Search Results

Search found 27606 results on 1105 pages for 'javascript disabled'.

Page 645/1105 | < Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >

  • database search function on an HTML page possible?

    - by synergy989
    Not sure if this is against stackoverflow rules as it's not a specific code question but I really need a little help. I want to know if it is possible to create a search feature (search box) on an HTML webpage that will query a database and return the results? Basically I have a database of products and their related categories. A user would come to the website, enter the category in the search field...somehow query the database and return the results on a new page. Note: the results page doesn't have to be HTML (could be PHP etc). If you could also include a little guidance on how (please nothing detailed, just need a direction). Thank you!

    Read the article

  • How do I find what text/HTML is on screen in a UIWebview?

    - by Grant M
    I would like to know what the first piece of text/html that is currently showing on screen, or more generally where in pixel location a particular tag or piece of text is in the UIWebview. I know that I can use window.pageYOffset to get the scroll position of the UIwebview, but how do I find out what text or HTML item is there?

    Read the article

  • Rails: How to preload a message to user

    - by Michael
    I have a Rails based prelaunch site that has some rotating background images (which are important for selling the idea of the site) that are taking too long to load, such that the users are leaving the site before they load. The only thing they're seeing is the email submission box. What's a good way to show a message to the users that the site will take some time to load but then have that message disappear after a reasonable period of time. I'm guessing a jQuery fadeOut() with a timer, but I'm not sure how long to set the timer for, because I'm not sure at what time it would start counting. Any suggestions?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • find Image correct width and height

    - by Jeny
    now i get the image's width and height when onload function of img . my problem is, the image original width = 500px but document.getElementId(id).offsetWidth gives only 300px and also for height. Please help me how can i get original width and height of image

    Read the article

  • Vertically And Horizonatally center main wrap div

    - by Hello you all men
    Now i try <html> <head> <title>?????????????????</title> <style type="text/css"> body { margin-left: auto; margin-right:auto; } #wrap { background: black; margin-left: auto; margin-right:auto; height:450px; width:450px; position:absolute; top:50%; right:50%; left:50%; margin-top:-225px; } </style> </head> <body> <div id="wrap"> Hello </div> </body> </html> ?????

    Read the article

  • Toggeling between image

    - by Binaryrespawn
    Hi all, I have two images with which I am using in an anchor tag. I am using jquery toggle on the click event of the anchor tag to swap between images. $(document).ready(function(){ $('#registrationForm').hide(); $('#callform').append("<a id='formlink'>IMAGE 1</a>"); $("#formlink").click(function(){ $('#registrationForm').toggle(function(){ $('#formlink').empty().append(IMAGE 2); }); }); }); This works fine the first time around, however i want to toggle between the two images whenever the other is clicked. Any ideas ?

    Read the article

  • jQuery clone( true ) not working with dynamic elements

    - by elclanrs
    Take the following example: $.fn.foo = function() { var $input = $('<input type="text"/>'); var $button_one = $('<button>One</button>'); var $button_two = $('<button>Two</button>'); $button_one.click(function(){ $input.val('hey'); }); $button_two.click(function(){ $input.replaceWith( $input.val('').clone( true ) ); }); this.append($input, $button_one, $button_two); }; Check the demo: http://jsbin.com/ezexah/1/edit Now click "one" and you should see "hey" in the input. Next click "two" and then click "one" again and it doesn't work. Even using the true option in clone to copy all events it still does not work. Any ideas?

    Read the article

  • jquery autocomplete get selected item text

    - by rlee923
    I am wondering how to grab the selected item's text value on jquery autocomplete. I have initialised jquery as following : $(document).ready(function (){ $("input#autocomplete").autocomplete({ source: postcodelist, select: function (event, ui) { AutoCompleteSelectHandler(event, ui) } }); }); And I have created a function function AutoCompleteSelectHandler(event, ui) { }. Inside this function I want to some extra handling to feed data into correct textboxes but I can't figure out how to grab the text value of the selected item. I did google a bit and tried examples but I can't seem to get it working. Any help will be much appreciated. Thanks a lot advance.

    Read the article

  • It is the arranging game in which

    - by bachchan
    1 2 3 13 5 4 7 10 6 14 11 9 8 15 12 1.Every time when we refresh the page the numbers in the cells will change but the These numbers will remain unique n from 1 to 15 2.Whenever we double click the number in the cell which is surrounded the empty cell then it will replace the empty cell with that number n that number cell become empty. 3.If we double click the cell which is not surrounded the empty cell then it will not replace the empty cell. 4.e.g. if we click 8 then it will not move to empty cell But if we click either 13, 7 , or 11 then it will move to empty cell 5.And every time when we click the cell it’s num color will change for a moment

    Read the article

  • focus() jQuery function doesn't work in Safari, but works fine on all other browsers?

    - by pMan
    I have a search text field and search button, when button is clicked with default text in text field, or null value, an alert pops up and sets focus back on search text field. This works very well on all major browsers but not in safari. I tried it even with out jquery, but didn't work. When the focus falls on search text field, I have another jQuery function, is that the problem. The code that sets focus on search text is: if (defaults.keyword == SEARCH_TIP || defaults.keyword == '') { alert(SEARCH_NULL); $('#store_search_keyword').focus(); return false; } The code on focus is: var search_dom = $('#store_search_keyword'); var search_text = search_dom.val(); search_dom.focus(function(){ if ($(this).val() === SEARCH_TIP) { $(this).val(''); } }); any help is appreciated, thanks..

    Read the article

  • Is there a way to embed an mp3 player in a website that isn't flash based (so that the website is iP

    - by hartleybrody
    I did a lot of searching for what I thought would be a pretty common question, but I came up with nothing. If there is another thread with a similar topic, please let me know. Basically, I'm looking for a way to have an .mp3 file play in a website without relying on a flash-based player. I've searched w3 schools and every forum I can think of, but every media player I've found so far has been some sort of proprietary flash player. Doesn't HTML support some sort of native player? I've found some that rely on Windows Media Player which is close, but I want the player to work on an iPhone and something tells me WMP won't get that done... PS, as I'm thinking more about this this idea just popped into my head: a javascipt player and inside the <noscript> tag, put a flash player? I'm running a music blog (@ http://www.freshoncampus.com) so the less code per post, the better...

    Read the article

  • Display alert msg in web page when forwarding from one page to another on page load.

    - by Shantanu Gupta
    I have created a html page in php and upon submission i validates that page using PHP. After validating i want to show an alert msg to show its status like showing any greeting or request for re-enter. I have dont validation. Now i m using header( 'Location: http://localhost/assignment/WebForm.htm' ) ; to redirect user to same page but with a alert msg at page load or something like that. What I need to do ?

    Read the article

  • Can jquery capture the dynamic dom events and perform actions

    - by Zombie15
    I just wanted to know if something like this is possible. Jquery should fire some action on certian custom event. Like Whenever a new row is added to dom dynamically to table then i have certain action like change the background color to example red. That should work across the whole site. Somethings like Event listeners in Doctrine2 or Signals in Django EDIT: Basically i want some thing like where i can create custom event $.AddnewEvent(newRowAdded); Then i can customise that event with my own functions like $.newRowAdded(function(){ blah blah });

    Read the article

  • why does twitter use the !function syntax in their embed code

    - by samccone
    I was looking at twitters embed code and saw that they are using !function ... while i know that this evaluates to false I was wondering what the point of it was. thoughts? !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");

    Read the article

  • Looking for a full list of jQuery event types.

    - by serg555
    Where I can find a complete list of all jQuery supported events (like click, mouseup etc) with some explanations when they are triggered? I am looking for those that can be binded: $('#foo').bind('click', handler); For example I just found out by accident that there is paste event but I can't find any references to it anywhere in their docs. What else is there?

    Read the article

  • Creating a json obj from a string when working without a net connection?

    - by user246114
    Hi, I have a json object returned from a third party api, it looks like: {"version":"1.0","encoding":"UTF-8"} I'm going to be working on my project without a network connection, so I have to do everything locally. How can I create an instance of a json object locally for testing? Say I copy the above string, can I do something like: var json = null; if (debugging_locally) { json = new jsonObj('{"version":"1.0","encoding":"UTF-8"}'); } else { json = doAjaxCall(); } doStuffWithJsonObj(json); so I just want to create a json object from a stored string if debugging locally - how can I do that? Thanks

    Read the article

  • Can I define which characters are allowed to 'break' a word?

    - by zneak
    Hey guys, I'm showing up veeeery long URLs in my Safari extension. Obviously, they can't fit on a single line. Currently, word breaking rules make it so most URLs are on two lines: the first one is rather short and ends with the ? symbol, and the other is ridiculously long and contains all the rest of the GET parameters. I'd like to make it so words also break on the & symbol, without screwing up copy-paste if possible. I've tried to replace every & with &\u00ad (& + the soft hyphen character), but it's kind of weird to see the hyphen after the & when there really isn't any in the URL. I thought there was something in store with CSS3 for that kind of problem, but I can't find it. Any suggestion welcome, as long as it works with Safari.

    Read the article

  • Implementing prompts in text-input

    - by AntonAL
    Hi, I have a form with some text-inputs: login, password. If user sees this form the first time, input-texts should "contain" prompts, like "enter login", "enter password". If user clicks text-input, it's prompt should disappear to allow typing. I have seen various examples, that uses background image with prerendered text on it. Those images are appearing with following jQuery: $("form > :text").focus(function(){ // hide image }).blur(function(){ // show image, if text-input is still empty if ( $(this).val() == "" ) // show image with prompt }); This approach has following problems: localization is impossible need to pre-render images for various textual prompts overhead with loading images How do you overcomes such a problems ?

    Read the article

  • Is there a way to catch an attempt to access a non existant property or method?

    - by Tor Valamo
    For instance this code: function stuff() { this.onlyMethod = function () { return something; } } // some error is thrown stuff().nonExistant(); Is there a way to do something like PHP's __call as a fallback from inside the object? function stuff() { this.onlyMethod = function () { return something; } this.__call__ = function (name, params) { alert(name + " can't be called."); } } // would then raise the alert "nonExistant can't be called". stuff().nonExistant();

    Read the article

< Previous Page | 641 642 643 644 645 646 647 648 649 650 651 652  | Next Page >