddress; } public String getReference () { return reference; } public void setReference (String reference) { this.reference = reference; } public String getPhoto () { return photo; } public void setPhoto (String photo) { this.photo = photo; } public List<String> getPhotos () { return photos; } public void setPhotos (List<String> photos) { this.photos = photos; } public double getLatitude() { return latitude; } public void setLatitude (double latitude) { this.latitude = latitude; } public double getLongitude() { return longitude; } public void setLongitude (double longitude) { this.longitude = longitude; } public Double getRating () { return rating; } public void setRating (Double rating) { this.rating = rating; } public Boolean getOpenNow () { return openNow; } public void setOpenNow (Boolean openNow) { this.openNow = openNow; } public Horarios getHorarios () { return horarios; } public void setHorarios (Horarios horarios) { this.horarios = horarios; } public String getPriceLevel () { return priceLevel; } public void setPriceLevel (String priceLevel) { this.priceLevel = priceLevel; } public String getFormattedPhoneNumber () { return formattedPhoneNumber; } public void setFormattedPhoneNumber (String formattedPhoneNumber) { this.formattedPhoneNumber = formattedPhoneNumber; } public List<Review> getReviews () { return reviews; } public void setReviews (List<Review> reviews) { this.reviews = reviews; } } and this is how i am sending it Intent act = new Intent (context, ActivityLugarDetalles.class); act.putExtra("elementDetails", elementDetails); startActivity(act); i would appreciate your help! thank you!

    Read the article

  • How do you unit test the real world?

    - by Kim Sun-wu
    I'm primarily a C++ coder, and thus far, have managed without really writing tests for all of my code. I've decided this is a Bad Idea(tm), after adding new features that subtly broke old features, or, depending on how you wish to look at it, introduced some new "features" of their own. But, unit testing seems to be an extremely brittle mechanism. You can test for something in "perfect" conditions, but you don't get to see how your code performs when stuff breaks. A for instance is a crawler, let's say it crawls a few specific sites, for data X. Do you simply save sample pages, test against those, and hope that the sites never change? This would work fine as regression tests, but, what sort of tests would you write to constantly check those sites live and let you know when the application isn't doing it's job because the site changed something, that now causes your application to crash? Wouldn't you want your test suite to monitor the intent of the code? The above example is a bit contrived, and something I haven't run into (in case you haven't guessed). Let me pick something I have, though. How do you test an application will do its job in the face of a degraded network stack? That is, say you have a moderate amount of packet loss, for one reason or the other, and you have a function DoSomethingOverTheNetwork() which is supposed to degrade gracefully when the stack isn't performing as it's supposed to; but does it? The developer tests it personally by purposely setting up a gateway that drops packets to simulate a bad network when he first writes it. A few months later, someone checks in some code that modifies something subtly, so the degradation isn't detected in time, or, the application doesn't even recognize the degradation, this is never caught, because you can't run real world tests like this using unit tests, can you? Further, how about file corruption? Let's say you're storing a list of servers in a file, and the checksum looks okay, but the data isn't really. You want the code to handle that, you write some code that you think does that. How do you test that it does exactly that for the life of the application? Can you? Hence, brittleness. Unit tests seem to test the code only in perfect conditions(and this is promoted, with mock objects and such), not what they'll face in the wild. Don't get me wrong, I think unit tests are great, but a test suite composed only of them seems to be a smart way to introduce subtle bugs in your code while feeling overconfident about it's reliability. How do I address the above situations? If unit tests aren't the answer, what is? Thanks!

    Read the article

  • Modify audio pitch of recorded clip (m4v)

    - by devcube
    I'm writing an app in which I'm trying to change the pitch of the audio when I'm recording a movie (.m4v). Or by modifying the audio pitch of the movie afterwards. I want the end result to be a movie (.m4v) that has the original length (i.e. same visual as original) but with modified sound pitch, e.g. a "chipmunk voice". A realtime conversion is to prefer if possible. I've read alot about changing audio pitch in iOS but most examples focus on playback, i.e. playing the sound with a different pitch. In my app I'm recording a movie (.m4v / AVFileTypeQuickTimeMovie) and saving it using standard AVAssetWriter. When saving the movie I have access to the following elements where I've tried to manipulate the audio (e.g. modify the pitch): audio buffer (CMSampleBufferRef) audio input writer (AVAssetWriterAudioInput) audio input writer options (e.g. AVNumberOfChannelsKey, AVSampleRateKey, AVChannelLayoutKey) asset writer (AVAssetWriter) I've tried to hook into the above objects to modify the audio pitch, but without success. I've also tried with Dirac as described here: Real Time Pitch Change In iPhone Using Dirac And OpenAL with AL_PITCH as described here: Piping output from OpenAL into a buffer And the "BASS" library from un4seen: Change Pitch/Tempo In Realtime I haven't found success with any of the above libs, most likely because I don't really know how to use them, and where to hook them into the audio saving code. There seems to be alot of librarys that have similar effects but focuses on playback or custom recording code. I want to manipulate the audio stream I've already got (AVAssetWriterAudioInput) or modify the saved movie clip (.m4v). I want the video to be unmodifed visually, i.e. played at the same speed. But I want the audio to go faster (like a chipmunk) or slower (like a ... monster? :)). Do you have any suggestions how I can modify the pitch in either real time (when recording the movie) or afterwards by converting the entire movie (.m4v file)? Should I look further into Dirac, OpenAL, SoundTouch, BASS or some other library? I want to be able to share the movie to others with modified audio, that's the reason I can't rely on modifying the pitch for playback only. Any help is appreciated, thanks!

    Read the article

  • Strategies for "Always-Connected" Windows Client Data Architecture

    - by magz2010
    Hi. Let me start by saying: this is my 1st post here, this is a bit lenghty, and I havent done Windows Forms development in years....with that in mind please excuse me if this isn't directly a programming question and please bear with me as I really need the help!! I have been asked to develop a Windows Forms app for our company that talks to a central (local area network) Linux Server hosting a PostgreSQL database. The app is to allow users to authenticate themselves into the system and thereafter conduct the usual transactions with the PG database. Ordinarily, I would propose writing a webforms app against Mono, but the clients need to utilise local resources such as USB peripheral devices, so that is out of the question. While it might not seem clear, my questions are italised below: Dilemma #1: The application is meant to be always connected. How should I structure my DAL/BLL - Should this reside on the server or with the client? Dilemma #2: I have been reading up on Client Application Services (CAS), and it seems like a great fit for authentication, as everything is exposed via URIs. I know that a .NET Data Provider exists for PostgreSQL, but not too sure if CAS will all work on a Linux (Debian) server? Believe me, I would get my hands dirty and try myself, but I need to come up with a logical design first before resources are allocated to me for "trial purposes"! Dilemma #3: If the DAL/BLL is to reside on the server, is there any way I can create data services, and expose only these services to authenticated clients. There is a (security) requirement whereby a connection string with username and password to the database cannot be present on any client machines...even if security on the database side is quite rigid. I'm guessing that the only way for this to work would be to create the various CRUD data service methods that are exposed by an ASP.NET app, and have the WindowsForms make a request for data or persist data to the ASP.NET app (thru a URI) and have that return a resultset or value. Would I be correct in assuming this? Should I be looking into WCF Data Services? and will WCF work with a non-SQL Server database? Thank you for taking the time out to read this, but know that I am desperately seeking any advice on this! THANKS A MILLION!!!!

    Read the article

  • Displaying an Image in an activity using URI

    - by evkwan
    Hi, I'm writing an application that uses Intent(MediaStore.ACTION_IMAGE_CAPTURE) to capture and image. On the process of capturing the image, I noted the output of the image's URI. Right after finishing the camera activity, I wish to display the image using this specific URI. The method I used to capture images is: private void saveFullImage() { Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); File file = new File(Environment.getExternalStorageDirectory(), "test.jpg"); outputFileUri = Uri.fromFile(file); intent.putExtra(MediaStore.EXTRA_OUTPUT, outputFileUri); startActivityForResult(intent, TAKE_PICTURE); } Which is a method taken from Reto Meier's book Professional Android 2 Application Development. The method works fine, and I assume that the URI of the picture I just took is stored in the outputFileUri variable. Then at this point of the code is where I want to display the picture: @Override protected void onActivityResult(int requestCode, int resultCode, Intent data) { if (requestCode == TAKE_PICTURE) { //I want to display the picture I just took here //using the URI } } I'm not sure how to do it. I tried creating a new layout object and a new ImageView object using the method setImageURI(outputFileUri). My main layout (xml) did not have a ImageView object. But even when I set the contentView to the new layout with the ImageView attached to it, it doesn't display anything. I tried creating a Bitmap object from the URI and set it to the ImageView, but I get an unexpected error and forced exit. I have seen examples from here here which creates a Bitmap from URI, but it's not displaying it? My question is just how to display an image in the middle of a running activity? Do I need to get the File Path (like this) in order to display it? If I make a Bitmap out of the URI, how do I display the Bitmap? I'm just probably missing something simple...so any help would be a greatly appreciated! Also additional question for thought: If I were to take multiple pictures, would you recommend me to use the SimpleCursorAdapter instead? Thanks!

    Read the article

< Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >