Search Results

Search found 27606 results on 1105 pages for 'javascript disabled'.

Page 645/1105 | < Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >

  • Looking for a jquery plugin to serialize a form to an object

    - by John
    I'm looking for a jQuery function or plugin that serializes form inputs to an object using the naming convention for deep-serialization supported by param() in jQuery 1.4: <form> <input name="a[b]" value="1"/> <input name="a[c]" value="2"/> <input name="d[]" value="3"/> <input name="d[]" value="4"/> <input name="d[2][e]" value="5"/> </form> $('form').serializeObject(); // { a: { b:1,c:2 }, d: [3,4,{ e:5 }] } Prototype's Form.serialize method can do exactly this. What's the jQuery equivalent? I found this plugin but it doesn't follow this naming convention.

    Read the article

  • Page does update with details from the database after i hit a button

    - by swathi
    I have a code and the way it should work is,when they click on NEW CUSTOMER,it takes them to test1.php where in they enter the details and they hit submit.it saves all the details in properly in the database and when i go back and hit REFRESH ,it should come up with the customer details which they had entered in previously. But what happens is, when i click on the REFRESH,it refreshes the same old page which is empty.I wanted to find out where am i missing the logic.Thanks in advance. The sample code would be <tr> <td class="tdvisitbig" colspan="5">THIS IS A TEST</td> </tr> <tr> <td class='tdvisitbig' colspan="5"><input type="button" onClick="openVisit('test1.php?id=<?=$key?>&name=<?=$name?>');return false;" value="NEW CUSTOMER" class="submit">&nbsp;<input type="button" value="REFRESH" name="add_xyz" class="submit" onClick="document.add.target='_self';document.add.action='test3.php?redirect=visit&section=test page';document.add.submit();"></td> </tr> <? $q = "SELECT address,customernum,status FROM customer WHERE name='$name' ORDER BY customernum"; $r = mysql_query( $q , $Link ); while( $rw = mysql_fetch_assoc( $r ) ) { extract( $rw ); ?> <tr> <? } ?>

    Read the article

  • mootools 1.11 .setHTML not working in IE

    - by moleculezz
    Hello, I am trying to make a form dynamic using mootools 1.11, for specific reasons I cannot upgrade atm. I'm trying to manipulate a select field to have dynamic options. This works in Firefox & Chrome but not IE8. Hope there's a fix for this. bits of the code: myOptions(hrs+1, 23, 'uur'); $('vertrektijd_uur').setHTML('<option value="">Kies uur</option>'+options_uur); $('vertrektijd_uur').addEvent('change', function() { hrsChanged = $('vertrektijd_uur').getValue(); hrsChanged = parseInt(hrsChanged); if(hrs+1 == hrsChanged) { myMinutes(parseInt(min)); myOptions(minChanged, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } else { myOptions(0, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } });

    Read the article

  • Toggeling between image

    - by Binaryrespawn
    Hi all, I have two images with which I am using in an anchor tag. I am using jquery toggle on the click event of the anchor tag to swap between images. $(document).ready(function(){ $('#registrationForm').hide(); $('#callform').append("<a id='formlink'>IMAGE 1</a>"); $("#formlink").click(function(){ $('#registrationForm').toggle(function(){ $('#formlink').empty().append(IMAGE 2); }); }); }); This works fine the first time around, however i want to toggle between the two images whenever the other is clicked. Any ideas ?

    Read the article

  • How to create a div with jQuery accordion

    - by skdnewbie
    Im using this: <script> $(function() { $( "#accordion" ).accordion(); }); </script> To get the effect of expand/collapse. (If you know a better plugin or method, pls notice me) I have this div: <div id ="accordion"></div> And this code to create a button inside that div. (dont worry about the content of button) $('#button_submit').click(function() { $("#accordion").append( $("<button id=saved"+j+">").click(function() { drawChart.apply(null, myArray); }).html("<b>Start date:</b>"+""+myArray[0]+"\n<b>End date:</b>"+myArray[1]+"\n<b>Chart type:</b>"+myArray[2]+"") ); My question is, how to create/format div accordion to have this effect accordion effect jquery . being that the <button id=saved"+j+"> should appear inside the sections. Cheers

    Read the article

  • onclick from an Object's button doesn't work

    - by 730
    I instantiate an object, with an argument which is a button. When the button of an instance is clicked, it should run a function, but it doesn't. In the full version of the code, Chrome gives this message in the console: "Uncaught TypeError: Cannot read property 'onclick' of undefined" HTML: <textarea id='txt' readonly rows='5' cols='40'></textarea> <button id='btn' type='button'>click</button> JS: var btn = document.getElementById('btn'); var txt = document.getElementById('txt'); var foo = new Foo(btn); function Foo(btn) { this.button = btn; } Foo.prototype.buy = function() { txt.value = 'Foo Bar'; }; Foo.button.onclick = function() { foo.buy(); }; Fiddle

    Read the article

  • Show elements depending on html value of a tag

    - by mike23
    I would like to accomplish the following with jquery : When I click on this link <a href="#">Cars</a> I would like all divs like those <div class="product"> <div class="category">Cars</div> </div> to do something. You get the idea, I have a menu with a list of categories, and a list of products, each containing a div with the category name, and I would like to make them hide/show.

    Read the article

  • Can an Ajax call complete before the DOM is loaded?

    - by Ek0nomik
    I am grabbing data through a jQuery Ajax call, and displaying it on the page. I need to wait for both the DOM to load and for the Ajax call to complete before I can use the data to display it on the page. Can an Ajax call ever complete before the DOM has loaded? I'm just trying to determine where I need to put my method that will manipulate the DOM and use the data I'm getting back.

    Read the article

  • Google Chrome && (cache || memory leaks).

    - by Alexey Ogarkov
    Hello All, I have a big problem with Google Chrome and its memory. My app is displaying to user several image charts and reloads them every 10s. In the interval i have code like that var image = new Image(); var src = 'myurl/image'+new Date().getTime(); image.onload = function() { document.getElementById('myimage').src = src; image.onload = image.onabort = image.onerror = null; } image.src = src; So i have no memory leaks in Firefox and IE. Here the response headers for images Server Apache-Coyote/1.1 Vary * Cache-Control no-store (// I try no-cache, must-revalidate and so on here) Content-Type image/png Content-Length 11131 Date Mon, 31 May 2010 14:00:28 GMT Vary * taken from here In about:cache page there is no my cached images. If i enable purge-memory-button for chrome (--purge-memory-button parameter) it`s not help. Images is in PNG24. So i think that the problem is not in cache. May be Google Chrome is not releasing memory for old images. Please help. Any suggestions. Thanks.

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

  • Call a function every hour

    - by user2961971
    I am trying to update information from a weather service on my page. The info should be updated every hour on the hour. How exactly do I go about calling a function on the hour every hour? I kind of had an idea but im not sure of how to actually refine it so it works... What I had in mind was something like creating an if statement, such as: (pseudo code) //get the mins of the current time var mins = datetime.mins(); if(mins == "00"){ function(); }

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • Get an array of forms in java script using prototype

    - by Saurabh
    My document contains more than one forms. How can I get an array of all forms using prototype? <html> <head></head> <body> <form id="form1"> <!-- Other stuffs here --> </form> <form id="form2"> <!-- Other stuffs here --> </form> <form id="form3"> <!-- Other stuffs here --> </form> </body> </html>

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • Finding all the URL requests from a firefox extension

    - by user303052
    I am building a firefox extension. In this extension, I want to see the URLs of any new webpage that the user visits. The webpage can be in a different tab or window than the current tab that the user is viewing (this should also catch the URL of pop-ups). Is there a way to find when firefox makes a GET or POST request and grab the URL? An alternative that I am trying to avoid is going through all the tabs and manually check to see if they have loaded a new page. Thanks

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • Fetch html page content into a var

    - by Cipher
    Just a small question here, that how do we get fetch the html content via ajax into a variable that I could use later. Right now, I have a button on the click of which, I fetch another html page simply through load method as follows: $('#container').load('http://127.0.0.1/someUrl') I want to get the content into a var instead that I could at a later time use to append to the dom $('#someContainer').append(someVar)

    Read the article

  • why does twitter use the !function syntax in their embed code

    - by samccone
    I was looking at twitters embed code and saw that they are using !function ... while i know that this evaluates to false I was wondering what the point of it was. thoughts? !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");

    Read the article

  • jQuery bug when trying to insert partial elements before() / after() ?

    - by RedGlobe
    I'm trying to wrap a div around an element (my 'template' div) by using jQuery's before() and after(). When I try to insert a closing after the selected element, it actually gets placed before the target. Example: <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8" /> <title>Div Wrap</title> <script src="http://code.jquery.com/jquery-1.4.4.min.js"></script> <script> $('document').ready(function() { var beforestr = "<div id=\"wrap\"><div id=\"header\">Top</div><div id=\"page\">"; var afterstr = "</div><div id=\"footer\">Bottom</div></div>"; $('#template').before(beforestr); $('#template').after(afterstr); }); </script> </head> <body> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. <script>document.write('This script should still work and might contain variables. Please don\'t recommend concatenation.');</script> Donec non enim in turpis pulvinar facilisis.</p> </div> </body> </html> The result is: <div id="wrap"> <div id="header">Top</div> <div id="page"> </div> </div> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. This script should still work and might contain variables. Please don't recommend concatenation. Donec non enim in turpis pulvinar facilisis.</p> </div> <div id="footer">Bottom</div> Why are my closing wrap and page divs getting placed before the target, when I'm trying to place them after() ? Is there an alternative way to accomplish this (keeping in mind I may need to call script functions within the template div)? As I'm sure you're aware, best practices aren't what I'm going for here.

    Read the article

< Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >