Search Results

Search found 27606 results on 1105 pages for 'javascript disabled'.

Page 645/1105 | < Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >

  • Can an Ajax call complete before the DOM is loaded?

    - by Ek0nomik
    I am grabbing data through a jQuery Ajax call, and displaying it on the page. I need to wait for both the DOM to load and for the Ajax call to complete before I can use the data to display it on the page. Can an Ajax call ever complete before the DOM has loaded? I'm just trying to determine where I need to put my method that will manipulate the DOM and use the data I'm getting back.

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • Finding all the URL requests from a firefox extension

    - by user303052
    I am building a firefox extension. In this extension, I want to see the URLs of any new webpage that the user visits. The webpage can be in a different tab or window than the current tab that the user is viewing (this should also catch the URL of pop-ups). Is there a way to find when firefox makes a GET or POST request and grab the URL? An alternative that I am trying to avoid is going through all the tabs and manually check to see if they have loaded a new page. Thanks

    Read the article

  • Simple Ticker (jQuery)

    - by Nimbuz
    <ul> <li><a href="#">one</a></li> <li><a href="#">two</a></li> <li><a href="#">three</a></li> </ul> I'd like to show only one li at a time using slide effect, thats it. I'd like to avoid using plugins for something as simple as this. Thanks in advance for your help.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How do I cache jQuery selections?

    - by David
    I need to cache about 100 different selections for animating. The following is sample code. Is there a syntax problem in the second sample? If this isn't the way to cache selections, it's certainly the most popular on the interwebs. So, what am I missing? note: p in the $.path.bezier(p) below is a correctly declared object passed to jQuery.path.bezier (awesome animation library, by the way) This works $(document).ready(function() { animate1(); animate2(); }) function animate1() { $('#image1').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $('#image2').animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); } This doesn't work var $one = $('#image1'); //problem with syntax here?? var $two = $('#image2'); $(document).ready(function() { animate1(); animate2(); }) function animate1() { $one.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate1()", 3000); } function animate2() { $two.animate({ path: new $.path.bezier(p) }, 3000); setTimeout("animate2()", 3000); }

    Read the article

  • jQuery center multiple dynamic images in different sized containers

    - by JVK Design
    So I've found similar questions but none that answer all the questions I have and I know there must be a simple jQuery answer to this. I've got multiple images that are being dynamically placed in their own containing div that have overflow:hidden, they need to fill their containing divs and be centered(horizontally and vertically) also. The containing divs will be different sizes as well. So in short: multiple different sized images fill and center in containing div. containing divs will be different sizes. will be used multiple times on a page. Hopefully this image helps explain what I'm after. Click here to view the image. HTML I'm using but can be changed <div class="imageHolder"> <div class="first SlideImage"> <img src="..." alt="..."/> </div> <div class="second SlideImage"> <img src="..." alt="..."/> </div> <div class="third SlideImage"> <img src="..." alt="..."/> </div> </div> And the CSS .imageHandler{ float:left; width:764px; height:70px; margin:1px 0px 0px; } .imageHolder .SlideImage{ float:left; position:relative; overflow:hidden; } .imageHolder .SlideImage img{ position:absolute; } .imageHolder .first.SlideImage{ width:381px; height:339px; margin-right:1px; } .imageHolder .second.SlideImage{margin-bottom:1px;} .imageHolder .second.SlideImage, .imageHolder .third.SlideImage { width: 382px; height: 169px; } Ask me anything if this doesn't make sense, thanks in advance

    Read the article

  • Why is the page still caching even after the no-cache headers have been sent?

    - by Matthew Grasinger
    I've done a ton of research on this and have asked many people with help and still no success. Here are the details... I'm involved in developing a website that pulls data from various data files, combines them in a temp .csv file, and then is graphed using a popular graphing library: dygraphs. The bulk of the website is written in PHP. The parameters that determine the data that is graphed are stored in the users session, the .csv is named after the users session and available for download, and then the .csv file is written in a script that passes it to the dygraphs object. And we've found, even with the no-cache headers sent: header("Cache-Control: no-cache, must-revalidate"); header("Expires: Sat, 26 Jul 1997 05:00:00 GMT"); Many users experience in the middle of a session, (if enough different graphs are generated) the page displaying an older, static rendering of the page (data they had graphed earlier in the session) as if it were cached and loaded instead of getting a new request. It only gets weirder though: I've checked using developer tools in both Firefox and Chrome and both browsers are receiving the no-cache headers just fine; Even when the problem occurs if you view the page source, the source is the correct content (a table/legend is also dynamically created using php, the source shows the correct table, but what is rendered is older content); the page begins to render correctly until the graph is about to be display, and then shows the older content; the older content displays as if it were a completely static overlay--the cached graph does not have the same dynamic features (roll over data point display, zoom and pan, etc.) And it is as if the correct page were somewhere beneath it (the download button for the csv file moves depending on how large the table is. The older, static page does nothing if you click the download .csv button, but if you can manage to find the one in the page beneath it you can click and still download the .csv. The data in the .csv is correct) It is one of the strangest things I've seen in development thus far. Some other relevant facts are that all the problems I've personally experience occurred while I was using Chrome. Non of these symptoms have been reported by Firefox users. IE users have had the same problems (IE users are forced to use chrome frame). I'm at my wits end at this point. We've sent the php headers; we've tried setting the cache profile for php on IIS as "DisableCache" (or whatever); we've tried sending a random query string to the results page; we've tried all the appropriate meta tags--all with no success.

    Read the article

  • Is this possible?

    - by Stud33
    I want to incorporate some Accelerometer code into a Android application im working and want to see if this is possible. Basically what I need is for the code to detect car acceleration motion. I am not wanting to determine speed with the code but just distinguish if the phone is in a car and has accelerated motion (Hence the car is moving for the first time). I have gone through many different accelerometer applications to see if this motion produces a viable profile to go off of and it appears it does. Just looking for something that popups a "Hello World" dialog when it detects your in the car and its moving for the first time down the street. Any help would be appreciated and a simple yes or no its possible would work. I would also be interested in compensating anyone that is capable of doing this as well. I need this done like yesterday so please let me know. Thank You, JTW

    Read the article

  • Call a function every hour

    - by user2961971
    I am trying to update information from a weather service on my page. The info should be updated every hour on the hour. How exactly do I go about calling a function on the hour every hour? I kind of had an idea but im not sure of how to actually refine it so it works... What I had in mind was something like creating an if statement, such as: (pseudo code) //get the mins of the current time var mins = datetime.mins(); if(mins == "00"){ function(); }

    Read the article

  • onclick from an Object's button doesn't work

    - by 730
    I instantiate an object, with an argument which is a button. When the button of an instance is clicked, it should run a function, but it doesn't. In the full version of the code, Chrome gives this message in the console: "Uncaught TypeError: Cannot read property 'onclick' of undefined" HTML: <textarea id='txt' readonly rows='5' cols='40'></textarea> <button id='btn' type='button'>click</button> JS: var btn = document.getElementById('btn'); var txt = document.getElementById('txt'); var foo = new Foo(btn); function Foo(btn) { this.button = btn; } Foo.prototype.buy = function() { txt.value = 'Foo Bar'; }; Foo.button.onclick = function() { foo.buy(); }; Fiddle

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • why does twitter use the !function syntax in their embed code

    - by samccone
    I was looking at twitters embed code and saw that they are using !function ... while i know that this evaluates to false I was wondering what the point of it was. thoughts? !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");

    Read the article

  • jquery autocomplete get selected item text

    - by rlee923
    I am wondering how to grab the selected item's text value on jquery autocomplete. I have initialised jquery as following : $(document).ready(function (){ $("input#autocomplete").autocomplete({ source: postcodelist, select: function (event, ui) { AutoCompleteSelectHandler(event, ui) } }); }); And I have created a function function AutoCompleteSelectHandler(event, ui) { }. Inside this function I want to some extra handling to feed data into correct textboxes but I can't figure out how to grab the text value of the selected item. I did google a bit and tried examples but I can't seem to get it working. Any help will be much appreciated. Thanks a lot advance.

    Read the article

  • Can jquery capture the dynamic dom events and perform actions

    - by Zombie15
    I just wanted to know if something like this is possible. Jquery should fire some action on certian custom event. Like Whenever a new row is added to dom dynamically to table then i have certain action like change the background color to example red. That should work across the whole site. Somethings like Event listeners in Doctrine2 or Signals in Django EDIT: Basically i want some thing like where i can create custom event $.AddnewEvent(newRowAdded); Then i can customise that event with my own functions like $.newRowAdded(function(){ blah blah });

    Read the article

  • Capturing clicks even when stopPropagation has been called (ie by 3rd party code)?

    - by josh
    I want to detect any click that happens on a page (to close a custom context menu). I'm using jQuery and trying to do $(document).click(function(){ ...close my context menu ... }); However, I'm using some code that calls evt.stopPropagation() in the click handlers for certain elements on the page, and those clicks aren't making it up to my top-level handler. Is there any way of capturing those clicks? Can be jQuery or not jQuery, as long as it works cross-browser.

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • How do I find what text/HTML is on screen in a UIWebview?

    - by Grant M
    I would like to know what the first piece of text/html that is currently showing on screen, or more generally where in pixel location a particular tag or piece of text is in the UIWebview. I know that I can use window.pageYOffset to get the scroll position of the UIwebview, but how do I find out what text or HTML item is there?

    Read the article

  • Toggeling between image

    - by Binaryrespawn
    Hi all, I have two images with which I am using in an anchor tag. I am using jquery toggle on the click event of the anchor tag to swap between images. $(document).ready(function(){ $('#registrationForm').hide(); $('#callform').append("<a id='formlink'>IMAGE 1</a>"); $("#formlink").click(function(){ $('#registrationForm').toggle(function(){ $('#formlink').empty().append(IMAGE 2); }); }); }); This works fine the first time around, however i want to toggle between the two images whenever the other is clicked. Any ideas ?

    Read the article

  • jQuery bug when trying to insert partial elements before() / after() ?

    - by RedGlobe
    I'm trying to wrap a div around an element (my 'template' div) by using jQuery's before() and after(). When I try to insert a closing after the selected element, it actually gets placed before the target. Example: <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8" /> <title>Div Wrap</title> <script src="http://code.jquery.com/jquery-1.4.4.min.js"></script> <script> $('document').ready(function() { var beforestr = "<div id=\"wrap\"><div id=\"header\">Top</div><div id=\"page\">"; var afterstr = "</div><div id=\"footer\">Bottom</div></div>"; $('#template').before(beforestr); $('#template').after(afterstr); }); </script> </head> <body> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. <script>document.write('This script should still work and might contain variables. Please don\'t recommend concatenation.');</script> Donec non enim in turpis pulvinar facilisis.</p> </div> </body> </html> The result is: <div id="wrap"> <div id="header">Top</div> <div id="page"> </div> </div> <div id="template"> <h1>Page Title</h1> <p>Pellentesque habitant morbi tristique senectus et netus et malesuada fames ac turpis egestas. Mauris placerat eleifend leo. Quisque sit amet est et sapien ullamcorper pharetra. This script should still work and might contain variables. Please don't recommend concatenation. Donec non enim in turpis pulvinar facilisis.</p> </div> <div id="footer">Bottom</div> Why are my closing wrap and page divs getting placed before the target, when I'm trying to place them after() ? Is there an alternative way to accomplish this (keeping in mind I may need to call script functions within the template div)? As I'm sure you're aware, best practices aren't what I'm going for here.

    Read the article

< Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >