Search Results

Search found 16838 results on 674 pages for 'writing patterns dita cms'.

Page 637/674 | < Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >

  • IEnumerable<T> ToArray usage, is it a copy or a pointer?

    - by Daniel
    I am parsing an arbitrary length byte array that is going to be passed around to a few different layers of parsing. Each parser creates a Header and a Packet payload just like any ordinary encapsulation. And my problem lies in how the encapsulation holds its packet byte array payload. Say i have a 100 byte array, and it has 3 levels of encapsulation. 3 packet objects will be created and i want to set the payload of these packets to the corresponding position in the byte array of the packet. For example lets say the payload size is 20 for all levels, then imagine it has a public byte[] Payload on each object. However the problem is that this byte[] Payload is a copy of the original 100 bytes. So i'm going to end up with 160 bytes in memory instead of 100. If it were in c++ i could just easily use a pointer however i'm writing this in c#. So i created the following class: public class PayloadSegment<T> : IEnumerable<T> { public readonly T[] Array; public readonly int Offset; public readonly int Count; public PayloadSegment(T[] array, int offset, int count) { this.Array = array; this.Offset = offset; this.Count = count; } public T this[int index] { get { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else return Array[Offset + index]; } set { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else Array[Offset + index] = value; } } public IEnumerator<T> GetEnumerator() { for (int i = Offset; i < Offset + Count; i++) yield return Array[i]; } System.Collections.IEnumerator System.Collections.IEnumerable.GetEnumerator() { IEnumerator<T> enumerator = this.GetEnumerator(); while (enumerator.MoveNext()) { yield return enumerator.Current; } } } This way i can simply reference a position inside the original byte array but use positional indexing. However if i do something like: PayloadSegment<byte> something = new PayloadSegment<byte>(someArray, 5, 10); byte[] somethingArray = something.ToArray(); Will the somethingArray be a copy of the bytes, or a reference to the original PayloadSegment which in turn is a reference to the original byte array? Sorry it was hard to word this lol _<

    Read the article

  • Parsing XML wont display all items.

    - by Nauman A
    I have this code but the toast wont display any message what is wrong with my code.. I can get the value from link, linknext but title wont bring out any value. ( I am not very bright with writing code so please suggest anything you may feel like. final Button button = (Button) findViewById(R.id.Button01); button.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { // Perform action on click try { URL url = new URL( "http://somelink.com=" + Link.setFirst_link); DocumentBuilderFactory dbf = DocumentBuilderFactory.newInstance(); DocumentBuilder db = dbf.newDocumentBuilder(); Document doc = db.parse(new InputSource(url.openStream())); doc.getDocumentElement().normalize(); NodeList nodeList = doc.getElementsByTagName("item"); /** Assign textview array lenght by arraylist size */ for (int i = 0; i < nodeList.getLength(); i++) { Node node = nodeList.item(i); Element fstElmnt = (Element) node; NodeList nameList = fstElmnt.getElementsByTagName("link"); Element nameElement = (Element) nameList.item(0); nameList = nameElement.getChildNodes(); String img = (((Node) nameList.item(0)).getNodeValue()); NodeList websiteList = fstElmnt.getElementsByTagName("linknext"); Element websiteElement = (Element) websiteList.item(0); websiteList = websiteElement.getChildNodes(); String nextlink = (((Node) websiteList.item(0)).getNodeValue()); Link.setFirst_link = nextlink; Drawable drawable = LoadImageFromWebOperations(img); imgView.setImageDrawable(drawable); NodeList titleList = fstElmnt.getElementsByTagName("title"); Element titleElement = (Element) titleList.item(0); websiteList = titleElement.getChildNodes(); String title = (((Node) titleList.item(0)).getNodeValue()); Context context = getApplicationContext(); CharSequence text = title; int duration = Toast.LENGTH_SHORT; Toast toast = Toast.makeText(context, text, duration); toast.show(); } } catch (Exception e) { System.out.println("XML Pasing Excpetion = " + e); } } }); /** Set the layout view to display */ } Here is the xml file <?xml version="1.0"?> <maintag> <item> <link>http://image.com/357769.jpg?40</link> <linknext>http://www.image.com</linknext> <title>imagename</title> </item> </maintag>

    Read the article

  • Should I skip authorization, with CanCan, of an action that instantiates a resource?

    - by irkenInvader
    I am writing a web app to pick random lists of cards from larger, complete sets of cards. I have a Card model and a CardSet model. Both models have a full RESTful set of 7 actions (:index, :new, :show, etc). The CardSetsController has an extra action for creating random sets: :random. # app/models/card_set.rb class CardSet < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :cards, :through => :memberships # app/models/card.rb class Card < ActiveRecord::Base belongs_to :creator, :class_name => "User" has_many :memberships has_many :card_sets, :through => :memberships I have added Devise for authentication and CanCan for authorizations. I have users with an 'editor' role. Editors are allowed to create new CardSets. Guest users (Users who have not logged in) can only use the :index and :show actions. These authorizations are working as designed. Editors can currently use both the :random and the :new actions without any problems. Guest users, as expected, cannot. # app/controllers/card_sets_controller.rb class CardSetsController < ApplicationController before_filter :authenticate_user!, :except => [:show, :index] load_and_authorize_resource I want to allow guest users to use the :random action, but not the :new action. In other words, they can see new random sets, but not save them. The "Save" button on the :random action's view is hidden (as designed) from the guest users. The problem is, the first thing the :random action does is build a new instance of the CardSet model to fill out the view. When cancan tries to load_and_authorize_resource a new CardSet, it throws a CanCan::AccessDenied exception. Therefore, the view never loads and the guest user is served a "You need to sign in or sign up before continuing" message. # app/controllers/card_sets_controllers.rb def random @card_set = CardSet.new( :name => "New Set of 10", :set_type => "Set of 10" ) I realize that I can tell load_and_authorize_resource to skip the :random action by passing :except => :random to the call, but that just feels "wrong" for some reason. What's the "right" way to do this? Should I create the new random set without instantiating a new CardSet? Should I go ahead and add the exception?

    Read the article

  • Chrome extension - Localstorage not working

    - by Bjarki Jonasson
    I'm writing a Chrome extension that uses a content script to modify certain parts of a website. The content script worked fine until I tried to add an options page to my extension. Right now I'm using an options.html file to save user preferences to localstorage, as you can see here: <html> <head><title>Options</title></head> <script type="text/javascript"> function save_options() { var select = document.getElementById("width"); var width = select.children[select.selectedIndex].value; localStorage["site_width"] = width; } function restore_options() { var fwidth = localStorage["site_width"]; if (!fwidth) { return; } var select = document.getElementById("width"); for (var i = 0; i < select.children.length; i++) { var child = select.children[i]; if (child.value == fwidth) { child.selected = "true"; break; } } } </script> <body onload="restore_options()"> Width: <select id="width"> <option value="100%">100%</option> <option value="90%">90%</option> <option value="80%">80%</option> <option value="70%">70%</option> </select> <br> <button onclick="save_options()">Save</button> </body> </html> I also have a background.html file to handle the communication between the content script and the localstorage: <html> <script type="text/javascript"> chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { if (request.method == "siteWidth") sendResponse({status: localStorage["site_width"]}); else sendResponse({}); }); </script> </html> Then there's the actual content script that looks like this: var Width; chrome.extension.sendRequest({method: "siteWidth"}, function(response) { width = response.status; }); None of that code actually works. It looks solid enough to me but I'm not a very experienced programmer so I might be wrong. Could someone explain localstorage to me in layman's terms?

    Read the article

  • Java Socket Connection is flooding network OR resulting in high ping

    - by user1461100
    i have a little problem with my java socket code. I'm writing an android client application which is sending data to a java multithreaded socket server on my pc through direct(!) wireless connection. It works fine but i want to improve it for mobile applications as it is very power consuming by now. When i remove two special lines in my code, the cpu usage of my mobile device (htc one x) is totally okay but then my connection seems to have high ping rates or something like that... Here is a server code snippet where i receive the clients data: while(true) { try { .... Object obj = in.readObject(); if(obj != null) { Class clazz = obj.getClass(); String className = clazz.getName(); if(className.equals("java.lang.String")) { String cmd = (String)obj; if(cmd.equals("dc")) { System.out.println("Client "+id+" disconnected!"); Server.connectedClients[id-1] = false; break; } if(cmd.substring(0,1).equals("!")) { robot.keyRelease(PlayerEnum.getKey(cmd,id)); } else { robot.keyPress(PlayerEnum.getKey(cmd,id)); } } } } catch .... Heres the client part, where i send my data in a while loop: private void networking() { try { if(client != null) { .... out.writeObject(sendQueue.poll()); .... } } catch .... when i write it this why, i send data everytime the while loop gets executed.. when sendQueue is empty, a null "Object" will be send. this results in "high" network traffic and in "high" cpu usage. BUT: all send comments are received nearly immediately. when i change the code to following: while(true) ... if(sendQueue.peek() != null) { out.writeObject(sendQueue.poll()); } ... the cpu usage is totally okay but i'm getting some laggs.. the commands do not arrive fast enough.. as i said, it works fine (besides cpu usage) if i'm sending data(with that null objects) every while execution. but i'm sure that this is very rough coding style because i'm kind of flooding the network. any hints? what am i doing wrong?? Thanks for your Help! Sincerly yours, maaft

    Read the article

  • Inserting checkbox values

    - by rabeea
    hey i have registration form that has checkboxes along with other fields. i cant insert the selected checkbox values into the data base. i have made one field in the database for storing all checked values. this is the code for checkbox part in the form: Websites, IT and Software Writing and Content <pre><input type="checkbox" name="expertise[]" value="Design and Media"> Design and Media <input type="checkbox" name="expertise[]" value="Data entry and Admin"> Data entry and Admin </pre> <pre><input type="checkbox" name="expertise[]" value="Engineering and Skills"> Engineering and Science <input type="checkbox" name="expertise[]" value="Seles and Marketing"> Sales and Marketing </pre> <pre><input type="checkbox" name="expertise[]" value="Business and Accounting"> Business and Accounting <input type="checkbox" name="expertise[]" value="Others"> Others </pre> and this is the corresponding php code for inserting data $checkusername=mysql_query("SELECT * FROM freelancer WHERE fusername='{$_POST['username']}'"); if (mysql_num_rows($checkusername)==1) { echo "username already exist"; } else { $query = "insert into freelancer(ffname,flname,fgender,femail,fusername,fpwd,fphone,fadd,facc,facc_name,fbank_details,fcity,fcountry,fexpertise,fprofile,fskills,fhourly_rate,fresume) values ('".$_POST['first_name']."','".$_POST['last_name']."','".$_POST['gender']."','".$_POST['email']."','".$_POST['username']."','".$_POST['password']."','".$_POST['phone']."','".$_POST['address']."','".$_POST['acc_num']."','".$_POST['acc_name']."','".$_POST['bank']."','".$_POST['city']."','".$_POST['country']."','".implode(',',$_POST['expertise'])."','".$_POST['profile']."','".$_POST['skills']."','".$_POST['rate']."','".$_POST['resume']."')"; $result = ($query) or die (mysql_error()); this code inserts data for all fields but the checkbox value field remains empty???

    Read the article

  • Methodology for a Rails app

    - by Aaron Vegh
    I'm undertaking a rather large conversion from a legacy database-driven Windows app to a Rails app. Because of the large number of forms and database tables involved, I want to make sure I've got the right methodology before getting too far. My chief concern is minimizing the amount of code I have to write. There are many models that interact together, and I want to make sure I'm using them correctly. Here's a simplified set of models: class Patient < ActiveRecord::Base has_many :PatientAddresses has_many :PatientFileStatuses end class PatientAddress < ActiveRecord::Base belongs_to :Patient end class PatientFileStatus < ActiveRecord::Base belongs_to :Patient end The controller determines if there's a Patient selected; everything else is based on that. In the view, I will be needing data from each of these models. But it seems like I have to write an instance variable in my controller for every attribute that I want to use. So I start writing code like this: @patient = Patient.find(session[:patient]) @patient_addresses = @patient.PatientAddresses @patient_file_statuses = @patient.PatientFileStatuses @enrollment_received_when = @patient_file_statuses[0].EnrollmentReceivedWhen @consent_received = @patient_file_statuses[0].ConsentReceived @consent_received_when = @patient_file_statuses[0].ConsentReceivedWhen The first three lines grab the Patient model and its relations. The next three lines are examples of my providing values to the view from one of those relations. The view has a combination of text fields and select fields to show the data above. For example: <%= select("patientfilestatus", "ConsentReceived", {"val1"="val1", "val2"="val2", "Written"="Written"}, :include_blank=true )% <%= calendar_date_select_tag "patient_file_statuses[EnrollmentReceivedWhen]", @enrollment_complete_when, :popup=:force % (BTW, the select tag isn't really working; I think I have to use collection_select?) My questions are: Do I have to manually declare the value of every instance variable in the controller, or can/should I do it within the view? What is the proper technique for displaying a select tag for data that's not the primary model? When I go to save changes to this form, will I have to manually pick out the attributes for each model and save them individually? Or is there a way to name the fields such that ActiveRecord does the right thing? Thanks in advance, Aaron.

    Read the article

  • How do I write sql data into a textbox after a submit type event

    - by Matt
    Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • Primary language - C++/Qt, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • Can I avoid a threaded UDP socket in Python dropping data?

    - by 666craig
    First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

    Read the article

  • How to change button's image in visual c++ at run time?

    - by karikari
    After trying and error for many times, I decided to ask here. My objective is I wanted to change the feature of my IE toolbar button. The button is firstly setup by IE at IE startup using the function CRebarHandler::onSetRedraw and CRebarHandler::setButtonMenu2(). And then, I create a call from another cpp file, to call CRebarHandler::setButtonMenu2(). I intent to change just the button's image. I assigned the ID of the image correctly. But somehow it does not work. When I put other code inside this function,like a code for writing to file, it is proven work. Means, it is properly being called from the other file. But the thing is, the code for the button inside CRebarHandler::setButtonMenu2() seems does not work. Need help. Here is the code I am working on (I modify John Lister's button code): LRESULT CRebarHandler::onSetRedraw(UINT uMsg, WPARAM wParam, LPARAM lParam, BOOL& bHandled){ bHandled=false; if (m_ieVer==6){ if (!m_hWndToolbar) scanForToolbarSlow(); if (m_hWndToolbar){ findButton(m_hWndToolbar); if (m_buttonID>0) setButtonMenu(); } } return S_OK; } void CRebarHandler::setButtonMenu(){ HIMAGELIST hImageList = ImageList_Create(32, 32,ILC_COLOR16 | ILC_MASK,1, 0); HINSTANCE module = _AtlBaseModule.GetResourceInstance(); TBBUTTONINFO inf; inf.cbSize=sizeof(inf); inf.dwMask = TBIF_IMAGE; char psBuffer[128]; FILE *pPipe; float f = 0; pPipe = _popen("javaw -jar c:\\simmetrics.jar c:\\chtml.txt c:\\thtml.txt", "rt" ); char* p = fgets(psBuffer, 128, pPipe); std::istringstream iss(p); iss >> f; if (f > 0.9) { inf.iImage = 1; SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); iss.clear(); f = 0; } else { inf.iImage = 2; SendMessage(m_hWndToolbar, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); iss.clear(); f = 0; } iss.clear(); f = 0; } void CRebarHandler::setButtonMenu2(){ TBBUTTONINFO inf; inf.cbSize=sizeof(inf); inf.dwMask = TBIF_IMAGE; inf.iImage = 1; //green SendMessage(NULL, TB_SETBUTTONINFO, m_buttonID, (LPARAM)(&inf)); }

    Read the article

  • JavaScript regular expression literal persists between function calls

    - by Charles Anderson
    I have this piece of code: function func1(text) { var pattern = /([\s\S]*?)(\<\?(?:attrib |if |else-if |else|end-if|search |for |end-for)[\s\S]*?\?\>)/g; var result; while (result = pattern.exec(text)) { if (some condition) { throw new Error('failed'); } ... } } This works, unless the throw statement is executed. In that case, the next time I call the function, the exec() call starts where it left off, even though I am supplying it with a new value of 'text'. I can fix it by writing var pattern = new RegExp('.....'); instead, but I don't understand why the first version is failing. How is the regular expression persisting between function calls? (This is happening in the latest versions of Firefox and Chrome.) Edit Complete test case: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-type" content="text/html;charset=UTF-8"> <title>Test Page</title> <style type='text/css'> body { font-family: sans-serif; } #log p { margin: 0; padding: 0; } </style> <script type='text/javascript'> function func1(text, count) { var pattern = /(one|two|three|four|five|six|seven|eight)/g; log("func1"); var result; while (result = pattern.exec(text)) { log("result[0] = " + result[0] + ", pattern.index = " + pattern.index); if (--count <= 0) { throw "Error"; } } } function go() { try { func1("one two three four five six seven eight", 3); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } try { func1("one two three four five six seven eight", 99); } catch (e) { } try { func1("one two three four five six seven eight", 2); } catch (e) { } } function log(msg) { var log = document.getElementById('log'); var p = document.createElement('p'); p.innerHTML = msg; log.appendChild(p); } </script> </head> <body><div> <input type='button' id='btnGo' value='Go' onclick='go();'> <hr> <div id='log'></div> </div></body> </html> The regular expression continues with 'four' as of the second call on FF and Chrome, not on IE7 or Opera.

    Read the article

  • MySQL LEFT OUTER JOIN virtual table

    - by user1707323
    I am working on a pretty complicated query let me try to explain it to you. Here is the tables that I have in my MySQL database: students Table --- `students` --- student_id first_name last_name current_status status_change_date ------------ ------------ ----------- ---------------- -------------------- 1 John Doe Active NULL 2 Jane Doe Retread 2012-02-01 students_have_courses Table --- `students_have_courses` --- students_student_id courses_course_id s_date e_date int_date --------------------- ------------------- ---------- ---------- ----------- 1 1 2012-01-01 2012-01-04 2012-01-05 1 2 2012-01-05 NULL NULL 2 1 2012-01-10 2012-01-11 NULL students_have_optional_courses Table --- `students_have_optional_courses` --- students_student_id optional_courses_opcourse_id s_date e_date --------------------- ------------------------------ ---------- ---------- 1 1 2012-01-02 2012-01-03 1 1 2012-01-06 NULL 1 5 2012-01-07 NULL Here is my query so far SELECT `students_and_courses`.student_id, `students_and_courses`.first_name, `students_and_courses`.last_name, `students_and_courses`.courses_course_id, `students_and_courses`.s_date, `students_and_courses`.e_date, `students_and_courses`.int_date, `students_have_optional_courses`.optional_courses_opcourse_id, `students_have_optional_courses`.s_date, `students_have_optional_courses`.e_date FROM ( SELECT `c_s_a_s`.student_id, `c_s_a_s`.first_name, `c_s_a_s`.last_name, `c_s_a_s`.courses_course_id, `c_s_a_s`.s_date, `c_s_a_s`.e_date, `c_s_a_s`.int_date FROM ( SELECT `students`.student_id, `students`.first_name, `students`.last_name, `students_have_courses`.courses_course_id, `students_have_courses`.s_date, `students_have_courses`.e_date, `students_have_courses`.int_date FROM `students` LEFT OUTER JOIN `students_have_courses` ON ( `students_have_courses`.`students_student_id` = `students`.`student_id` AND (( `students_have_courses`.`s_date` >= `students`.`status_change_date` AND `students`.current_status = 'Retread' ) OR `students`.current_status = 'Active') ) WHERE `students`.current_status = 'Active' OR `students`.current_status = 'Retread' ) `c_s_a_s` ORDER BY `c_s_a_s`.`courses_course_id` DESC ) `students_and_courses` LEFT OUTER JOIN `students_have_optional_courses` ON ( `students_have_optional_courses`.students_student_id = `students_and_courses`.student_id AND `students_have_optional_courses`.s_date >= `students_and_courses`.s_date AND `students_have_optional_courses`.e_date IS NULL ) GROUP BY `students_and_courses`.student_id; What I want to be returned is the student_id, first_name, and last_name for all Active or Retread students and then LEFT JOIN the highest course_id, s_date, e_date, and int_date for the those students where the s_date is since the status_change_date if status is 'Retread'. Then LEFT JOIN the highest optional_courses_opcourse_id, s_date, and e_date from the students_have_optional_courses TABLE where the students_have_optional_courses.s_date is greater or equal to the students_have_courses.s_date and the students_have_optional_courses.e_date IS NULL Here is what is being returned: student_id first_name last_name courses_course_id s_date e_date int_date optional_courses_opcourse_id s_date_1 e_date_1 ------------ ------------ ----------- ------------------- ---------- ---------- ------------ ------------------------------ ---------- ---------- 1 John Doe 2 2012-01-05 NULL NULL 1 2012-01-06 NULL 2 Jane Doe NULL NULL NULL NULL NULL NULL NULL Here is what I want being returned: student_id first_name last_name courses_course_id s_date e_date int_date optional_courses_opcourse_id s_date_1 e_date_1 ------------ ------------ ----------- ------------------- ---------- ---------- ------------ ------------------------------ ---------- ---------- 1 John Doe 2 2012-01-05 NULL NULL 5 2012-01-07 NULL 2 Jane Doe NULL NULL NULL NULL NULL NULL NULL Everything is working except one thing, I cannot seem to get the highest students_have_optional_courses.optional_courses_opcourse_id no matter how I form the query Sorry, I just solved this myself after writing this all out I think it helped me think of the solution. Here is the solution query: SELECT `students_and_courses`.student_id, `students_and_courses`.first_name, `students_and_courses`.last_name, `students_and_courses`.courses_course_id, `students_and_courses`.s_date, `students_and_courses`.e_date, `students_and_courses`.int_date, `students_optional_courses`.optional_courses_opcourse_id, `students_optional_courses`.s_date, `students_optional_courses`.e_date FROM ( SELECT `c_s_a_s`.student_id, `c_s_a_s`.first_name, `c_s_a_s`.last_name, `c_s_a_s`.courses_course_id, `c_s_a_s`.s_date, `c_s_a_s`.e_date, `c_s_a_s`.int_date FROM ( SELECT `students`.student_id, `students`.first_name, `students`.last_name, `students_have_courses`.courses_course_id, `students_have_courses`.s_date, `students_have_courses`.e_date, `students_have_courses`.int_date FROM `students` LEFT OUTER JOIN `students_have_courses` ON ( `students_have_courses`.`students_student_id` = `students`.`student_id` AND (( `students_have_courses`.`s_date` >= `students`.`status_change_date` AND `students`.current_status = 'Retread' ) OR `students`.current_status = 'Active') ) WHERE `students`.current_status = 'Active' OR `students`.current_status = 'Retread' ) `c_s_a_s` ORDER BY `c_s_a_s`.`courses_course_id` DESC ) `students_and_courses` LEFT OUTER JOIN ( SELECT * FROM `students_have_optional_courses` ORDER BY `students_have_optional_courses`.optional_courses_opcourse_id DESC ) `students_optional_courses` ON ( `students_optional_courses`.students_student_id = `students_and_courses`.student_id AND `students_optional_courses`.s_date >= `students_and_courses`.s_date AND `students_optional_courses`.e_date IS NULL ) GROUP BY `students_and_courses`.student_id;

    Read the article

  • Error with connection in my database servlet

    - by Zerobu
    Hello, I am writing a Database servlet, all seems well except that there seems to be an error in my connection import java.io.IOException; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.Statement; import java.util.ArrayList; import javax.servlet.RequestDispatcher; import javax.servlet.ServletContext; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; public class DBServlet3 extends HttpServlet { private static final long serialVersionUID = 1L; @Override public void init() throws ServletException { super.init(); try { String jdbcDriverClass= getServletContext().getInitParameter( "jdbcDriverClass" ); if (jdbcDriverClass == null) throw new ServletException( "Could not find jdbcDriverClass initialization parameter" ); Class.forName( jdbcDriverClass ); } catch (ClassNotFoundException e) { throw new ServletException( "Could not load JDBC driver class", e ); } } @Override protected void doGet( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { RequestDispatcher dispatcher= request.getRequestDispatcher( "/db.jsp" ); ServletContext application= getServletContext(); ArrayList<String> names= new ArrayList<String>(); try { Connection connection= null; Statement statement= null; ResultSet results= null; try { String jdbcUrl= application.getInitParameter( "jdbcUrl" ); String jdbcUser= application.getInitParameter( "jdbcUser" ); String jdbcPassword= application.getInitParameter( "jdbcPassword" ); connection= DriverManager.getConnection( jdbcUrl, jdbcUser, jdbcPassword ); statement= connection.createStatement(); results= statement.executeQuery( "SELECT * FROM students" ); while (results.next()) { String name= results.getString( "name" ); names.add( name ); } } finally { if (results != null) results.close(); if (statement != null) statement.close(); if (connection != null) connection.close(); } } catch (SQLException e) { throw new ServletException( e ); } request.setAttribute( "names", names ); dispatcher.forward( request, response ); } @Override protected void doPost( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { String sql= "INSERT INTO students VALUES (" + request.getParameter( "id" ) + ", '" + request.getParameter( "name" ) + "')"; sql= "INSERT INTO students VALUES (?, ?, ?, ?)"; PreparedStatement statement= connection.prepareStatement( sql ); //error on this line statement.setString( 1, request.getParameter( "id" ) ); statement.setString( 2, request.getParameter( "name" ) ); } }

    Read the article

  • Is this BlockingQueue susceptible to deadlock?

    - by unforgiven3
    I've been using this code as a queue that blocks on Dequeue() until an element is enqueued. I've used this code for a few years now in several projects, all with no issues... until now. I'm seeing a deadlock in some code I'm writing now, and in investigating the problem, my 'eye of suspicion' has settled on this BlockingQueue<T>. I can't prove it, so I figured I'd ask some people smarter than me to review it for potential issues. Can you guys see anything that might cause a deadlock in this code? public class BlockingQueue<T> { private readonly Queue<T> _queue; private readonly ManualResetEvent _event; /// <summary> /// Constructor /// </summary> public BlockingQueue() { _queue = new Queue<T>(); _event = new ManualResetEvent(false); } /// <summary> /// Read-only property to get the size of the queue /// </summary> public int Size { get { int count; lock (_queue) { count = _queue.Count; } return count; } } /// <summary> /// Enqueues element on the queue /// </summary> /// <param name="element">Element to enqueue</param> public void Enqueue(T element) { lock (_queue) { _queue.Enqueue(element); _event.Set(); } } /// <summary> /// Dequeues an element from the queue /// </summary> /// <returns>Dequeued element</returns> public T Dequeue() { T element; while (true) { if (Size == 0) { _event.Reset(); _event.WaitOne(); } lock (_queue) { if (_queue.Count == 0) continue; element = _queue.Dequeue(); break; } } return element; } /// <summary> /// Clears the queue /// </summary> public void Clear() { lock (_queue) { _queue.Clear(); } } }

    Read the article

  • B-trees, databases, sequential inputs, and speed.

    - by IanC
    I know from experience that b-trees have awful performance when data is added to them sequentially (regardless of the direction). However, when data is added randomly, best performance is obtained. This is easy to demonstrate with the likes of an RB-Tree. Sequential writes cause a maximum number of tree balances to be performed. I know very few databases use binary trees, but rather used n-order balanced trees. I logically assume they suffer a similar fate to binary trees when it comes to sequential inputs. This sparked my curiosity. If this is so, then one could deduce that writing sequential IDs (such as in IDENTITY(1,1)) would cause multiple re-balances of the tree to occur. I have seen many posts argue against GUIDs as "these will cause random writes". I never use GUIDs, but it struck me that this "bad" point was in fact a good point. So I decided to test it. Here is my code: SET ANSI_NULLS ON GO SET QUOTED_IDENTIFIER ON GO CREATE TABLE [dbo].[T1]( [ID] [int] NOT NULL CONSTRAINT [T1_1] PRIMARY KEY CLUSTERED ([ID] ASC) ) GO CREATE TABLE [dbo].[T2]( [ID] [uniqueidentifier] NOT NULL CONSTRAINT [T2_1] PRIMARY KEY CLUSTERED ([ID] ASC) ) GO declare @i int, @t1 datetime, @t2 datetime, @t3 datetime, @c char(300) set @t1 = GETDATE() set @i = 1 while @i < 2000 begin insert into T2 values (NEWID(), @c) set @i = @i + 1 end set @t2 = GETDATE() WAITFOR delay '0:0:10' set @t3 = GETDATE() set @i = 1 while @i < 2000 begin insert into T1 values (@i, @c) set @i = @i + 1 end select DATEDIFF(ms, @t1, @t2) AS [Int], DATEDIFF(ms, @t3, getdate()) AS [GUID] drop table T1 drop table T2 Note that I am not subtracting any time for the creation of the GUID nor for the considerably extra size of the row. The results on my machine were as follows: Int: 17,340 ms GUID: 6,746 ms This means that in this test, random inserts of 16 bytes was almost 3 times faster than sequential inserts of 4 bytes. Would anyone like to comment on this? Ps. I get that this isn't a question. It's an invite to discussion, and that is relevant to learning optimum programming.

    Read the article

  • Mercurial local repository backup

    - by Ricket
    I'm a big fan of backing things up. I keep my important school essays and such in a folder of my Dropbox. I make sure that all of my photos are duplicated to an external drive. I have a home server where I keep important files mirrored across two drives inside the server (like a software RAID 1). So for my code, I have always used Subversion to back it up. I keep the trunk folder with a stable copy of my application, but then I create a branch named with my username, and inside there is my working copy. I make very few changes between commits to that branch, with the understanding that the code in there is my backup. Now I'm looking into Mercurial, and I must admit I haven't truly used it yet so I may have this all wrong. But it seems to me that you have a server-side repository, and then you clone it to a working directory in the form of a local repository. Then as you work on something, you make commits to that local repository, and when things are in a state to be shared with others, you hg push to the parent repository on the server. Between pushes of stable, tested, bug-free code, where is the backup? After doing some thinking, I've come to the conclusion that it is not meant for backup purposes and it assumes you've handled that on your own. I guess I need to keep my Mercurial local repositories in my dropbox or some other backed-up location, since my in-progress code is not pushed to the server. Is this pretty much it, or have I missed something? If you use Mercurial, how do you backup your local repositories? If you had turned on your computer this morning and your hard drive went up in flames (or, more likely, the read head went bad, or the OS corrupted itself, ...), what would be lost? If you spent the past week developing a module, writing test cases for it, documenting and commenting it, and then a virus wipes your local repository away, isn't that the only copy? So then on the flip side, do you create a remote repository for every local repository and push to it all the time? How do you find a balance? How do you ensure your code is backed up? Where is the line between using Mercurial as backup, and using a local filesystem backup utility to keep your local repositories safe?

    Read the article

  • Modify audio pitch of recorded clip (m4v)

    - by devcube
    I'm writing an app in which I'm trying to change the pitch of the audio when I'm recording a movie (.m4v). Or by modifying the audio pitch of the movie afterwards. I want the end result to be a movie (.m4v) that has the original length (i.e. same visual as original) but with modified sound pitch, e.g. a "chipmunk voice". A realtime conversion is to prefer if possible. I've read alot about changing audio pitch in iOS but most examples focus on playback, i.e. playing the sound with a different pitch. In my app I'm recording a movie (.m4v / AVFileTypeQuickTimeMovie) and saving it using standard AVAssetWriter. When saving the movie I have access to the following elements where I've tried to manipulate the audio (e.g. modify the pitch): audio buffer (CMSampleBufferRef) audio input writer (AVAssetWriterAudioInput) audio input writer options (e.g. AVNumberOfChannelsKey, AVSampleRateKey, AVChannelLayoutKey) asset writer (AVAssetWriter) I've tried to hook into the above objects to modify the audio pitch, but without success. I've also tried with Dirac as described here: Real Time Pitch Change In iPhone Using Dirac And OpenAL with AL_PITCH as described here: Piping output from OpenAL into a buffer And the "BASS" library from un4seen: Change Pitch/Tempo In Realtime I haven't found success with any of the above libs, most likely because I don't really know how to use them, and where to hook them into the audio saving code. There seems to be alot of librarys that have similar effects but focuses on playback or custom recording code. I want to manipulate the audio stream I've already got (AVAssetWriterAudioInput) or modify the saved movie clip (.m4v). I want the video to be unmodifed visually, i.e. played at the same speed. But I want the audio to go faster (like a chipmunk) or slower (like a ... monster? :)). Do you have any suggestions how I can modify the pitch in either real time (when recording the movie) or afterwards by converting the entire movie (.m4v file)? Should I look further into Dirac, OpenAL, SoundTouch, BASS or some other library? I want to be able to share the movie to others with modified audio, that's the reason I can't rely on modifying the pitch for playback only. Any help is appreciated, thanks!

    Read the article

  • Strategies for "Always-Connected" Windows Client Data Architecture

    - by magz2010
    Hi. Let me start by saying: this is my 1st post here, this is a bit lenghty, and I havent done Windows Forms development in years....with that in mind please excuse me if this isn't directly a programming question and please bear with me as I really need the help!! I have been asked to develop a Windows Forms app for our company that talks to a central (local area network) Linux Server hosting a PostgreSQL database. The app is to allow users to authenticate themselves into the system and thereafter conduct the usual transactions with the PG database. Ordinarily, I would propose writing a webforms app against Mono, but the clients need to utilise local resources such as USB peripheral devices, so that is out of the question. While it might not seem clear, my questions are italised below: Dilemma #1: The application is meant to be always connected. How should I structure my DAL/BLL - Should this reside on the server or with the client? Dilemma #2: I have been reading up on Client Application Services (CAS), and it seems like a great fit for authentication, as everything is exposed via URIs. I know that a .NET Data Provider exists for PostgreSQL, but not too sure if CAS will all work on a Linux (Debian) server? Believe me, I would get my hands dirty and try myself, but I need to come up with a logical design first before resources are allocated to me for "trial purposes"! Dilemma #3: If the DAL/BLL is to reside on the server, is there any way I can create data services, and expose only these services to authenticated clients. There is a (security) requirement whereby a connection string with username and password to the database cannot be present on any client machines...even if security on the database side is quite rigid. I'm guessing that the only way for this to work would be to create the various CRUD data service methods that are exposed by an ASP.NET app, and have the WindowsForms make a request for data or persist data to the ASP.NET app (thru a URI) and have that return a resultset or value. Would I be correct in assuming this? Should I be looking into WCF Data Services? and will WCF work with a non-SQL Server database? Thank you for taking the time out to read this, but know that I am desperately seeking any advice on this! THANKS A MILLION!!!!

    Read the article

  • How to discover classes with [Authorize] attributes using Reflection in C#? (or How to build Dynamic

    - by Pretzel
    Maybe I should back-up and widen the scope before diving into the title question... I'm currently writing a web app in ASP.NET MVC 1.0 (although I do have MVC 2.0 installed on my PC, so I'm not exactly restricted to 1.0) -- I've started with the standard MVC project which has your basic "Welcome to ASP.NET MVC" and shows both the [Home] tab and [About] tab in the upper-right corner. Pretty standard, right? I've added 4 new Controller classes, let's call them "Astronomer", "Biologist", "Chemist", and "Physicist". Attached to each new controller class is the [Authorize] attribute. For example, for the BiologistController.cs [Authorize(Roles = "Biologist,Admin")] public class BiologistController : Controller { public ActionResult Index() { return View(); } } These [Authorize] tags naturally limit which user can access different controllers depending on Roles, but I want to dynamically build a Menu at the top of my website in the Site.Master Page based on the Roles the user is a part of. So for example, if JoeUser was a member of Roles "Astronomer" and "Physicist", the navigation menu would say: [Home] [Astronomer] [Physicist] [About] And naturally, it would not list links to "Biologist" or "Chemist" controller Index page. Or if "JohnAdmin" was a member of Role "Admin", links to all 4 controllers would show up in the navigation bar. Ok, you prolly get the idea... Starting with the answer from this StackOverflow topic about Dynamic Menu building in ASP.NET, I'm trying to understand how I would fully implement this. (I'm a newbie and need a little more guidance, so please bare with me.) The answer proposes Extending the Controller class (call it "ExtController") and then have each new WhateverController inherit from ExtController. My conclusion is that I would need to use Reflection in this ExtController Constructor to determine which Classes and Methods have [Authorize] attributes attached to them to determine the Roles. Then using a Static Dictionary, store the Roles and Controllers/Methods in key-value pairs. I imagine it something like this: public class ExtController : Controller { protected static Dictionary<Type,List<string>> ControllerRolesDictionary; protected override void OnActionExecuted(ActionExecutedContext filterContext) { // build list of menu items based on user's permissions, and add it to ViewData IEnumerable<MenuItem> menu = BuildMenu(); ViewData["Menu"] = menu; } private IEnumerable<MenuItem> BuildMenu() { // Code to build a menu SomeRoleProvider rp = new SomeRoleProvider(); foreach (var role in rp.GetRolesForUser(HttpContext.User.Identity.Name)) { } } public ExtController() { // Use this.GetType() to determine if this Controller is already in the Dictionary if (!ControllerRolesDictionary.ContainsKey(this.GetType())) { // If not, use Reflection to add List of Roles to Dictionary // associating with Controller } } } Is this doable? If so, how do I perform Reflection in the ExtController constructor to discover the [Authorize] attribute and related Roles (if any) ALSO! Feel free to go out-of-scope on this question and suggest an alternate way of solving this "Dynamic Site.Master Menu based on Roles" problem. I'm the first to admit that this may not be the best approach.

    Read the article

  • ActionResult - Service

    - by cem
    I bored, writing same code for service and ui. Then i tried to write a converter for simple actions. This converter, converting Service Results to MVC result, seems like good solution for me but anyway i think this gonna opposite MVC pattern. So here, I need help, what you think about algorithm - is this good or not? Thanks ServiceResult - Base: public abstract class ServiceResult { public static NoPermissionResult Permission() { return new NoPermissionResult(); } public static SuccessResult Success() { return new SuccessResult(); } public static SuccessResult<T> Success<T>(T result) { return new SuccessResult<T>(result); } protected ServiceResult(ServiceResultType serviceResultType) { _resultType = serviceResultType; } private readonly ServiceResultType _resultType; public ServiceResultType ResultType { get { return _resultType; } } } public class SuccessResult<T> : ServiceResult { public SuccessResult(T result) : base(ServiceResultType.Success) { _result = result; } private readonly T _result; public T Result { get { return _result; } } } public class SuccessResult : SuccessResult<object> { public SuccessResult() : this(null) { } public SuccessResult(object o) : base(o) { } } Service - eg. ForumService: public ServiceResult Delete(IVUser user, int id) { Forum forum = Repository.GetDelete(id); if (!Permission.CanDelete(user, forum)) { return ServiceResult.Permission(); } Repository.Delete(forum); return ServiceResult.Success(); } Controller: public class BaseController { public ActionResult GetResult(ServiceResult result) { switch (result.ResultType) { case ServiceResultType.Success: var successResult = (SuccessResult)result; return View(successResult.Result); break; case ServiceResultType.NoPermission: return View("Error"); break; default: return View(); break; } } } [HandleError] public class ForumsController : BaseController { [ValidateAntiForgeryToken] [Transaction] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Delete(int id) { ServiceResult result = ForumService.Delete(WebUser.Current, id); /* Custom result */ if (result.ResultType == ServiceResultType.Success) { TempData[ControllerEnums.GlobalViewDataProperty.PageMessage.ToString()] = "The forum was successfully deleted."; return this.RedirectToAction(ec => Index()); } /* Custom result */ /* Execute Permission result etc. */ TempData[ControllerEnums.GlobalViewDataProperty.PageMessage.ToString()] = "A problem was encountered preventing the forum from being deleted. " + "Another item likely depends on this forum."; return GetResult(result); } }

    Read the article

  • Internet Explorer 8 + Deflate

    - by Andreas Bonini
    I have a very weird problem.. I really do hope someone has an answer because I wouldn't know where else to ask. I am writing a cgi application in C++ which is executed by Apache and outputs HTML code. I am compressing the HTML output myself - from within my C++ application - since my web host doesn't support mod_deflate for some reason. I tested this with Firefox 2, Firefox 3, Opera 9, Opera 10, Google Chrome, Safari, IE6, IE7, IE8, even wget.. It works with ANYTHING except IE8. IE8 just says "Internet Explorer cannot display the webpage", with no information whatsoever. I know it's because of the compression only because it works if I disable it. Do you know what I'm doing wrong? I use zlib to compress it, and the exact code is: /* Compress it */ int compressed_output_size = content.length() + (content.length() * 0.2) + 16; char *compressed_output = (char *)Alloc(compressed_output_size); int compressed_output_length; Compress(compressed_output, compressed_output_size, (void *)content.c_str(), content.length(), &compressed_output_length); /* Send the compressed header */ cout << "Content-Encoding: deflate\r\n"; cout << boost::format("Content-Length: %d\r\n") % compressed_output_length; cgiHeaderContentType("text/html"); cout.write(compressed_output, compressed_output_length); static void Compress(void *to, size_t to_size, void *from, size_t from_size, int *final_size) { int ret; z_stream stream; stream.zalloc = Z_NULL; stream.zfree = Z_NULL; stream.opaque = Z_NULL; if ((ret = deflateInit(&stream, CompressionSpeed)) != Z_OK) COMPRESSION_ERROR("deflateInit() failed: %d", ret); stream.next_out = (Bytef *)to; stream.avail_out = (uInt)to_size; stream.next_in = (Bytef *)from; stream.avail_in = (uInt)from_size; if ((ret = deflate(&stream, Z_NO_FLUSH)) != Z_OK) COMPRESSION_ERROR("deflate() failed: %d", ret); if (stream.avail_in != 0) COMPRESSION_ERROR("stream.avail_in is not 0 (it's %d)", stream.avail_in); if ((ret = deflate(&stream, Z_FINISH)) != Z_STREAM_END) COMPRESSION_ERROR("deflate() failed: %d", ret); if ((ret = deflateEnd(&stream)) != Z_OK) COMPRESSION_ERROR("deflateEnd() failed: %d", ret); if (final_size) *final_size = stream.total_out; return; }

    Read the article

  • C++ string sort like a human being?

    - by Walter Nissen
    I would like to sort alphanumeric strings the way a human being would sort them. I.e., "A2" comes before "A10", and "a" certainly comes before "Z"! Is there any way to do with without writing a mini-parser? Ideally it would also put "A1B1" before "A1B10". I see the question "Natural (human alpha-numeric) sort in Microsoft SQL 2005" with a possible answer, but it uses various library functions, as does "Sorting Strings for Humans with IComparer". Below is a test case that currently fails: #include <set> #include <iterator> #include <iostream> #include <vector> #include <cassert> template <typename T> struct LexicographicSort { inline bool operator() (const T& lhs, const T& rhs) const{ std::ostringstream s1,s2; s1 << toLower(lhs); s2 << toLower(rhs); bool less = s1.str() < s2.str(); std::cout<<s1.str()<<" "<<s2.str()<<" "<<less<<"\n"; return less; } inline std::string toLower(const std::string& str) const { std::string newString(""); for (std::string::const_iterator charIt = str.begin(); charIt!=str.end();++charIt) { newString.push_back(std::tolower(*charIt)); } return newString; } }; int main(void) { const std::string reference[5] = {"ab","B","c1","c2","c10"}; std::vector<std::string> referenceStrings(&(reference[0]), &(reference[5])); //Insert in reverse order so we know they get sorted std::set<std::string,LexicographicSort<std::string> > strings(referenceStrings.rbegin(), referenceStrings.rend()); std::cout<<"Items:\n"; std::copy(strings.begin(), strings.end(), std::ostream_iterator<std::string>(std::cout, "\n")); std::vector<std::string> sortedStrings(strings.begin(), strings.end()); assert(sortedStrings == referenceStrings); }

    Read the article

< Previous Page | 633 634 635 636 637 638 639 640 641 642 643 644  | Next Page >