Search Results

Search found 27606 results on 1105 pages for 'javascript disabled'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 645/1105 | < Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >

  • IE Hanging on jQuery code

    - by OrangeRind
    Here's another clichéd problem, but I couldn't find an exact match to this. I haven't posted any source here, as you can freely see all that is there on the link. :-) Statement:I have a web page at http://agrimgupta.com/antaragni/ Disclaimer: Pardon me for the pathetic coding on that page. ;-) It was done on a very short interval. Improvements will be done at a later stage. Observation: This page is functioning normally on my localhost on all browsers. Problem: IE 8 is crawling (nearly hanging) while loading this page from the website. Although it is working fine on localhost. When on the website, It fails to render the mouseover effects, doing them in almost what seems like a minute. Question: How to resolve this stuck up of IE? It is necessary to resolve this. Thanks in Advance

    Read the article

  • How do I find what text/HTML is on screen in a UIWebview?

    - by Grant M
    I would like to know what the first piece of text/html that is currently showing on screen, or more generally where in pixel location a particular tag or piece of text is in the UIWebview. I know that I can use window.pageYOffset to get the scroll position of the UIwebview, but how do I find out what text or HTML item is there?

    Read the article

  • Toggeling between image

    - by Binaryrespawn
    Hi all, I have two images with which I am using in an anchor tag. I am using jquery toggle on the click event of the anchor tag to swap between images. $(document).ready(function(){ $('#registrationForm').hide(); $('#callform').append("<a id='formlink'>IMAGE 1</a>"); $("#formlink").click(function(){ $('#registrationForm').toggle(function(){ $('#formlink').empty().append(IMAGE 2); }); }); }); This works fine the first time around, however i want to toggle between the two images whenever the other is clicked. Any ideas ?

    Read the article

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Display alert msg in web page when forwarding from one page to another on page load.

    - by Shantanu Gupta
    I have created a html page in php and upon submission i validates that page using PHP. After validating i want to show an alert msg to show its status like showing any greeting or request for re-enter. I have dont validation. Now i m using header( 'Location: http://localhost/assignment/WebForm.htm' ) ; to redirect user to same page but with a alert msg at page load or something like that. What I need to do ?

    Read the article

  • Implementing prompts in text-input

    - by AntonAL
    Hi, I have a form with some text-inputs: login, password. If user sees this form the first time, input-texts should "contain" prompts, like "enter login", "enter password". If user clicks text-input, it's prompt should disappear to allow typing. I have seen various examples, that uses background image with prerendered text on it. Those images are appearing with following jQuery: $("form > :text").focus(function(){ // hide image }).blur(function(){ // show image, if text-input is still empty if ( $(this).val() == "" ) // show image with prompt }); This approach has following problems: localization is impossible need to pre-render images for various textual prompts overhead with loading images How do you overcomes such a problems ?

    Read the article

  • Creating a json obj from a string when working without a net connection?

    - by user246114
    Hi, I have a json object returned from a third party api, it looks like: {"version":"1.0","encoding":"UTF-8"} I'm going to be working on my project without a network connection, so I have to do everything locally. How can I create an instance of a json object locally for testing? Say I copy the above string, can I do something like: var json = null; if (debugging_locally) { json = new jsonObj('{"version":"1.0","encoding":"UTF-8"}'); } else { json = doAjaxCall(); } doStuffWithJsonObj(json); so I just want to create a json object from a stored string if debugging locally - how can I do that? Thanks

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

  • How do I cache jQuery selections?

    - by David
    I need to cache about 100 different selections for animating. The following is sample code. Is there a syntax problem in the second sample? If this isn't the way to cache selections, it's certainly the most popular on the interwebs. So, what am I missing? note: p in the $.path.bezier(p) below is a correctly declared object passed to jQuery.path.bezier (awesome animation library, by the way) This works $(document).ready(function() { animate1(); animate2(); }) function animate1() { $('#image1').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $('#image2').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); } This doesn't work var $one = $('#image1'); //problem with syntax here?? var $two = $('#image2'); $(document).ready(function() { animate1(); animate2(); }) function animate1() { $one.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $two.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); }

    Read the article

  • It is the arranging game in which

    - by bachchan
    1 2 3 13 5 4 7 10 6 14 11 9 8 15 12 1.Every time when we refresh the page the numbers in the cells will change but the These numbers will remain unique n from 1 to 15 2.Whenever we double click the number in the cell which is surrounded the empty cell then it will replace the empty cell with that number n that number cell become empty. 3.If we double click the cell which is not surrounded the empty cell then it will not replace the empty cell. 4.e.g. if we click 8 then it will not move to empty cell But if we click either 13, 7 , or 11 then it will move to empty cell 5.And every time when we click the cell it’s num color will change for a moment

    Read the article

  • Is there a way to embed an mp3 player in a website that isn't flash based (so that the website is iP

    - by hartleybrody
    I did a lot of searching for what I thought would be a pretty common question, but I came up with nothing. If there is another thread with a similar topic, please let me know. Basically, I'm looking for a way to have an .mp3 file play in a website without relying on a flash-based player. I've searched w3 schools and every forum I can think of, but every media player I've found so far has been some sort of proprietary flash player. Doesn't HTML support some sort of native player? I've found some that rely on Windows Media Player which is close, but I want the player to work on an iPhone and something tells me WMP won't get that done... PS, as I'm thinking more about this this idea just popped into my head: a javascipt player and inside the <noscript> tag, put a flash player? I'm running a music blog (@ http://www.freshoncampus.com) so the less code per post, the better...

    Read the article

  • focus() jQuery function doesn't work in Safari, but works fine on all other browsers?

    - by pMan
    I have a search text field and search button, when button is clicked with default text in text field, or null value, an alert pops up and sets focus back on search text field. This works very well on all major browsers but not in safari. I tried it even with out jquery, but didn't work. When the focus falls on search text field, I have another jQuery function, is that the problem. The code that sets focus on search text is: if (defaults.keyword == SEARCH_TIP || defaults.keyword == '') { alert(SEARCH_NULL); $('#store_search_keyword').focus(); return false; } The code on focus is: var search_dom = $('#store_search_keyword'); var search_text = search_dom.val(); search_dom.focus(function(){ if ($(this).val() === SEARCH_TIP) { $(this).val(''); } }); any help is appreciated, thanks..

    Read the article

  • Loading external content with jquery or iframe?

    - by nailuenlue
    Hiho, There's an existing website that i need to include into another site which goes like this: a.mysite.com and i need to fetch content from this site in my www.mysite.com website... As i need to access the content of the iframe the Same origin policy produces a problem here. What i did was to configure mod_proxy on Apache to proxy pass all requests from www.mysite.com/a to a.mysite.com This will work fine...but my problem is that im not sure what the best way would be to include those pages. 1. Idea As the content of the iframe is a full featured site with a top navigation...left navigation etc....i would need to change the page template to only show the content box to be able to integrate that page in the iframe. 2. Idea I could just load the DIV where the content lies through JQuery.load() and integrate it into my site. What is the best way to accomplish such a task? How bad is both ideas from the SEO point of view?

    Read the article

  • jQuery center multiple dynamic images in different sized containers

    - by JVK Design
    So I've found similar questions but none that answer all the questions I have and I know there must be a simple jQuery answer to this. I've got multiple images that are being dynamically placed in their own containing div that have overflow:hidden, they need to fill their containing divs and be centered(horizontally and vertically) also. The containing divs will be different sizes as well. So in short: multiple different sized images fill and center in containing div. containing divs will be different sizes. will be used multiple times on a page. Hopefully this image helps explain what I'm after. Click here to view the image. HTML I'm using but can be changed <div class="imageHolder"> <div class="first SlideImage"> <img src="..." alt="..."/> </div> <div class="second SlideImage"> <img src="..." alt="..."/> </div> <div class="third SlideImage"> <img src="..." alt="..."/> </div> </div> And the CSS .imageHandler{ float:left; width:764px; height:70px; margin:1px 0px 0px; } .imageHolder .SlideImage{ float:left; position:relative; overflow:hidden; } .imageHolder .SlideImage img{ position:absolute; } .imageHolder .first.SlideImage{ width:381px; height:339px; margin-right:1px; } .imageHolder .second.SlideImage{margin-bottom:1px;} .imageHolder .second.SlideImage, .imageHolder .third.SlideImage { width: 382px; height: 169px; } Ask me anything if this doesn't make sense, thanks in advance

    Read the article

  • Transfer values from one selection box to another

    - by Tonya Cash
    I need to populate the first box with the items from a db table. Users would choose from the first box, and either drag value(items) to the second for selection, or would select items, and then click a button to move them over to the 2nd box. After that I need to update the db with the selected values/items.

    Read the article

  • Fetch html page content into a var

    - by Cipher
    Just a small question here, that how do we get fetch the html content via ajax into a variable that I could use later. Right now, I have a button on the click of which, I fetch another html page simply through load method as follows: $('#container').load('http://127.0.0.1/someUrl') I want to get the content into a var instead that I could at a later time use to append to the dom $('#someContainer').append(someVar)

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >