Search Results

Search found 27606 results on 1105 pages for 'javascript disabled'.

Page 645/1105 | < Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >

  • Toggeling between image

    - by Binaryrespawn
    Hi all, I have two images with which I am using in an anchor tag. I am using jquery toggle on the click event of the anchor tag to swap between images. $(document).ready(function(){ $('#registrationForm').hide(); $('#callform').append("<a id='formlink'>IMAGE 1</a>"); $("#formlink").click(function(){ $('#registrationForm').toggle(function(){ $('#formlink').empty().append(IMAGE 2); }); }); }); This works fine the first time around, however i want to toggle between the two images whenever the other is clicked. Any ideas ?

    Read the article

  • Simple Ticker (jQuery)

    - by Nimbuz
    <ul> <li><a href="#">one</a></li> <li><a href="#">two</a></li> <li><a href="#">three</a></li> </ul> I'd like to show only one li at a time using slide effect, thats it. I'd like to avoid using plugins for something as simple as this. Thanks in advance for your help.

    Read the article

  • mootools 1.11 .setHTML not working in IE

    - by moleculezz
    Hello, I am trying to make a form dynamic using mootools 1.11, for specific reasons I cannot upgrade atm. I'm trying to manipulate a select field to have dynamic options. This works in Firefox & Chrome but not IE8. Hope there's a fix for this. bits of the code: myOptions(hrs+1, 23, 'uur'); $('vertrektijd_uur').setHTML('<option value="">Kies uur</option>'+options_uur); $('vertrektijd_uur').addEvent('change', function() { hrsChanged = $('vertrektijd_uur').getValue(); hrsChanged = parseInt(hrsChanged); if(hrs+1 == hrsChanged) { myMinutes(parseInt(min)); myOptions(minChanged, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } else { myOptions(0, 55, 'min'); $('vertrektijd_min').setHTML('<option value="">Kies minuten</option>'+options_min); } });

    Read the article

  • IE Hanging on jQuery code

    - by OrangeRind
    Here's another clichéd problem, but I couldn't find an exact match to this. I haven't posted any source here, as you can freely see all that is there on the link. :-) Statement:I have a web page at http://agrimgupta.com/antaragni/ Disclaimer: Pardon me for the pathetic coding on that page. ;-) It was done on a very short interval. Improvements will be done at a later stage. Observation: This page is functioning normally on my localhost on all browsers. Problem: IE 8 is crawling (nearly hanging) while loading this page from the website. Although it is working fine on localhost. When on the website, It fails to render the mouseover effects, doing them in almost what seems like a minute. Question: How to resolve this stuck up of IE? It is necessary to resolve this. Thanks in Advance

    Read the article

  • Is this possible?

    - by Stud33
    I want to incorporate some Accelerometer code into a Android application im working and want to see if this is possible. Basically what I need is for the code to detect car acceleration motion. I am not wanting to determine speed with the code but just distinguish if the phone is in a car and has accelerated motion (Hence the car is moving for the first time). I have gone through many different accelerometer applications to see if this motion produces a viable profile to go off of and it appears it does. Just looking for something that popups a "Hello World" dialog when it detects your in the car and its moving for the first time down the street. Any help would be appreciated and a simple yes or no its possible would work. I would also be interested in compensating anyone that is capable of doing this as well. I need this done like yesterday so please let me know. Thank You, JTW

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Loading external content with jquery or iframe?

    - by nailuenlue
    Hiho, There's an existing website that i need to include into another site which goes like this: a.mysite.com and i need to fetch content from this site in my www.mysite.com website... As i need to access the content of the iframe the Same origin policy produces a problem here. What i did was to configure mod_proxy on Apache to proxy pass all requests from www.mysite.com/a to a.mysite.com This will work fine...but my problem is that im not sure what the best way would be to include those pages. 1. Idea As the content of the iframe is a full featured site with a top navigation...left navigation etc....i would need to change the page template to only show the content box to be able to integrate that page in the iframe. 2. Idea I could just load the DIV where the content lies through JQuery.load() and integrate it into my site. What is the best way to accomplish such a task? How bad is both ideas from the SEO point of view?

    Read the article

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • Capturing clicks even when stopPropagation has been called (ie by 3rd party code)?

    - by josh
    I want to detect any click that happens on a page (to close a custom context menu). I'm using jQuery and trying to do $(document).click(function(){ ...close my context menu ... }); However, I'm using some code that calls evt.stopPropagation() in the click handlers for certain elements on the page, and those clicks aren't making it up to my top-level handler. Is there any way of capturing those clicks? Can be jQuery or not jQuery, as long as it works cross-browser.

    Read the article

  • How to create a div with jQuery accordion

    - by skdnewbie
    Im using this: <script> $(function() { $( "#accordion" ).accordion(); }); </script> To get the effect of expand/collapse. (If you know a better plugin or method, pls notice me) I have this div: <div id ="accordion"></div> And this code to create a button inside that div. (dont worry about the content of button) $('#button_submit').click(function() { $("#accordion").append( $("<button id=saved"+j+">").click(function() { drawChart.apply(null, myArray); }).html("<b>Start date:</b>"+""+myArray[0]+"\n<b>End date:</b>"+myArray[1]+"\n<b>Chart type:</b>"+myArray[2]+"") ); My question is, how to create/format div accordion to have this effect accordion effect jquery . being that the <button id=saved"+j+"> should appear inside the sections. Cheers

    Read the article

  • Finding all the URL requests from a firefox extension

    - by user303052
    I am building a firefox extension. In this extension, I want to see the URLs of any new webpage that the user visits. The webpage can be in a different tab or window than the current tab that the user is viewing (this should also catch the URL of pop-ups). Is there a way to find when firefox makes a GET or POST request and grab the URL? An alternative that I am trying to avoid is going through all the tabs and manually check to see if they have loaded a new page. Thanks

    Read the article

  • Simplify my menu animation code

    - by zaius
    I've got a bunch of 'project' divs that I want to expand when they're clicked on. If there's already a project open, I want to hide it before I slide out the new one. I also want to stop clicks on an already open project from closing and then opening it again. Here's an example of what I mean (warning - wrote the code in the browser): $('.projects').click(function() { var clicked_project = $(this); if (clicked_project.is(':visible')) { clicked_project.height(10).slideUp(); return; } var visible_projects = $('.projects:visible'); if (visible_projects.size() > 0) { visible_projects.height(10).slideUp(function() { clicked_project.slideDown(); }); } else { clicked_project.slideDown(); } }); Really, my big issue is with the second part - it sucks that I have to use that if/else - I should just be able to make the callback run instantly if there aren't any visible_projects. I would think this would be a pretty common task, and I'm sure there's a simplification I'm missing. Any suggestions appreciated!

    Read the article

  • It is the arranging game in which

    - by bachchan
    1 2 3 13 5 4 7 10 6 14 11 9 8 15 12 1.Every time when we refresh the page the numbers in the cells will change but the These numbers will remain unique n from 1 to 15 2.Whenever we double click the number in the cell which is surrounded the empty cell then it will replace the empty cell with that number n that number cell become empty. 3.If we double click the cell which is not surrounded the empty cell then it will not replace the empty cell. 4.e.g. if we click 8 then it will not move to empty cell But if we click either 13, 7 , or 11 then it will move to empty cell 5.And every time when we click the cell it’s num color will change for a moment

    Read the article

  • why does twitter use the !function syntax in their embed code

    - by samccone
    I was looking at twitters embed code and saw that they are using !function ... while i know that this evaluates to false I was wondering what the point of it was. thoughts? !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");

    Read the article

  • jquery autocomplete get selected item text

    - by rlee923
    I am wondering how to grab the selected item's text value on jquery autocomplete. I have initialised jquery as following : $(document).ready(function (){ $("input#autocomplete").autocomplete({ source: postcodelist, select: function (event, ui) { AutoCompleteSelectHandler(event, ui) } }); }); And I have created a function function AutoCompleteSelectHandler(event, ui) { }. Inside this function I want to some extra handling to feed data into correct textboxes but I can't figure out how to grab the text value of the selected item. I did google a bit and tried examples but I can't seem to get it working. Any help will be much appreciated. Thanks a lot advance.

    Read the article

  • jQuery setinterval does not show first element

    - by Me-and-Coding
    Hi, I am creating this content slider, you can view/edit here: http://jsbin.com/esame4 I have put in place setInterval so that animation runs automatically, however, when it is run for the first time, google image is shown but not afterwords. Should be simple but i am unable to figure out the problem.

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • onclick from an Object's button doesn't work

    - by 730
    I instantiate an object, with an argument which is a button. When the button of an instance is clicked, it should run a function, but it doesn't. In the full version of the code, Chrome gives this message in the console: "Uncaught TypeError: Cannot read property 'onclick' of undefined" HTML: <textarea id='txt' readonly rows='5' cols='40'></textarea> <button id='btn' type='button'>click</button> JS: var btn = document.getElementById('btn'); var txt = document.getElementById('txt'); var foo = new Foo(btn); function Foo(btn) { this.button = btn; } Foo.prototype.buy = function() { txt.value = 'Foo Bar'; }; Foo.button.onclick = function() { foo.buy(); }; Fiddle

    Read the article

  • Can jquery capture the dynamic dom events and perform actions

    - by Zombie15
    I just wanted to know if something like this is possible. Jquery should fire some action on certian custom event. Like Whenever a new row is added to dom dynamically to table then i have certain action like change the background color to example red. That should work across the whole site. Somethings like Event listeners in Doctrine2 or Signals in Django EDIT: Basically i want some thing like where i can create custom event $.AddnewEvent(newRowAdded); Then i can customise that event with my own functions like $.newRowAdded(function(){ blah blah });

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

< Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >