Search Results

Search found 17187 results on 688 pages for 'give me chicken'.

Page 641/688 | < Previous Page | 637 638 639 640 641 642 643 644 645 646 647 648  | Next Page >

  • output with "Private`" Content in Mathematica Package

    - by madalina
    Hello everyone, I am trying to solve the following implementation problem in Mathematica 7.0 for some days now and I do not understand exactly what is happening so I hope someone can give me some hints. I have 3 functions that I implemented in Mathematica in a source file with extension *.nb. They are working okay to all the examples. Now I want to put these functions into 3 different packages. So I created three different packages with extension .*m in which I put all the desired Mathematica function. An example in the "stereographic.m" package which contain the code: BeginPackage["stereographic`"] stereographic::usage="The package stereographic...." formEqs::usage="The function formEqs[complexBivPolyEqn..." makePoly::usage="The function makePoly[algebraicEqn] ..." getFixPolys::usage="The function..." milnorFibration::usage="The function..." Begin["Private`"] Share[]; formEqs[complex_,{m_,n_}]:=Block[{complexnew,complexnew1, realeq, imageq, expreal, expimag, polyrealF, polyimagF,s,t,u,v,a,b,c,epsilon,x,y,z}, complexnew:=complex/.{m->s+I*t,n->u+I*v}; complexnew1:=complexnew/.{s->(2 a epsilon)/(1+a^2+b^2+c^2),t->(2 b epsilon)/(1+a^2+b^2+c^2),u->(2 c epsilon)/(1+a^2+b^2+c^2),v->(- epsilon+a^2 epsilon+b^2 epsilon+c^2 epsilon)/(1+a^2+b^2+c^2)}; realeq:=ComplexExpand[Re[complexnew1]]; imageq:=ComplexExpand[Im[complexnew1]]; expreal:=makePoly[realeq]; expimag:=makePoly[imageq]; polyrealF:=expreal/.{a->x,b->y,c->z}; polyimagF:=expimag/.{a->x,b->y,c->z}; {polyrealF,polyimagF} ] End[] EndPackage[] Now to test the function I load the package Needs["stereographic`"] everything is okay. But when I test the function for example with formEqs[x^2-y^2,{x,y}] I get the following ouput: {Private`epsilon^2 + 2 Private`x^2 Private`epsilon^2 + Private`x^4 Private`epsilon^2 - 6 Private`y^2 Private`epsilon^2 + 2 Private`x^2 Private`y^2 Private`epsilon^2 + Private`y^4 Private`epsilon^2 - 6 Private`z^2 Private`epsilon^2 + 2 Private`x^2 Private`z^2 Private`epsilon^2 + 2 Private`y^2 Private`z^2 Private`epsilon^2 + Private`z^4 Private`epsilon^2, 8 Private`x Private`y Private`epsilon^2 + 4 Private`z Private`epsilon^2 - 4 Private`x^2 Private`z Private`epsilon^2 - 4 Private`y^2 Private`z Private`epsilon^2 - 4 Private`z^3 Private`epsilon^2} Of course I do not understand why Private` appears in front of any local variable which I returned in the final result. I would want not to have this Private` in the computed output. Any idea or better explanations which could indicate me why this happens? Thank you very much for your help. Best wishes, madalina

    Read the article

  • Re-Add tabBarController's view into window and the device is in landscape mode

    - by user285553
    Hello, I have an app that is a tabBarController based app. I have 4 tabs on it and one of these is for logging in/out in my app. The main ideea is that when I logout, I release the tabBarController (this will release the all 4 view controllers too - I have done this becuse I want to refersh all the views after logging out to look just like the first time).After this, I alloc it again and add the view controllers aagin,set the tabBarItem's titles,etc.This work ok. The problem is when I am in landscape mode;my logout view is painted to fit the landscape area,but after disconnect(now I releasse and alloc again the tabbarController) the view is painted in portrait mode but my device is in lanscape. After disconnected, I call the releaseOldTabView and the createNewTabView.After this tabBarController is in portrait insead of landscape. -(void)releaseOldTabView:(BOOL)tabViewEnabled{ if(tabViewEnabled){ [tabBarController.view removeFromSuperview]; [tabBarController release]; } } -(void)createNewTabView{ tabBarController = [[UITabBarController alloc] init]; NSMutableArray *oneArray = [[NSMutableArray alloc] init]; tabBarController.delegate = self; LoginViewController *login= [[LoginViewController2 alloc] initWithNibName:@"LoginViewController" bundle:nil]; SecondViewController *secondController = [[SecondViewController alloc] initWithNibName:@"SecondViewController" bundle:nil]; ThirdViewController *thirdController = [[ThirdViewController alloc] init]; FourthViewController *fourthController = [[FourthViewController alloc] init]; login.tabBarItem = [[UITabBarItem alloc] initWithTitle:@"Login" image:[UIImage imageNamed:@"connect.png"] tag:0]; secondController.tabBarItem = [[UITabBarItem alloc] initWithTitle:@"TabBar2" image:[UIImage imageNamed:@"tabBar2.png"] tag:1]; thirdController.tabBarItem = [[UITabBarItem alloc] initWithTitle:@"TabBar3" image:[UIImage imageNamed:@"tabBar3.png"] tag:2]; fourthController.tabBarItem = [[UITabBarItem alloc] initWithTitle:@"TabBar4" image:[UIImage imageNamed:@"tabBar4.png"] tag:3]; [oneArray addObject:login]; [oneArray addObject:secondController]; [oneArray addObject:thirdController]; [oneArray addObject:fourthController]; [tabBarController setViewControllers:oneArray]; //[tabBarController.view convertRect:tabBarController.view.frame toView:window]; [window addSubview:tabBarController.view]; [oneArray release]; [login release]; [secondController release]; [thirdController release]; [fourthController release]; } After calling this method, the tabbar view is in portrait,but statusBar(the top bar which says the carrier name) is painted normally(landscape). I also tried the [tabBarController.view convertRect:tabBarController.view.frame toView:window]; but without any succes. Can anyone give a hand of help? Thanks in advance, Alex.

    Read the article

  • Need to know how to properly create a new object in another cpp file

    - by karikari
    I have a class. The problem now is, after a few attempt, I'm still in huge error. My problem is I don't know how to properly declare a new object for this class, inside another cpp file. I wanted to call/trigger the functions from this RebarHandler class from my other cpp file. I keep on getting problems like, 'used without being initialized', 'debug assertion failed' and so on. In the other cpp file, I include the RebarHandler.h and did like this: CRebarHandler *test=NULL; test->setButtonMenu2(); When compile, I does not give any error. But, when run time, it gives error and my IE crash. I need help. Below is the class I meant: #pragma once class CIEWindow; class CRebarHandler : public CWindowImpl<CRebarHandler>{ public: CRebarHandler(HWND hWndToolbar, CIEWindow *ieWindow); CRebarHandler(){}; ~CRebarHandler(); BEGIN_MSG_MAP(CRebarHandler) NOTIFY_CODE_HANDLER(TBN_DROPDOWN, onNotifyDropDown) NOTIFY_CODE_HANDLER(TBN_TOOLBARCHANGE, onNotifyToolbarChange) NOTIFY_CODE_HANDLER(NM_CUSTOMDRAW, onNotifyCustomDraw) NOTIFY_CODE_HANDLER(TBN_ENDADJUST, onNotifyEndAdjust) MESSAGE_HANDLER(WM_SETREDRAW, onSetRedraw) END_MSG_MAP() // message handlers LRESULT onNotifyDropDown(WPARAM wParam, LPNMHDR pNMHDR, BOOL& bHandled); LRESULT onNotifyToolbarChange(WPARAM wParam, LPNMHDR pNMHDR, BOOL& bHandled); LRESULT onNotifyCustomDraw(WPARAM wParam, LPNMHDR pNMHDR, BOOL& bHandled); LRESULT onNotifyEndAdjust(WPARAM wParam, LPNMHDR pNMHDR, BOOL& bHandled); LRESULT onSetRedraw(UINT uMsg, WPARAM wParam, LPARAM lParam, BOOL& bHandled); // manage the subclassing of the IE rebar void subclass(); void unsubclass(); void handleSettings(); void setButtonMenu2(); bool findButton(HWND hWndToolbar); private: // handles to the various things HWND m_hWnd; HWND m_hWndToolbar, m_hWndRebar, m_hWndTooltip; HMENU m_hMenu; int m_buttonID; int m_ieVer; CIEWindow *m_ieWindow; // toolbar finding functions void scanForToolbarSlow(); void getRebarHWND(); void setButtonMenu(); };

    Read the article

  • compressed archive with quick access to individual file

    - by eric.frederich
    I need to come up with a file format for new application I am writing. This file will need to hold a bunch other text files which are mostly text but can be other formats as well. Naturally, a compressed tar file seems to fit the bill. The problem is that I want to be able to retrieve some data from the file very quickly and getting just a particular file from a tar.gz file seems to take longer than it should. I am assumeing that this is because it has to decompress the entire file even though I just want one. When I have just a regular uncompressed tar file I can get that data real quick. Lets say the file I need quickly is called data.dat For example the command... tar -x data.dat -zf myfile.tar.gz ... is what takes a lot longer than I'd like. MP3 files have id3 data and jpeg files have exif data that can be read in quickly without opening the entire file. I would like my data.dat file to be available in a similar way. I was thinking that I could leave it uncompressed and seperate from the rest of the files in myfile.tar.gz I could then create a tar file of data.dat and myfile.tar.gz and then hopefully that data would be able to be retrieved faster because it is at the head of outer tar file and is uncompressed. Does this sound right?... putting a compressed tar inside of a tar file? Basically, my need is to have an archive type of file with quick access to one particular file. Tar does this just fine, but I'd also like to have that data compressed and as soon as I do that, I no longer have quick access. Are there other archive formats that will give me that quick access I need? As a side note, this application will be written in Python. If the solution calls for a re-invention of the wheel with my own binary format I am familiar with C and would have no problem writing the Python module in C. Idealy I'd just use tar, dd, cat, gzip, etc though. Thanks, ~Eric

    Read the article

  • SSL Authentication with Certificates: Should the Certificates have a hostname?

    - by sixtyfootersdude
    Summary JBoss allows clients and servers to authenticate using certificates and ssl. One thing that seems strange is that you are not required to give your hostname on the certificate. I think that this means if Server B is in your truststore, Sever B can pretend to be any server that they want. (And likewise: if Client B is in your truststore...) Am I missing something here? Authentication Steps (Summary of Wikipeida Page) Client Server ================================================================================================= 1) Client sends Client Hello ENCRIPTION: None - highest TLS protocol supported - random number - list of cipher suites - compression methods 2) Sever Hello ENCRIPTION: None - highest TLS protocol supported - random number - choosen cipher suite - choosen compression method 3) Certificate Message ENCRIPTION: None - 4) ServerHelloDone ENCRIPTION: None 5) Certificate Message ENCRIPTION: None 6) ClientKeyExchange Message ENCRIPTION: server's public key => only server can read => if sever can read this he must own the certificate - may contain a PreMasterSecerate, public key or nothing (depends on cipher) 7) CertificateVerify Message ENCRIPTION: clients private key - purpose is to prove to the server that client owns the cert 8) BOTH CLIENT AND SERVER: - use random numbers and PreMasterSecret to compute a common secerate 9) Finished message - contains a has and MAC over previous handshakes (to ensure that those unincripted messages did not get broken) 10) Finished message - samething Sever Knows The client has the public key for the sent certificate (step 7) The client's certificate is valid because either: it has been signed by a CA (verisign) it has been self-signed BUT it is in the server's truststore It is not a replay attack because presumably the random number (step 1 or 2) is sent with each message Client Knows The server has the public key for the sent certificate (step 6 with step 8) The server's certificate is valid because either: it has been signed by a CA (verisign) it has been self-signed BUT it is in the client's truststore It is not a replay attack because presumably the random number (step 1 or 2) is sent with each message Potential Problem Suppose the client's truststore has certs in it: Server A Server B (malicous) Server A has hostname www.A.com Server B has hostname www.B.com Suppose: The client tries to connect to Server A but Server B launches a man in the middle attack. Since server B: has a public key for the certificate that will be sent to the client has a "valid certificate" (a cert in the truststore) And since: certificates do not have a hostname feild in them It seems like Server B can pretend to be Server A easily. Is there something that I am missing?

    Read the article

  • Supporting multiple instances of a plugin DLL with global data

    - by Bruno De Fraine
    Context: I converted a legacy standalone engine into a plugin component for a composition tool. Technically, this means that I compiled the engine code base to a C DLL which I invoke from a .NET wrapper using P/Invoke; the wrapper implements an interface defined by the composition tool. This works quite well, but now I receive the request to load multiple instances of the engine, for different projects. Since the engine keeps the project data in a set of global variables, and since the DLL with the engine code base is loaded only once, loading multiple projects means that the project data is overwritten. I can see a number of solutions, but they all have some disadvantages: You can create multiple DLLs with the same code, which are seen as different DLLs by Windows, so their code is not shared. Probably this already works if you have multiple copies of the engine DLL with different names. However, the engine is invoked from the wrapper using DllImport attributes and I think the name of the engine DLL needs to be known when compiling the wrapper. Obviously, if I have to compile different versions of the wrapper for each project, this is quite cumbersome. The engine could run as a separate process. This means that the wrapper would launch a separate process for the engine when it loads a project, and it would use some form of IPC to communicate with this process. While this is a relatively clean solution, it requires some effort to get working, I don't now which IPC technology would be best to set-up this kind of construction. There may also be a significant overhead of the communication: the engine needs to frequently exchange arrays of floating-point numbers. The engine could be adapted to support multiple projects. This means that the global variables should be put into a project structure, and every reference to the globals should be converted to a corresponding reference that is relative to a particular project. There are about 20-30 global variables, but as you can imagine, these global variables are referenced from all over the code base, so this conversion would need to be done in some automatic manner. A related problem is that you should be able to reference the "current" project structure in all places, but passing this along as an extra argument in each and every function signature is also cumbersome. Does there exist a technique (in C) to consider the current call stack and find the nearest enclosing instance of a relevant data value there? Can the stackoverflow community give some advice on these (or other) solutions?

    Read the article

  • Why wont my while loop wont take new input (c++)

    - by Van
    I've written a program to get a string input from a user and parse it into tokens and move a robot according to the input. My problem is trying to issue more than one command. The code looks like: void Navigator::manualDrive() { const int bufSize = 42; char uinput[bufSize]; char delim[] = " "; char *token; while(true) { Navigator::parseInstruction(uinput); } } /* parseInstruction(char *c) -- parses cstring instructions received * and moves robot accordingly */ void Navigator::parseInstruction(char * c) { const int bufSize = 42; char uinput[bufSize]; char delim[] = " "; char *token; cout << "Enter your directions below: \n"; cin.ignore(); cin.getline (uinput, bufSize); token=strtok(uinput, delim); if(strcmp("forward", token) == 0) { int inches; token = strtok(NULL, delim); inches = atoi (token); Navigator::travel(inches); } if(strcmp("back",token) == 0) { int inches; token = strtok(NULL, delim); inches = atoi (token); double value = fabs(0.0735 * fabs(inches) - 0.0550); myRobot.backward(1/*speed*/, value/*time*/); } if(strcmp("turn",token) == 0) { int degrees; token = strtok(NULL, delim); if(strcmp("left",token) == 0) { token = strtok(uinput, delim); degrees = atoi (token); double value = fabs(0.0041 * degrees - 0.0523); myRobot.turnLeft(1/*speed*/, value/*time*/); } } if(strcmp("turn",token) == 0) { int degrees; token = strtok(NULL, delim); if(strcmp("right",token) == 0) { token = strtok(uinput, delim); degrees = atoi (token); double value = fabs(0.0041 * degrees - 0.0523); myRobot.turnRight(1/*speed*/, value/*time*/); } } if(strcmp("stop",token) == 0) { myRobot.motors(0,0); } } In the function manualDrive I have a while loop calling the function parseInstruction infinitely. The program outputs "Enter your directions below: " When I give the program instructions it executes them, and then it outputs "enter your directions below: " again and when I input my directions again it does not execute them and outputs "Enter your directions below: " instead. I'm sure this is a very simple fix I'm just very new to c++. So if you could please help me out and tell me why the program only takes the first set of directions. thanks

    Read the article

  • Resize AIR app window while dragging

    - by matt lohkamp
    So I've noticed Windows 7 has a disturbing tendency to prevent you from dragging the title bar of windows off the top of the screen. If you try - in this case, using an air app with a draggable area at the bottom of the window, allowing you to push the top of the window up past the screen - it just kicks the window back down far enough that the title bar is at the top of what it considers the 'visible area.' One solution would be to resize the app window as it moves, so that the title bar is always where windows wants it. How would you resize the window while you're dragging it, though? Would you do it like this? dragHitArea.addEventListener(MouseEvent.MOUSE_DOWN, function(e:MouseEvent):void{ stage.nativeWindow.height += 50; stage.nativeWindow.startMove(); stage.nativeWindow.height -= 50; }); see what's going on there? When I click, I'm doing startMove(), which is hooking into the OS' function for dragging a window around. I'm also increasing and decreasing the height of the window by 50 pixels - which should give me no net increase, right? Wrong - the first '.height +=' gets executed, but the '.height -=' after the .startMove() never runs. Why? update - If you're curious, I'm programming an air widget with fly-out menus which expand rightwards and upwards - and since those element can only be displayed within the boundaries of the application window itself (even though the window is set to be chromeless and transparent) I have to expand the application's borders to include the area that the menu 'pops up' into. In the extreme case, with the widget positioned bottom left, and the menus expanded completely across to the right side and top edge of the screen, the application area could very well cover the entire desktop. The problem is, when it's expanded like this, if the user drags it up and to the right, it causes the 'title bar' area of the application window to move above the top edge of the desktop area, where it would normally be unreachable; and Windows automatically re-positions the window back below that edge once the .startMove() operation is completed. So what I want to do is continually resize the height of the application so that the visual effect will be the same for the user, but for the benefit of the operating system the window's title bar will never be above that top boundary of the desktop area.

    Read the article

  • How to compare filename of uploaded file and string

    - by user225269
    I use this code to upload image files in xammp server: <?php if ((($_FILES["file"]["type"] == "image/gif") || ($_FILES["file"]["type"] == "image/jpeg") || ($_FILES["file"]["type"] == "image/pjpeg")) && ($_FILES["file"]["size"] < 100000)) { if ($_FILES["file"]["error"] > 0) { echo "Return Code: " . $_FILES["file"]["error"] . "<br />"; } else { echo "Upload: " . $_FILES["file"]["name"] . "<br />"; echo "Type: " . $_FILES["file"]["type"] . "<br />"; echo "Size: " . ($_FILES["file"]["size"] / 1024) . " Kb<br />"; echo "Temp file: " . $_FILES["file"]["tmp_name"] . "<br />"; if (file_exists("upload/" . $_FILES["file"]["name"])) { echo $_FILES["file"]["name"] . " already exists. "; } else { move_uploaded_file($_FILES["file"]["tmp_name"], "upload/" . $_FILES["file"]["name"]); echo "Stored in: " . "upload/" . $_FILES["file"]["name"]; } } } else { echo "Invalid file, File must be less than 100Kb in size with .jpg, .jpeg, or .gif file extension"; } ?> What do I do to compare the file name of the uploaded files with the text inputted by the user? My goal is to be able to compare the user input(ID number) and the file name of the image file which should also be an ID number. So that I will be able to display the image that corresponds with the ID Number provided. What do I need to do?Please give me an idea on how can I achieve this. Thanks

    Read the article

  • dynamically embedding youtube videos with jquery

    - by danwoods
    Hello all, I'm trying to retrieve a listing of a user's youtube videos and embed them in a page using jQuery. My code looks something like this: $(document).ready(function() { //some variables var fl_obj_template = $('<object width="260" height="140">' + '<param name="movie" value=""></param>' + '<param name="allowFullScreen" value="true"></param>' + '<param name="allowscriptaccess" value="always"></param>' + '<embed src="" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="260" height="140"></embed>' + '</object>'); var video_elm_arr = $('.video'); //hide videos until ready $('.video').addClass('hidden'); //pull video data from youtube $.ajax({ url: 'http://gdata.youtube.com/feeds/api/users/username/uploads?alt=json', dataType: 'jsonp', success: function(data) { $.each(data.feed.entry, function(i,item){ //only take the first 7 videos if(i > 6) return; //give the video element a flash object var cur_flash_obj = fl_obj_template; //assign title $(video_elm_arr[i]).find('.video_title').html(item.title.$t); //clean url var video_url = item.media$group.media$content[0].url; var index = video_url.indexOf("?"); if (index > 0) video_url = video_url.substring(0, index); //and asign it to the player's parameters $(cur_flash_obj).find('object param[name="movie"]').attr('value', video_url); $(cur_flash_obj).find('object embed').attr('src', video_url); //alert(cur_flash_obj); //insert flash object in video element $(video_elm_arr[i]).append(cur_flash_obj); //and show $(video_elm_arr[i]).removeClass('hidden'); }); } }); }); (of course with 'username' being the actual username). The video titles appear correctly but no videos show up. What gives? The target html looks like: <div id="top_row_center" class="video_center video"> <p class="video_title"></p> </div>

    Read the article

  • OpenGL, how to set a monochrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :)

    Read the article

  • Is it Bad Practice to use C++ only for the STL containers?

    - by gmatt
    First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

    Read the article

  • Sliding panel in the middle of the page. Z-index given not working

    - by Nehal Rupani
    Hi all, I am implementing sliding panel element but problem is when i slide out other div element is floating down. I guess and tried to give z-index to element which i am sliding but it doesn't seems to work. Let me put code for both div. <div class="vrcontrol"> <div class="slide-out-div"> <a class="handle" href="http://link-for-non-js-users.html">Content</a> <h3>Contact me</h3> <p>Thanks for checking out my jQuery plugin, I hope you find this useful. </p> <p>This can be a form to submit feedback, or contact info</p> </div> This is div which i am sliding in and out and beneath is code of effective div. <div class="askform"> <p class="titletext">Ask an Expert Trade Forum</p> <p class="detailtext">WD-40’s leading source for DIY tips and tricks.</p> <span> <form id="askform" name="askform" action="" method="post"> <span class="left"><input name="input" type="text" class="askinputbox"/></span><span class="marginleft"><input type="image" src="images/search_icon.gif" /></span> </form> </span> <div class="followus"> <span class="followtext">Follow us on</span><span class="right"><img src="images/bookmark.jpg" width="121" height="45" alt="Bookmark" /></span> </div> </div> Sliding div is in left portion of the page and effective div is in right portion of the page. I guess something with z-index, positioning element and overflow properties will do something.

    Read the article

  • Need Help About Using XPathNavigator in C#?

    - by Nano HE
    Hello. My XML file as below. It mixed schema and normal elements. <?xml version="1.0" encoding="utf-8"?> <!-- R1 --> <ax:root xmlns:ax="http://amecn/software/realtime/ax"> <xsd:schema xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <xsd:element name="EquipmentConstants"> <xsd:complexType> <xsd:sequence> <xsd:element minOccurs="0" maxOccurs="unbounded" ref="EquipmentConstant" /> </xsd:sequence> </xsd:complexType> <xsd:unique name="id"> <xsd:selector xpath=".//EquipmentConstant" /> <xsd:field xpath="@id" /> </xsd:unique> </xsd:element> ...... ...... </xsd:schema> <EquipmentConstants xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"> <EquipmentConstant id="0"> <Name>SerialNumber</Name> <Group>SYSTEM</Group> <Data> <Value min="0" max="10000000" scale_factor="0" unit="U_NO_UNITS" permission="NolimitedAndNoChangeable" type="xsd_string" enum="" flag="0">0</Value> </Data> <Description>Serial Number</Description> </EquipmentConstant> ..... ..... </EquipmentConstants> </ax:root> My C# code as below. I want to loop the elements from <EquipmentConstants xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"> XPathDocument doc = new XPathDocument("test.xml"); XPathNavigator navigator = doc.CreateNavigator(); navigator.MoveToRoot(); // <?xml version="1.0" encoding="utf-8"?> //navigator.MoveToFirstChild(); // <!-- R1 --> // 1st, I tried to use MoveToChield(), But I failed to move there. navigator.MoveToChild("EquipmentConstants"); // Then, I also tried to use SelectSingleNode(). But I failed too. navigator.SelectSingleNode("ax/EquipmentConstants"); while (navigator.MoveToNext()) { // do something. } Could you please give me some suggestion. Thank you.

    Read the article

  • Is a many-to-many relationship with extra fields the right tool for my job?

    - by whichhand
    Previously had a go at asking a more specific version of this question, but had trouble articulating what my question was. On reflection that made me doubt if my chosen solution was correct for the problem, so this time I will explain the problem and ask if a) I am on the right track and b) if there is a way around my current brick wall. I am currently building a web interface to enable an existing database to be interrogated by (a small number of) users. Sticking with the analogy from the docs, I have models that look something like this: class Musician(models.Model): first_name = models.CharField(max_length=50) last_name = models.CharField(max_length=50) dob = models.DateField() class Album(models.Model): artist = models.ForeignKey(Musician) name = models.CharField(max_length=100) class Instrument(models.Model): artist = models.ForeignKey(Musician) name = models.CharField(max_length=100) Where I have one central table (Musician) and several tables of associated data that are related by either ForeignKey or OneToOneFields. Users interact with the database by creating filtering criteria to select a subset of Musicians based on data the data on the main or related tables. Likewise, the users can then select what piece of data is used to rank results that are presented to them. The results are then viewed initially as a 2 dimensional table with a single row per Musician with selected data fields (or aggregates) in each column. To give you some idea of scale, the database has ~5,000 Musicians with around 20 fields of related data. Up to here is fine and I have a working implementation. However, it is important that I have the ability for a given user to upload there own annotation data sets (more than one) and then filter and order on these in the same way they can with the existing data. The way I had tried to do this was to add the models: class UserDataSets(models.Model): user = models.ForeignKey(User) name = models.CharField(max_length=100) description = models.CharField(max_length=64) results = models.ManyToManyField(Musician, through='UserData') class UserData(models.Model): artist = models.ForeignKey(Musician) dataset = models.ForeignKey(UserDataSets) score = models.IntegerField() class Meta: unique_together = (("artist", "dataset"),) I have a simple upload mechanism enabling users to upload a data set file that consists of 1 to 1 relationship between a Musician and their "score". Within a given user dataset each artist will be unique, but different datasets are independent from each other and will often contain entries for the same musician. This worked fine for displaying the data, starting from a given artist I can do something like this: artist = Musician.objects.get(pk=1) dataset = UserDataSets.objects.get(pk=5) print artist.userdata_set.get(dataset=dataset.pk) However, this approach fell over when I came to implement the filtering and ordering of query set of musicians based on the data contained in a single user data set. For example, I could easily order the query set based on all of the data in the UserData table like this: artists = Musician.objects.all().order_by(userdata__score) But that does not help me order by the results of a given single user dataset. Likewise I need to be able to filter the query set based on the "scores" from different user data sets (eg find all musicians with a score 5 in dataset1 and < 2 in dataset2). Is there a way of doing this, or am I going about the whole thing wrong?

    Read the article

  • CTE Join query issues

    - by Lee_McIntosh
    Hi everyone, this problem has me head going round in circles at the moment and i wondering if anyone could give any pointers as to where im going wrong. Im trying to produce a SPROC that produces a dataset to be called by SSRS for graphs spanning the last 6 months. The data for example purposes uses three tables (theres more but the it wont change the issue at hand) and are as follows: tbl_ReportList: Report Site ---------------- North abc North def East bbb East ccc East ddd South poa South pob South poc South pod West xyz tbl_TicketsRaisedThisMonth: Date Site Type NoOfTickets --------------------------------------------------------- 2010-07-01 00:00:00.000 abc Support 101 2010-07-01 00:00:00.000 abc Complaint 21 2010-07-01 00:00:00.000 def Support 6 ... 2010-12-01 00:00:00.000 abc Support 93 2010-12-01 00:00:00.000 xyz Support 5 tbl_FeedBackRequests: Date Site NoOfFeedBackR ---------------------------------------------------------------- 2010-07-01 00:00:00.000 abc 101 2010-07-01 00:00:00.000 def 11 ... 2010-12-01 00:00:00.000 abc 63 2010-12-01 00:00:00.000 xyz 4 I'm using CTE's to simplify the code, which is as follows: DECLARE @ReportName VarChar(200) SET @ReportName = 'North'; WITH TicketsRaisedThisMonth AS ( SELECT [Date], Site, SUM(NoOfTickets) AS NoOfTickets FROM tbl_TicketsRaisedThisMonth WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), FeedBackRequests AS ( SELECT [Date], Site, SUM(NoOfFeedBackR) AS NoOfFeedBackR FROM tbl_FeedBackRequests WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), SELECT trtm.[Date] SUM(trtm.NoOfTickets) AS NoOfTickets, SUM(fbr.NoOfFeedBackR) AS NoOfFeedBackR, FROM Reports rpts LEFT OUTER JOIN TotalIncidentsDuringMonth trtm ON rpts.Site = trtm.Site LEFT OUTER JOIN LoggedComplaints fbr ON rpts.Site = fbr.Site WHERE rpts.report = @ReportName GROUP BY trtm.[Date] And the output when the sproc is pass a parameter such as 'North' to be as follows: Date NoOfTickets NoOfFeedBackR ----------------------------------------------------------------------------------- 2010-07-01 00:00:00.000 128 112 2010-08-01 00:00:00.000 <data for that month> <data for that month> 2010-09-01 00:00:00.000 <data for that month> <data for that month> 2010-10-01 00:00:00.000 <data for that month> <data for that month> 2010-11-01 00:00:00.000 <data for that month> <data for that month> 2010-12-01 00:00:00.000 122 63 The issue I'm having is that when i execute the query I'm given a repeated list of values of each month, such as 128 will repeat 6 times then another value for the next months value repeated 6 times, etc. argh!

    Read the article

  • Unable to read data from the transport connection: the connection was closed

    - by webdreamer
    The exception is Remoting Exception - Authentication Failure. The detailed message says "Unable to read data from the transport connection: the connection was closed." I'm having trouble with creating two simple servers that can comunicate as remote objects in C#. ServerInfo is just a class I created that holds the IP and Port and can give back the address. It works fine, as I used it before, and I've debugged it. Also the server is starting just fine, no exception is thrown, and the channel is registered without problems. I'm using Forms to do the interfaces, and call some of the methods on the server, but didn't find any problems in passing the parameters from the FormsApplication to the server when debugging. All seems fine in that chapter. public ChordServerProgram() { RemotingServices.Marshal(this, "PADIBook"); nodeInt = 0; } public void startServer() { try { serverChannel = new TcpChannel(serverInfo.Port); ChannelServices.RegisterChannel(serverChannel, true); } catch (Exception e) { Console.WriteLine(e.ToString()); } } I run two instances of this program. Then startNode is called on one of the instances of the application. The port is fine, the address generated is fine as well. As you can see, I'm using the IP for localhost, since this server is just for testing purposes. public void startNode(String portStr) { IPAddress address = IPAddress.Parse("127.0.0.1"); Int32 port = Int32.Parse(portStr); serverInfo = new ServerInfo(address, port); startServer(); //node = new ChordNode(serverInfo,this); } Then, in the other istance, through the interface again, I call another startNode method, giving it a seed server to get information from. This is where it goes wrong. When it calls the method on the seedServer proxy it just got, a RemotingException is thrown, due to an authentication failure. (The parameter I'll want to get is the node, I'm just using the int to make sure the ChordNode class has nothing to do with this error.) public void startNode(String portStr, String seedStr) { IPAddress address = IPAddress.Parse("127.0.0.1"); Int32 port = Int32.Parse(portStr); serverInfo = new ServerInfo(address, port); IPAddress addressSeed = IPAddress.Parse("127.0.0.1"); Int32 portSeed = Int32.Parse(seedStr); ServerInfo seedInfo = new ServerInfo(addressSeed, portSeed); startServer(); ChordServerProgram seedServer = (ChordServerProgram)Activator.GetObject(typeof(ChordServerProgram), seedInfo.GetFullAddress()); // node = new ChordNode(serverInfo,this); int seedNode = seedServer.nodeInt; // node.chordJoin(seedNode.self); }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • using AsyncTask class for parallel operationand displaying a progress bar

    - by Kumar
    I am displaying a progress bar using Async task class and simulatneously in parallel operation , i want to retrieve a string array from a function of another class that takes some time to return the string array. The problem is that when i place the function call in doing backgroung function of AsyncTask class , it gives an error in Doing Background and gives the message as cant change the UI in doing Background .. Therefore , i placed the function call in post Execute method of Asynctask class . It doesnot give an error but after the progress bar has reached 100% , then the screen goes black and takes some time to start the new activity. How can i display the progress bar and make the function call simultaneously.??plz help , m in distress here is the code package com.integrated.mpr; import android.app.Activity; import android.app.ProgressDialog; import android.content.Intent; import android.os.AsyncTask; import android.os.Bundle; import android.os.Handler; import android.view.View; import android.view.View.OnClickListener; import android.widget.Button; public class Progess extends Activity implements OnClickListener{ static String[] display = new String[Choose.n]; Button bprogress; @Override protected void onCreate(Bundle savedInstanceState) { // TODO Auto-generated method stub super.onCreate(savedInstanceState); setContentView(R.layout.progress); bprogress = (Button) findViewById(R.id.bProgress); bprogress.setOnClickListener(this); } @Override public void onClick(View v) { // TODO Auto-generated method stub switch(v.getId()){ case R.id.bProgress: String x ="abc"; new loadSomeStuff().execute(x); break; } } public class loadSomeStuff extends AsyncTask<String , Integer , String>{ ProgressDialog dialog; protected void onPreExecute(){ dialog = new ProgressDialog(Progess.this); dialog.setProgressStyle(ProgressDialog.STYLE_HORIZONTAL); dialog.setMax(100); dialog.show(); } @Override protected String doInBackground(String... arg0) { // TODO Auto-generated method stub for(int i = 0 ;i<40;i++){ publishProgress(5); try { Thread.sleep(1000); } catch (InterruptedException e) { // TODO Auto-generated catch block e.printStackTrace(); } } dialog.dismiss(); String y ="abc"; return y; } protected void onProgressUpdate(Integer...progress){ dialog.incrementProgressBy(progress[0]); } protected void onPostExecute(String result){ display = new Logic().finaldata(); Intent openList = new Intent("com.integrated.mpr.SENSITIVELIST"); startActivity(openList); } } }

    Read the article

  • Image animation problem in silverlight

    - by Jak
    Hi followed " http://www.switchonthecode.com/tutorials/silverlight-3-tutorial-planeprojection-and-perspective-3d#comment-4688 ".. the animation is working fine. I am new to silver light. when i use dynamic image from xml instead of static image as in tutorial,.. it is not working fine, please help me on this. i used list box.. for this animation effect do i need to change listbox to some other arrangement ? if your answer yes means, pls give me some sample code. Thanks in advance. Xaml code: <ListBox Name="listBox1"> <ListBox.ItemTemplate> <DataTemplate> <StackPanel> <Image Source="{Binding imgurl}" HorizontalAlignment="Left" Name="image1" Stretch="Fill" VerticalAlignment="Top" MouseLeftButtonUp="FlipImage" /> </StackPanel> </DataTemplate> </ListBox.ItemTemplate> </ListBox> My C# code: //getting image URL from xml XElement xmlads = XElement.Parse(e.Result); //i bind the url in to listBox listBox1.ItemsSource = from ads in xmlads.Descendants("ad") select new zestItem { imgurl = ads.Element("picture").Value }; public class zestItem { public string imgurl { get; set; } } private int _zIndex = 10; private void FlipImage(object sender, MouseButtonEventArgs e) { Image image = sender as Image; // Make sure the image is on top of all other images. image.SetValue(Canvas.ZIndexProperty, _zIndex++); // Create the storyboard. Storyboard flip = new Storyboard(); // Create animation and set the duration to 1 second. DoubleAnimation animation = new DoubleAnimation() { Duration = new TimeSpan(0, 0, 1) }; // Add the animation to the storyboard. flip.Children.Add(animation); // Create a projection for the image if it doesn't have one. if (image.Projection == null) { // Set the center of rotation to -0.01, which will put a little space // between the images when they're flipped. image.Projection = new PlaneProjection() { CenterOfRotationX = -0.01 }; } PlaneProjection projection = image.Projection as PlaneProjection; // Set the from and to properties based on the current flip direction of // the image. if (projection.RotationY == 0) { animation.To = 180; } else { animation.From = 180; animation.To = 0; } // Tell the animation to animation the image's PlaneProjection object. Storyboard.SetTarget(animation, projection); // Tell the animation to animation the RotationYProperty. Storyboard.SetTargetProperty(animation, new PropertyPath(PlaneProjection.RotationYProperty)); flip.Begin(); }

    Read the article

  • Java loading user-specified classes at runtime

    - by user349043
    I'm working on robot simulation in Java (a Swing application). I have an abstract class "Robot" from which different types of Robots are derived, e.g. public class StupidRobot extends Robot { int m_stupidness; int m_insanityLevel; ... } public class AngryRobot extends Robot { float m_aggression; ... } As you can see, each Robot subclass has a different set of parameters. What I would like to do is control the simulation setup in the initial UI. Choose the number and type of Robots, give it a name, fill in the parameters etc. This is one of those times where being such a dinosaur programmer, and new to Java, I wonder if there is some higher level stuff/thinking that could help me here. So here is what I've got: (1) User Interface Scrolling list of Robot types on the left. "Add " and "<< Remove" buttons in the middle. Default-named scrolling list of Robots on the right. "Set Parameters" button underneath. (So if you wanted an AngryRobot, you'd select AngryRobot on the left list, click "Add" and "AngryRobot1" would show up on the right.) When selecting a Robot on the right, click "Set Parameters..." button which would call yet another model dialog where you'd fill in the parameters. Different dialog called for each Robot type. (2) Data structures an implementation As an end-product I think a HashMap would be most convenient. The keys would be Robot types and the accompanying object would be all of the parameters. The initializer could just retrieve each item one and a time and instantiate. Here's what the data structures would look like: enum ROBOT_TYPE {STUPID, ANGRY, etc} public class RobotInitializer { public ROBOT_TYPE m_type; public string m_name; public int[] m_int_params; public float[] m_float_params; etc. The initializer's constructor would create the appropriate length parameter arrays based on the type: public RobotInitializer(ROBOT_TYPE type, int[] int_array, float[] float_array, etc){ switch (type){ case STUPID: m_int_params = new int[STUPID_INT_PARAM_LENGTH]; System.arraycopy(int_array,0,m_int_params,0,STUPID_INT_PARAM_LENGTH); etc. Once all the RobotInitializers are instantiated, they are added to the HashMap. Iterating through the HashMap, the simulation initializer takes items from the Hashmap and instantiates the appropriate Robots. Is this reasonable? If not, how can it be improved? Thanks

    Read the article

  • apt-get install fuse - MAKEDEV not installed, skipping device node creation

    - by holms
    This happened with command apt-get dist-upgrade to upgrade to debian jessie, after which I've tried to remove fuse, and install it again. Same error: root@msgapp:/dev# apt-get install fuse Reading package lists... Done Building dependency tree Reading state information... Done The following NEW packages will be installed: fuse 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. Need to get 0 B/69.9 kB of archives. After this operation, 191 kB of additional disk space will be used. Selecting previously unselected package fuse. (Reading database ... 39354 files and directories currently installed.) Preparing to unpack .../fuse_2.9.3-10_amd64.deb ... Unpacking fuse (2.9.3-10) ... Processing triggers for man-db (2.6.7.1-1) ... Setting up fuse (2.9.3-10) ... MAKEDEV not installed, skipping device node creation. device node not found dpkg: error processing package fuse (--configure): subprocess installed post-installation script returned error exit status 2 Errors were encountered while processing: fuse E: Sub-process /usr/bin/dpkg returned an error code (1) UPDATE Reinstalling makedev gives another problem: root@msgapp:/dev# apt-get install makedev Reading package lists... Done Building dependency tree Reading state information... Done The following NEW packages will be installed: makedev 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. Need to get 0 B/42.6 kB of archives. After this operation, 129 kB of additional disk space will be used. Selecting previously unselected package makedev. (Reading database ... 39347 files and directories currently installed.) Preparing to unpack .../makedev_2.3.1-93_all.deb ... Unpacking makedev (2.3.1-93) ... Processing triggers for man-db (2.6.7.1-1) ... ySetting up makedev (2.3.1-93) ... /run/udev or .udevdb or .udev presence implies active udev. Aborting MAKEDEV invocation. /run/udev or .udevdb or .udev presence implies active udev. Aborting MAKEDEV invocation. /run/udev or .udevdb or .udev presence implies active udev. Aborting MAKEDEV invocation. There's ticket raised, and their fix doesn't give any result: root@msgapp:/dev# cd /dev && ./MAKEDEV fuse /run/udev or .udevdb or .udev presence implies active udev. Aborting MAKEDEV invocation.

    Read the article

  • help me to choose the best soulotion for my purpose to build my software.

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • How to calculate the time difference between two time fields , with respect to the date changes

    - by Tiru
    I want to calculate the time difference.I have three EditTexts , I want to input the times in the first two edittexts in HH:MM format. And then calculate the time difference and the result will show on third edittext field in same format. If the date changes, the time difference will calculate according that, i.e If first time = 23:00 and second time = 01:00 then, the time difference = 02:00 hours public class TimeCalculate extends Activity { private String mBlock; private String mBlockoff; private String mBlockon ; // String mHours, mMinutes; Date date1, date2; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); EditText blockoff = (EditText) findViewById(R.id.blockoff); mBlockoff = blockoff.getText().toString(); EditText blockon = (EditText) findViewById(R.id.blockon); mBlockon = blockon.getText().toString(); SimpleDateFormat simpleDateFormat = new SimpleDateFormat("hh:mm"); try { date1 = simpleDateFormat.parse(mBlockoff); } catch (ParseException e) { // TODO Auto-generated catch block e.printStackTrace(); } try { date2 = simpleDateFormat.parse(mBlockon); } catch (ParseException e) { // TODO Auto-generated catch block e.printStackTrace(); } mBlock = getDifference(date1, date2); EditText block = (EditText) findViewById(R.id.block); block.setText(mBlock.toString()); } public static String getDifference(Date startTime, Date endTime) { if (startTime == null) return "corrupted"; Calendar startDateTime = Calendar.getInstance(); startDateTime.setTime(startTime); Calendar endDateTime = Calendar.getInstance(); endDateTime.setTime(endTime); long milliseconds1 = startDateTime.getTimeInMillis(); long milliseconds2 = endDateTime.getTimeInMillis(); long diff = milliseconds2 - milliseconds1; /*int hours = (int)diff / (60 * 60 * 1000); int minutes = (int) (diff / (60 * 1000)); minutes = minutes - 60 * hours; long seconds = diff / (1000); */ //timeDiff = DateUtils.formatElapsedTime(seconds); SimpleDateFormat simpleDateFormat = new SimpleDateFormat("HH:MM"); Date date = new Date(diff); return simpleDateFormat.format(date); } } I executed this code ,but gives error as Source not found.I think error at getDifference method.Please give any other logic

    Read the article

  • git: setting a single tracking remote from a public repo.

    - by Gauthier
    I am confused with remote branches. My local repo: (local) ---A---B---C-master My remote repo (called int): (int) ---A---B---C---D---E-master What I want to do is to setup the local repo's master branch to follow that of int. Local repo: (local) ---A---B---C---D---E-master-remotes/int/master So that when int changes to: (int) ---A---B---C---D---E---F-master I can run git pull from the local repo's master and get (local) ---A---B---C---D---E---F-master-remotes/int/master Here's what I have tried: git fetch int gets me all the branches of int into remote branches. This can get messy since int might have hundreds of branches. git fetch int master gets me the commits, but no ref to it, only FETCH_HEAD. No remote branch either. git fetch int master:new_master works but I don't want a new name every time I update, and no remote branch is setup. git pull int master does what I want, but there is still no remote branch setup. I feel that it is ok to do so (that's the best I have now), but I read here and there that with the remote setup it is enough with git pull. git branch --track new_master int/master, as per http://www.gitready.com/beginner/2009/03/09/remote-tracking-branches.html . I get "not a valid object name: int/master". git remote -v does show me that int is defined and points at the correct location (1. worked). What I miss is the int/master branch, which is precisely what I want to get. git fetch in master:int/master. Well, int/master is created, but is no remote. So to summarize, I've tried some stuff with no luck. I would expect 2 to give me the remote branch to master in the repo int. The solution I use now is option 3. I read somewhere that you could change some config file by hand, but isn't that a bit cumbersome? The "cumbersome" way of editting the config file did work: [branch "master"] remote = int merge = master It can be done from command line: $ git config branch.master.remote int $ git config branch.master.merge master Any reason why option 2 above wouldn't do that automatically? Even in that case, git pull fetches all branches from the remote.

    Read the article

< Previous Page | 637 638 639 640 641 642 643 644 645 646 647 648  | Next Page >