Search Results

Search found 7864 results on 315 pages for 'pre commit hook'.

Page 65/315 | < Previous Page | 61 62 63 64 65 66 67 68 69 70 71 72  | Next Page >

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • how to generate PMK?

    - by sebby_zml
    Hi everyone, I would like to know how can I generate a random pre-master key PMK in java? (related in key exchange and authentication) Is it similar with other randam key generating? What particularly is a pre master key? Thanks, Sebby.

    Read the article

  • problems with chili source code highlighter (mysql)

    - by jason
    I am using Chili source code highlighter it works fine with php source using php as the class. But when i change it to mysql it doesnt highlight any SQL code i also tried sql as the classname, i double checked the recipes' and there is a mysql recipes in there. ... What could i be doing wrong? <pre><code id="code" class="php"></code></pre>

    Read the article

  • shell_exec() Doesn't Show The Output

    - by Nathan Campos
    I'm doing a PHP site that uses a shell_exec() function like this: $file = "upload/" . $_FILES["file"]["name"]; $output = shell_exec("leaf $file"); echo "<pre>$output</pre>"; Where leaf is a program that is located in the same directory of my script, but when I tried to run this script on the server, I just got nothing. What is wrong?

    Read the article

  • iPhone HTTP Live Streaming not working on models below 3GS

    - by dreamer
    We are using http live streaming for on demand video from within our iPhone app and on the 3GS models the videos play as they are meant to. However, on the models pre 3GS it gives an error saying this movie format is not supported. I have seen other threads on this however no solutions or insights. Does anyone know if this really is a hardware limitation of the pre 3GS phones or does it have something to do with our code?

    Read the article

  • Visual C++ preprocessor definitions

    - by alemjerus
    Is there a way to transfer C++ preprocessor definitions into a custom pre-link step procedure call as a command-line parameter or export them into a file any other way? Example: Let's say, I have a c++ project, and in it's Debug configuration I put a preprocessor definition like MAKUMBA_OBA=0x13 Then I add custom pre-link step which executes some javascript like sarahjessicaparker.js /to tomsrhinoplasty $(MAKUMBA_OBA) It would be great, if it just worked, but I never get a third parameter in my js. So the question is: how to pass a preprocessor definition to s script?

    Read the article

  • Difference in DocumentBuilder.parse when using JRE 1.5 and JDK 1.6

    - by dhiller
    Recently at last we have switched our projects to Java 1.6. When executing the tests I found out that using 1.6 a SAXParseException is not thrown which has been thrown using 1.5. Below is my test code to demonstrate the problem. import java.io.StringReader; import javax.xml.parsers.DocumentBuilder; import javax.xml.parsers.DocumentBuilderFactory; import javax.xml.transform.stream.StreamSource; import javax.xml.validation.SchemaFactory; import org.junit.Test; import org.xml.sax.InputSource; import org.xml.sax.SAXParseException; /** * Test class to demonstrate the difference between JDK 1.5 to JDK 1.6. * * Seen on Linux: * * <pre> * #java version "1.6.0_18" * Java(TM) SE Runtime Environment (build 1.6.0_18-b07) * Java HotSpot(TM) Server VM (build 16.0-b13, mixed mode) * </pre> * * Seen on OSX: * * <pre> * java version "1.6.0_17" * Java(TM) SE Runtime Environment (build 1.6.0_17-b04-248-10M3025) * Java HotSpot(TM) 64-Bit Server VM (build 14.3-b01-101, mixed mode) * </pre> * * @author dhiller (creator) * @author $Author$ (last editor) * @version $Revision$ * @since 12.03.2010 11:32:31 */ public class TestXMLValidation { /** * Tests the schema validation of an XML against a simple schema. * * @throws Exception * Falls ein Fehler auftritt * @throws junit.framework.AssertionFailedError * Falls eine Unit-Test-Pruefung fehlschlaegt */ @Test(expected = SAXParseException.class) public void testValidate() throws Exception { final StreamSource schema = new StreamSource( new StringReader( "<?xml version=\"1.0\" encoding=\"UTF-8\"?>" + "<xs:schema xmlns:xs=\"http://www.w3.org/2001/XMLSchema\" " + "elementFormDefault=\"qualified\" xmlns:xsd=\"undefined\">" + "<xs:element name=\"Test\"/>" + "</xs:schema>" ) ); final String xml = "<Test42/>"; final DocumentBuilderFactory newFactory = DocumentBuilderFactory.newInstance(); newFactory.setSchema( SchemaFactory.newInstance( "http://www.w3.org/2001/XMLSchema" ).newSchema( schema ) ); final DocumentBuilder documentBuilder = newFactory.newDocumentBuilder(); documentBuilder.parse( new InputSource( new StringReader( xml ) ) ); } } When using a JVM 1.5 the test passes, on 1.6 it fails with "Expected exception SAXParseException". The Javadoc of the DocumentBuilderFactory.setSchema(Schema) Method says: When errors are found by the validator, the parser is responsible to report them to the user-specified ErrorHandler (or if the error handler is not set, ignore them or throw them), just like any other errors found by the parser itself. In other words, if the user-specified ErrorHandler is set, it must receive those errors, and if not, they must be treated according to the implementation specific default error handling rules. The Javadoc of the DocumentBuilder.parse(InputSource) method says: BTW: I tried setting an error handler via setErrorHandler, but there still is no exception. Now my question: What has changed to 1.6 that prevents the schema validation to throw a SAXParseException? Is it related to the schema or to the xml that I tried to parse?

    Read the article

  • Algorithm to suggest a list of tags to users

    - by Itay Moav
    Given a free text, I need to analyse this this text and suggest a list of tags from a pre existing list. What algorithms are out there in the market? Can they handle a case where, for example, the text have a word like high cholesterol and I would like it so suggest heart disease although "high cholesterol" might not exists (initially) in the pre defined list.

    Read the article

  • Is an editable select box the right way?

    - by Neil Middleton
    I have a scenario where a user is emailing another user in an HTML based web app. For the To: field, the user may select one of a pre-defined list of emails OR enter their own ignoring the pre-defined options. What would be the best way of doing this from a UI point of view? I've looked at editable select boxes using jQuery but none seem to let you enter your own option. Is there some other UI mechanism that would work here?

    Read the article

  • jQuery datepicker calendar - call to function updates database

    - by erbaker
    So I'm using the datepicker plugin to make an availability calendar. Here is my javascript: http://pastebin.com/H7D9PcAg When dpSetSelected() is called it is also calling dateSelected() which triggers the AJAX call to my PHP script. I need a way to only update the database if the date is clicked on and not pre-loaded. When I pre-load the dates they are sent to the PHP page and subsequently removed.

    Read the article

  • How to avoid my this facebook app api login page?

    - by user1035140
    I got a problem regrading with my apps which is once I go to my apps, it sure will show me a login page instead of allow page? it always display the login page 1st then only display allow page, I had tried other apps, if I am 1st time user, It sure will appear the allow page only, it did not show me the login page. my question is how to I avoid my login page direct go to allow page? here is my login page picture here is my apps link https://apps.facebook.com/christmas_testing/ here is my facebook php jdk api coding <?php $fbconfig['appid' ] = "XXXXXXXXXXXXX"; $fbconfig['secret'] = "XXXXXXXXXXXXX"; $fbconfig['baseUrl'] = "myserverlink"; $fbconfig['appBaseUrl'] = "http://apps.facebook.com/christmas_testing/"; if (isset($_GET['code'])){ header("Location: " . $fbconfig['appBaseUrl']); exit; } if (isset($_GET['request_ids'])){ //user comes from invitation //track them if you need header("Location: " . $fbconfig['appBaseUrl']); } $user = null; //facebook user uid try{ include_once "facebook.php"; } catch(Exception $o){ echo '<pre>'; print_r($o); echo '</pre>'; } // Create our Application instance. $facebook = new Facebook(array( 'appId' => $fbconfig['appid'], 'secret' => $fbconfig['secret'], 'cookie' => true, )); //Facebook Authentication part $user = $facebook->getUser(); $loginUrl = $facebook->getLoginUrl( array( 'scope' => 'email,publish_stream,user_birthday,user_location,user_work_history,user_about_me,user_hometown' ) ); if ($user) { try { // Proceed knowing you have a logged in user who's authenticated. $user_profile = $facebook->api('/me'); } catch (FacebookApiException $e) { //you should use error_log($e); instead of printing the info on browser d($e); // d is a debug function defined at the end of this file $user = null; } } if (!$user) { echo "<script type='text/javascript'>top.location.href = '$loginUrl';</script>"; exit; } //get user basic description $userInfo = $facebook->api("/$user"); function d($d){ echo '<pre>'; print_r($d); echo '</pre>'; } ?

    Read the article

  • selenium, get text from id

    - by user3766148
    on the following url - http://www.filestube.to/26frq-Buffalo-Clover-Test-Your-Love-2014-9Jai9TJFukAS9fq9sWngAD.html I am trying to copy the; Direct links: turbobit.net/9mrb0eu9eksx/26frq.Buffalo.Clover..Test.Your.Love.2014.rar.html via css path or xpath and unable to retrieve the information and store it to a variable. firebug gives me html body div.cnt div.rH.no-js.fd div.rl div.fgBx pre span#copy_paste_links but when I apply css=html.body.div.cnt.div.rH.no-js.fd.div.rl.div.fgBx.pre.span#copy_paste_links/text() to the target, I get error not found http://i.imgur.com/KdBmDHE.png

    Read the article

  • Code example with annotation in JavaDoc

    - by John
    Hello, my JavaDoc doesn't work when I have a code example with an annotation. Any suggestions? /** * <pre> * public class Demo { * @DemoAnnotation * public void demoMethod() { * } * } * </pre> */ @Retention(RetentionPolicy.RUNTIME) @Target({ElementType.METHOD}) public @interface DemoAnnotation {

    Read the article

  • What's the fastest lookup algorithm for a key, pair data structure (i.e, a map)?

    - by truncheon
    In the following example a std::map structure is filled with 26 values from A - Z (for key) and 0 – 26 for value. The time taken (on my system) to lookup the last entry (10000000 times) is roughly 250 ms for the vector, and 125 ms for the map. (I compiled using release mode, with O3 option turned on for g++ 4.4) But if for some odd reason I wanted better performance than the std::map, what data structures and functions would I need to consider using? I apologize if the answer seems obvious to you, but I haven't had much experience in the performance critical aspects of C++ programming. #include <ctime> #include <map> #include <vector> #include <iostream> struct mystruct { char key; int value; mystruct(char k = 0, int v = 0) : key(k), value(v) { } }; int find(const std::vector<mystruct>& ref, char key) { for (std::vector<mystruct>::const_iterator i = ref.begin(); i != ref.end(); ++i) if (i->key == key) return i->value; return -1; } int main() { std::map<char, int> mymap; std::vector<mystruct> myvec; for (int i = 'a'; i < 'a' + 26; ++i) { mymap[i] = i - 'a'; myvec.push_back(mystruct(i, i - 'a')); } int pre = clock(); for (int i = 0; i < 10000000; ++i) { find(myvec, 'z'); } std::cout << "linear scan: milli " << clock() - pre << "\n"; pre = clock(); for (int i = 0; i < 10000000; ++i) { mymap['z']; } std::cout << "map scan: milli " << clock() - pre << "\n"; return 0; }

    Read the article

  • Google App Engine + AWS S3 file protection!

    - by grep
    Hi all, I have an application running on GAE/J that streams video from AWS S3. I need a solution for protecting the video from being stolen and I found that pre-signed URLs might be it (??). How can I create pre-signed URLs from GAE/J or there's a better solution to secure the videos? thanks

    Read the article

  • Git apache : unable to push via http

    - by GlinesMome
    I have to setup a server which can allow http vcs management (such as git and svn). svn support works well, but I have some trouble with git. Actual configuration: CentOS 5 Apache 2.2.8 Git 1.7.4.1 The /etc/httpd/conf/httpd.conf content: ServerTokens OS ServerRoot "/etc/httpd" PidFile run/httpd.pid Timeout 120 KeepAlive On MaxKeepAliveRequests 100 KeepAliveTimeout 10 <IfModule prefork.c> StartServers 8 MinSpareServers 5 MaxSpareServers 20 ServerLimit 256 MaxClients 256 MaxRequestsPerChild 4000 </IfModule> <IfModule worker.c> StartServers 2 MaxClients 150 MinSpareThreads 25 MaxSpareThreads 75 ThreadsPerChild 25 MaxRequestsPerChild 0 </IfModule> Listen 80 LoadModule auth_basic_module modules/mod_auth_basic.so LoadModule auth_digest_module modules/mod_auth_digest.so LoadModule authn_file_module modules/mod_authn_file.so LoadModule authn_alias_module modules/mod_authn_alias.so LoadModule authn_anon_module modules/mod_authn_anon.so LoadModule authn_dbm_module modules/mod_authn_dbm.so LoadModule authn_default_module modules/mod_authn_default.so LoadModule authz_host_module modules/mod_authz_host.so LoadModule authz_user_module modules/mod_authz_user.so LoadModule authz_owner_module modules/mod_authz_owner.so LoadModule authz_groupfile_module modules/mod_authz_groupfile.so LoadModule authz_dbm_module modules/mod_authz_dbm.so LoadModule authz_default_module modules/mod_authz_default.so LoadModule ldap_module modules/mod_ldap.so LoadModule authnz_ldap_module modules/mod_authnz_ldap.so LoadModule include_module modules/mod_include.so LoadModule log_config_module modules/mod_log_config.so LoadModule logio_module modules/mod_logio.so LoadModule env_module modules/mod_env.so LoadModule ext_filter_module modules/mod_ext_filter.so LoadModule mime_magic_module modules/mod_mime_magic.so LoadModule expires_module modules/mod_expires.so LoadModule deflate_module modules/mod_deflate.so LoadModule headers_module modules/mod_headers.so LoadModule usertrack_module modules/mod_usertrack.so LoadModule setenvif_module modules/mod_setenvif.so LoadModule mime_module modules/mod_mime.so LoadModule dav_module modules/mod_dav.so LoadModule status_module modules/mod_status.so LoadModule autoindex_module modules/mod_autoindex.so LoadModule info_module modules/mod_info.so LoadModule dav_fs_module modules/mod_dav_fs.so LoadModule vhost_alias_module modules/mod_vhost_alias.so LoadModule negotiation_module modules/mod_negotiation.so LoadModule dir_module modules/mod_dir.so LoadModule actions_module modules/mod_actions.so LoadModule speling_module modules/mod_speling.so LoadModule userdir_module modules/mod_userdir.so LoadModule alias_module modules/mod_alias.so LoadModule rewrite_module modules/mod_rewrite.so LoadModule proxy_module modules/mod_proxy.so LoadModule proxy_balancer_module modules/mod_proxy_balancer.so LoadModule proxy_ftp_module modules/mod_proxy_ftp.so LoadModule proxy_http_module modules/mod_proxy_http.so LoadModule proxy_connect_module modules/mod_proxy_connect.so LoadModule cache_module modules/mod_cache.so LoadModule suexec_module modules/mod_suexec.so LoadModule disk_cache_module modules/mod_disk_cache.so LoadModule file_cache_module modules/mod_file_cache.so LoadModule mem_cache_module modules/mod_mem_cache.so LoadModule cgi_module modules/mod_cgi.so LoadModule mysql_auth_module modules/mod_auth_mysql.so LoadModule passenger_module /usr/lib/ruby/gems/1.8/gems/passenger-3.0.2/ext/apache2/mod_passenger.so PassengerRoot /usr/lib/ruby/gems/1.8/gems/passenger-3.0.2 PassengerRuby /usr/bin/ruby Include conf.d/*.conf User apache Group apache ServerAdmin aedi.admin@domain ServerName s1.domain UseCanonicalName Off DocumentRoot "/data/www/" <Directory /> Options FollowSymLinks AllowOverride None </Directory> <Directory "/data/www/"> Options -Indexes FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> <IfModule mod_userdir.c> UserDir disable </IfModule> DirectoryIndex index.html index.html.var AccessFileName .htaccess <Files ~ "^\.ht"> Order allow,deny Deny from all </Files> TypesConfig /etc/mime.types DefaultType text/plain <IfModule mod_mime_magic.c> MIMEMagicFile conf/magic </IfModule> HostnameLookups Off ErrorLog logs/error_log LogLevel warn LogFormat "%h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\"" combined LogFormat "%h %l %u %t \"%r\" %>s %b" common LogFormat "%{Referer}i -> %U" referer LogFormat "%{User-agent}i" agent CustomLog logs/access_log combined ServerSignature On Alias /icons/ "/var/www/icons/" <Directory "/var/www/icons"> Options Indexes MultiViews AllowOverride None Order allow,deny Allow from all </IfModule> </Directory> <IfModule mod_dav_fs.c> DAVLockDB /var/lib/dav/lockdb ScriptAlias /cgi-bin/ "/var/www/cgi-bin/" <Directory "/var/www/cgi-bin"> AllowOverride None Options None Order allow,deny Allow from all </Directory> IndexOptions FancyIndexing VersionSort NameWidth=* HTMLTable AddIconByEncoding (CMP,/icons/compressed.gif) x-compress x-gzip AddIconByType (TXT,/icons/text.gif) text/* AddIconByType (IMG,/icons/image2.gif) image/* AddIconByType (SND,/icons/sound2.gif) audio/* AddIconByType (VID,/icons/movie.gif) video/* AddIcon /icons/binary.gif .bin .exe AddIcon /icons/binhex.gif .hqx AddIcon /icons/tar.gif .tar AddIcon /icons/world2.gif .wrl .wrl.gz .vrml .vrm .iv AddIcon /icons/compressed.gif .Z .z .tgz .gz .zip AddIcon /icons/a.gif .ps .ai .eps AddIcon /icons/layout.gif .html .shtml .htm .pdf AddIcon /icons/text.gif .txt AddIcon /icons/c.gif .c AddIcon /icons/p.gif .pl .py AddIcon /icons/f.gif .for AddIcon /icons/dvi.gif .dvi AddIcon /icons/uuencoded.gif .uu AddIcon /icons/script.gif .conf .sh .shar .csh .ksh .tcl AddIcon /icons/tex.gif .tex AddIcon /icons/bomb.gif core AddIcon /icons/back.gif .. AddIcon /icons/hand.right.gif README AddIcon /icons/folder.gif ^^DIRECTORY^^ AddIcon /icons/blank.gif ^^BLANKICON^^ DefaultIcon /icons/unknown.gif ReadmeName README.html HeaderName HEADER.html AddLanguage ca .ca AddLanguage cs .cz .cs AddLanguage da .dk AddLanguage de .de AddLanguage el .el AddLanguage en .en AddLanguage eo .eo AddLanguage es .es AddLanguage et .et AddLanguage fr .fr AddLanguage he .he AddLanguage hr .hr AddLanguage it .it AddLanguage ja .ja AddLanguage ko .ko AddLanguage ltz .ltz AddLanguage nl .nl AddLanguage nn .nn AddLanguage no .no AddLanguage pl .po AddLanguage pt .pt AddLanguage pt-BR .pt-br AddLanguage ru .ru AddLanguage sv .sv AddLanguage zh-CN .zh-cn AddLanguage zh-TW .zh-tw LanguagePriority en ca cs da de el eo es et fr he hr it ja ko ltz nl nn no pl pt pt-BR ru sv zh-CN zh-TW ForceLanguagePriority Prefer Fallback AddDefaultCharset UTF-8 AddType application/x-compress .Z AddType application/x-gzip .gz .tgz AddHandler type-map var AddType text/html .shtml AddOutputFilter INCLUDES .shtml Alias /error/ "/var/www/error/" <IfModule mod_negotiation.c> <IfModule mod_include.c> <Directory "/var/www/error"> AllowOverride None Options IncludesNoExec AddOutputFilter Includes html AddHandler type-map var Order allow,deny Allow from all LanguagePriority en es de fr ForceLanguagePriority Prefer Fallback </Directory> </IfModule> </IfModule> BrowserMatch "Mozilla/2" nokeepalive BrowserMatch "MSIE 4\.0b2;" nokeepalive downgrade-1.0 force-response-1.0 BrowserMatch "RealPlayer 4\.0" force-response-1.0 BrowserMatch "Java/1\.0" force-response-1.0 BrowserMatch "JDK/1\.0" force-response-1.0 BrowserMatch "Microsoft Data Access Internet Publishing Provider" redirect-carefully BrowserMatch "MS FrontPage" redirect-carefully BrowserMatch "^WebDrive" redirect-carefully BrowserMatch "^WebDAVFS/1.[0123]" redirect-carefully BrowserMatch "^gnome-vfs/1.0" redirect-carefully BrowserMatch "^XML Spy" redirect-carefully BrowserMatch "^Dreamweaver-WebDAV-SCM1" redirect-carefully NameVirtualHost *:80 NameVirtualHost *:443 <VirtualHost *:80> DocumentRoot /data/www/s1/html ServerName s1.asso.domain ErrorLog logs/s1.error.log </VirtualHost> <VirtualHost *:80> DocumentRoot /data/www/s2/old ServerName s2.domain ErrorLog logs/s2.error.log RailsBaseURI /blog <Directory /data/www/s2/html/blog> Options -MultiViews </Directory> </VirtualHost> <VirtualHost *:443> DocumentRoot /data/www/s2/html ServerName s2.domain ErrorLog logs/s2.error.log RailsBaseURI /blog <Directory /data/www/s2/html/blog> Options -MultiViews </Directory> </VirtualHost> The /etc/httpd/conf.d/git.conf content: Alias /git /data/www/s2/git <Directory /data/www/s2/git> Options +Indexes DAV on SSLRequireSSL </Directory> Fine, every repository are created by the same way: git --bare init "$1.git" && cd "$1.git" && git update-server-info && chmod -R 770 . && cd .. && git clone `pwd`/"$1.git" && cd "$1" && echo 42 > answer && git add . && git commit -m "Initial commit" && git push origin master && git rm answer && git commit -a -m "Clean repository" && git push && cd .. && rm -Rf "$1" Then, on the client side, I try: ~ $ git clone https://s2.domain/git/repo.git Cloning into 'repo'... warning: You appear to have cloned an empty repository. ~ $ cd repo repo $ echo 42 > answer && git add . && git commit -m "init" && git push origin master [master (root-commit) a2aadb1] init 1 file changed, 1 insertion(+) create mode 100644 answer Fetching remote heads... refs/ refs/heads/ refs/tags/ updating 'refs/heads/master' from 0000000000000000000000000000000000000000 to a2aadb1772e12104ce358f7ff9a11db5d93ead7d sending 3 objects MOVE d81cc0710eb6cf9efd5b920a8453e1e07157b6cd failed, aborting (22/502) MOVE 2c186ad49fa24695512df5e41cb5e6f2d33c119b failed, aborting (22/502) MOVE a2aadb1772e12104ce358f7ff9a11db5d93ead7d failed, aborting (22/502) Updating remote server info fatal: git-http-push failed The apache associated logs: my.ip - - [21/Sep/2012:16:19:19 +0200] "GET /git/repo.git/info/refs?service=git-upload-pack HTTP/1.1" 200 - "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:19 +0200] "GET /git/repo.git/HEAD HTTP/1.1" 200 23 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:48 +0200] "GET /git/repo.git/info/refs?service=git-receive-pack HTTP/1.1" 200 - "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "GET /git/repo.git/HEAD HTTP/1.1" 200 23 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PROPFIND /git/repo.git/ HTTP/1.1" 207 569 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "HEAD /git/repo.git/info/refs HTTP/1.1" 200 - "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "HEAD /git/repo.git/objects/info/packs HTTP/1.1" 200 - "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "MKCOL /git/repo.git/info/ HTTP/1.1" 405 336 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "LOCK /git/repo.git/info/refs HTTP/1.1" 200 475 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "GET /git/repo.git/objects/info/packs HTTP/1.1" 200 1 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PROPFIND /git/repo.git/refs/ HTTP/1.1" 207 2608 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PROPFIND /git/repo.git/refs/heads/ HTTP/1.1" 207 941 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PROPFIND /git/repo.git/refs/tags/ HTTP/1.1" 207 940 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "MKCOL /git/repo.git/refs/ HTTP/1.1" 405 336 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "MKCOL /git/repo.git/refs/heads/ HTTP/1.1" 405 342 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "LOCK /git/repo.git/refs/heads/master HTTP/1.1" 200 475 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PROPFIND /git/repo.git/objects/a2/ HTTP/1.1" 404 317 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PROPFIND /git/repo.git/objects/2c/ HTTP/1.1" 207 4565 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PROPFIND /git/repo.git/objects/d8/ HTTP/1.1" 207 4565 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PUT /git/repo.git/objects/d8/1cc0710eb6cf9efd5b920a8453e1e07157b6cd_20ca3a58daa09e54112968cbd4e86580b6301074 HTTP/1.1" 201 373 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "MKCOL /git/repo.git/objects/a2/ HTTP/1.1" 201 296 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PUT /git/repo.git/objects/2c/186ad49fa24695512df5e41cb5e6f2d33c119b_20ca3a58daa09e54112968cbd4e86580b6301074 HTTP/1.1" 201 373 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "MOVE /git/repo.git/objects/d8/1cc0710eb6cf9efd5b920a8453e1e07157b6cd_20ca3a58daa09e54112968cbd4e86580b6301074 HTTP/1.1" 502 341 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "MOVE /git/repo.git/objects/2c/186ad49fa24695512df5e41cb5e6f2d33c119b_20ca3a58daa09e54112968cbd4e86580b6301074 HTTP/1.1" 502 341 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PUT /git/repo.git/objects/a2/aadb1772e12104ce358f7ff9a11db5d93ead7d_20ca3a58daa09e54112968cbd4e86580b6301074 HTTP/1.1" 201 373 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "MOVE /git/repo.git/objects/a2/aadb1772e12104ce358f7ff9a11db5d93ead7d_20ca3a58daa09e54112968cbd4e86580b6301074 HTTP/1.1" 502 341 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "UNLOCK /git/repo.git/refs/heads/master HTTP/1.1" 204 - "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PROPFIND /git/repo.git/refs/ HTTP/1.1" 207 2608 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PROPFIND /git/repo.git/refs/heads/ HTTP/1.1" 207 941 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "PROPFIND /git/repo.git/refs/tags/ HTTP/1.1" 207 940 "-" "git/1.7.11.4" my.ip - - [21/Sep/2012:16:19:49 +0200] "UNLOCK /git/repo.git/info/refs HTTP/1.1" 204 - "-" "git/1.7.11.4" I have tried many configurations (even smart http from progit), but a major part of them consider the fact that they have a dedicated domain, but I'm in a sub-directory, so I can't apply these examples. Have you got an idea of the problem? have you got solutions? have you got configuration example with non-root directory? For your help, In advance, Thanks.

    Read the article

  • How can I forward ALL traffic over a site-to-site VPN on Cisco ASA?

    - by Scott Clements
    Hi There, I currently have two Cisco ASA 5100 routers. They are at different physical sites and are configured with a site-to-site VPN which is active and working. I can communicate with the subnets on either site from the other and both are connected to the internet, however I need to ensure that all the traffic at my remote site goes through this VPN to my site here. I know that the web traffic is doing so as a "tracert" confirms this, but I need to ensure that all other network traffic is being directed over this VPN to my network here. Here is my config for the ASA router at my remote site: hostname ciscoasa domain-name xxxxx enable password 78rl4MkMED8xiJ3g encrypted names ! interface Ethernet0/0 nameif NIACEDC security-level 100 ip address x.x.x.x 255.255.255.0 ! interface Ethernet0/1 description External Janet Connection nameif JANET security-level 0 ip address x.x.x.x 255.255.255.248 ! interface Ethernet0/2 shutdown no nameif security-level 100 no ip address ! interface Ethernet0/3 shutdown no nameif security-level 100 ip address dhcp setroute ! interface Management0/0 nameif management security-level 100 ip address 192.168.100.1 255.255.255.0 management-only ! passwd 2KFQnbNIdI.2KYOU encrypted ftp mode passive clock timezone GMT/BST 0 clock summer-time GMT/BDT recurring last Sun Mar 1:00 last Sun Oct 2:00 dns domain-lookup NIACEDC dns server-group DefaultDNS name-server 154.32.105.18 name-server 154.32.107.18 domain-name XXXX same-security-traffic permit inter-interface same-security-traffic permit intra-interface access-list ren_access_in extended permit ip any any access-list ren_access_in extended permit tcp any any access-list ren_nat0_outbound extended permit ip 192.168.6.0 255.255.255.0 192.168.3.0 255.255.255.0 access-list NIACEDC_nat0_outbound extended permit ip 192.168.12.0 255.255.255.0 192.168.3.0 255.255.255.0 access-list JANET_20_cryptomap extended permit ip 192.168.12.0 255.255.255.0 192.168.3.0 255.255.255.0 access-list NIACEDC_access_in extended permit ip any any access-list NIACEDC_access_in extended permit tcp any any access-list JANET_access_out extended permit ip any any access-list NIACEDC_access_out extended permit ip any any pager lines 24 logging enable logging asdm informational mtu NIACEDC 1500 mtu JANET 1500 mtu management 1500 icmp unreachable rate-limit 1 burst-size 1 asdm image disk0:/asdm-522.bin no asdm history enable arp timeout 14400 nat-control global (NIACEDC) 1 interface global (JANET) 1 interface nat (NIACEDC) 0 access-list NIACEDC_nat0_outbound nat (NIACEDC) 1 192.168.12.0 255.255.255.0 access-group NIACEDC_access_in in interface NIACEDC access-group NIACEDC_access_out out interface NIACEDC access-group JANET_access_out out interface JANET route JANET 0.0.0.0 0.0.0.0 194.82.121.82 1 route JANET 0.0.0.0 0.0.0.0 192.168.3.248 tunneled timeout xlate 3:00:00 timeout conn 1:00:00 half-closed 0:10:00 udp 0:02:00 icmp 0:00:02 timeout sunrpc 0:10:00 h323 0:05:00 h225 1:00:00 mgcp 0:05:00 mgcp-pat 0:05:00 timeout sip 0:30:00 sip_media 0:02:00 sip-invite 0:03:00 sip-disconnect 0:02:00 timeout uauth 0:05:00 absolute http server enable http 192.168.12.0 255.255.255.0 NIACEDC http 192.168.100.0 255.255.255.0 management http 192.168.9.0 255.255.255.0 NIACEDC no snmp-server location no snmp-server contact snmp-server enable traps snmp authentication linkup linkdown coldstart crypto ipsec transform-set ESP-3DES-SHA esp-3des esp-sha-hmac crypto ipsec transform-set ESP-AES-256-SHA esp-aes-256 esp-sha-hmac crypto map JANET_map 20 match address JANET_20_cryptomap crypto map JANET_map 20 set pfs crypto map JANET_map 20 set peer X.X.X.X crypto map JANET_map 20 set transform-set ESP-AES-256-SHA crypto map JANET_map interface JANET crypto isakmp enable JANET crypto isakmp policy 10 authentication pre-share encryption aes-256 hash sha group 2 lifetime 86400 crypto isakmp policy 30 authentication pre-share encryption 3des hash sha group 2 lifetime 86400 crypto isakmp policy 50 authentication pre-share encryption aes-256 hash sha group 5 lifetime 86400 tunnel-group X.X.X.X type ipsec-l2l tunnel-group X.X.X.X ipsec-attributes pre-shared-key * telnet timeout 5 ssh timeout 5 console timeout 0 dhcpd address 192.168.100.2-192.168.100.254 management dhcpd enable management ! ! class-map inspection_default match default-inspection-traffic ! ! policy-map type inspect dns preset_dns_map parameters message-length maximum 512 policy-map global_policy class inspection_default inspect dns preset_dns_map inspect ftp inspect h323 h225 inspect h323 ras inspect rsh inspect rtsp inspect esmtp inspect sqlnet inspect skinny inspect sunrpc inspect xdmcp inspect sip inspect netbios inspect tftp inspect http ! service-policy global_policy global prompt hostname context no asdm history enable Thanks in advance, Scott

    Read the article

  • UnicodeEncodeError when uploading files in Django admin

    - by Samuel Linde
    Note: I asked this question on StackOverflow, but I realize this might be a more proper place to ask this kind of question. I'm trying to upload a file called 'Testaråäö.txt' via the Django admin app. I'm running Django 1.3.1 with Gunicorn 0.13.4 and Nginx 0.7.6.7 on a Debian 6 server. Database is PostgreSQL 8.4.9. Other Unicode data is saved to the database with no problem, so I guess the problem must be with the filesystem somehow. I've set http { charset utf-8; } in my nginx.conf. LC_ALL and LANG is set to 'sv_SE.UTF-8'. Running 'locale' verifies this. I even tried setting LC_ALL and LANG in my nginx init script just to make sure locale is set properly. Here's the traceback: Traceback (most recent call last): File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/core/handlers/base.py", line 111, in get_response response = callback(request, *callback_args, **callback_kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/contrib/admin/options.py", line 307, in wrapper return self.admin_site.admin_view(view)(*args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/utils/decorators.py", line 93, in _wrapped_view response = view_func(request, *args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/views/decorators/cache.py", line 79, in _wrapped_view_func response = view_func(request, *args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/contrib/admin/sites.py", line 197, in inner return view(request, *args, **kwargs) File "/srv/django/letebo/app/cms/admin.py", line 81, in change_view return super(PageAdmin, self).change_view(request, obj_id) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/utils/decorators.py", line 28, in _wrapper return bound_func(*args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/utils/decorators.py", line 93, in _wrapped_view response = view_func(request, *args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/utils/decorators.py", line 24, in bound_func return func(self, *args2, **kwargs2) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/transaction.py", line 217, in inner res = func(*args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/contrib/admin/options.py", line 985, in change_view self.save_formset(request, form, formset, change=True) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/contrib/admin/options.py", line 677, in save_formset formset.save() File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/forms/models.py", line 482, in save return self.save_existing_objects(commit) + self.save_new_objects(commit) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/forms/models.py", line 613, in save_new_objects self.new_objects.append(self.save_new(form, commit=commit)) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/forms/models.py", line 717, in save_new obj.save() File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/base.py", line 460, in save self.save_base(using=using, force_insert=force_insert, force_update=force_update) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/base.py", line 504, in save_base self.save_base(cls=parent, origin=org, using=using) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/base.py", line 543, in save_base for f in meta.local_fields if not isinstance(f, AutoField)] File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/fields/files.py", line 255, in pre_save file.save(file.name, file, save=False) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/fields/files.py", line 92, in save self.name = self.storage.save(name, content) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/core/files/storage.py", line 48, in save name = self.get_available_name(name) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/core/files/storage.py", line 74, in get_available_name while self.exists(name): File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/core/files/storage.py", line 218, in exists return os.path.exists(self.path(name)) File "/srv/.virtualenvs/letebo/lib/python2.6/genericpath.py", line 18, in exists st = os.stat(path) UnicodeEncodeError: 'ascii' codec can't encode characters in position 52-54: ordinal not in range(128) I tried running Gunicorn with debugging turned on, and the file uploads without any problem at all. I suppose this must mean that the issue is with Nginx. Still beats me where to look, though. Here are the raw response headers from Gunicorn and Nginx, if it makes any sense: Gunicorn: HTTP/1.1 302 FOUND Server: gunicorn/0.13.4 Date: Thu, 09 Feb 2012 14:50:27 GMT Connection: close Transfer-Encoding: chunked Expires: Thu, 09 Feb 2012 14:50:27 GMT Vary: Cookie Last-Modified: Thu, 09 Feb 2012 14:50:27 GMT Location: http://my-server.se:8000/admin/cms/page/15/ Cache-Control: max-age=0 Content-Type: text/html; charset=utf-8 Set-Cookie: messages="yada yada yada"; Path=/ Nginx: HTTP/1.1 500 INTERNAL SERVER ERROR Server: nginx/0.7.67 Date: Thu, 09 Feb 2012 14:50:57 GMT Content-Type: text/html; charset=utf-8 Transfer-Encoding: chunked Connection: close Vary: Cookie 500 UPDATE: Both locale.getpreferredencoding() and sys.getfilesystemencoding() outputs 'UTF-8'. locale.getdefaultlocale() outputs ('sv_SE', 'UTF8'). This seem correct to me, so I'm still not sure why I keep getting these errors.

    Read the article

  • Permissions problems with Apache / SVN

    - by Fred Wuerges
    I am installed a SVN server (v1.6) on a VPS contracted with CentOS 5, Apache 2.2 with WHM panel. I installed and configured all necessary modules and am able to create and access repositories via my web browser normally. The problem: I can not commit or import anything, always return permission errors: First error: Can not open file '/var/www/svn/test/db/txn-current-lock': Permission denied After fix the previous error: Can't open '/var/www/svn/test/db/tempfile.tmp': Permission denied And other... (and happends many others) Can't open file '/var/www/svn/test/db/txn-protorevs/0-1m.rev': Permission denied I've read and executed permissions on numerous tutorials regarding this errors, all without success. I've defined the owner as apache or nobody and different permissions for folders and files. I'm using TortoiseSVN to connect to the server. Some information that may find useful: I'm trying to perform commit through an external HTTP connection, like: svn commit http://example.com/svn/test SELinux is disabled. sestatus returns SELinux status: disabled Running the command to see the active processes of Apache, some processes are left with user/group "nobody". I tried changing the settings of Apache to not run with that user/group, but all my websites stopped working, returning this error: Forbidden You don't have permission to access / on this server. Additionally, a 403 Forbidden error was encountered while trying to use an ErrorDocument to handle the request. Apache process list: root@vps [/var/www]# ps aux | egrep '(apache|httpd)' root 19904 0.0 4.4 133972 35056 ? Ss 16:58 0:00 /usr/local/apache/bin/httpd -k start -DSSL nobody 20401 0.0 3.5 133972 27772 ? S 17:01 0:00 /usr/local/apache/bin/httpd -k start -DSSL root 20409 0.0 3.4 133972 27112 ? S 17:01 0:00 /usr/local/apache/bin/httpd -k start -DSSL nobody 20410 0.0 3.8 190040 30412 ? Sl 17:01 0:00 /usr/local/apache/bin/httpd -k start -DSSL nobody 20412 0.0 3.9 190344 30944 ? Sl 17:01 0:00 /usr/local/apache/bin/httpd -k start -DSSL nobody 20414 0.0 4.4 190160 35364 ? Sl 17:01 0:00 /usr/local/apache/bin/httpd -k start -DSSL nobody 20416 0.0 4.0 190980 32108 ? Sl 17:01 0:00 /usr/local/apache/bin/httpd -k start -DSSL nobody 20418 0.3 5.3 263028 42328 ? Sl 17:01 0:12 /usr/local/apache/bin/httpd -k start -DSSL root 32409 0.0 0.1 7212 816 pts/0 R+ 17:54 0:00 egrep (apache|httpd) SVN folder permission var/www/: drwxrwxr-x 3 apache apache 4096 Dec 11 16:41 svn/ Repository permission var/www/svn/: drwxrwxr-x 6 apache apache 4096 Dec 11 16:41 test/ Internal folders of repository var/www/svn/test: drwxrwxr-x 2 apache apache 4096 Dec 11 16:41 conf/ drwxrwxr-x 6 apache apache 4096 Dec 11 16:41 db/ -rwxrwxr-x 1 apache apache 2 Dec 11 16:41 format* drwxrwxr-x 2 apache apache 4096 Dec 11 16:41 hooks/ drwxrwxr-x 2 apache apache 4096 Dec 11 16:41 locks/ -rwxrwxr-x 1 apache apache 229 Dec 11 16:41 README.txt*

    Read the article

  • How to prevent ssh git push to set file ownership?

    - by e-satis
    I have a remote bare git repository on an Ubuntu server, where the file are owned by the user my_project and the group my_project, with permissions set accordingly. All commiters are themself in the group my_project. When somebody commit then push from my Ubuntu laptop with the user my_user to the server via SSH, some files in the remote repository are created (updated?) so they now belong to the user and group my_user. Of course, when somebody else want to commit, he is now unable to do so because he doesn't have write permissions. I could set permission to 777 but it's not the best option. Is there any way I can solve this problem while keeping restricted write permissions.

    Read the article

  • Git Daemon on linux?

    - by bwawok
    Trying to set up a simple git-daemon on a linux server, and talk to it from a windows box. On linux server: Make a folder /home/foo/bar CD to /home/foo/bar do a git --bare init here Do a touch git-daemon-export-ok CD to /home/foo Run the command git-daemon --verbose --reuseaddr --base-path=/home/foo --enable=receive-pack On Windows Client w tortoise Git Do git.exe clone --progress -v "git://servername/bar" "C:\source\myFolderName" (works) Create file a.txt, add it to git, and commit (works) Do a git.exe pull "origin" master and then get fatal: Couldn't find remote ref master (makes sense, master isn't there yet) Do a git.exe push "origin" master:master and tortoise hangs forever without do anything I realize why I can't pull from master yet on the remote branch.. but why can't I push my first commit into the remote repo? #4 really should work. Tried it both with tortoise and the mysysgit command line, both cases I hang forever. What am I missing? Server has no useful log

    Read the article

  • Git Daemon on linux?

    - by bwawok
    Trying to set up a simple git-daemon on a linux server, and talk to it from a windows box. On linux server: Make a folder /home/foo/bar CD to /home/foo/bar do a git --bare init here Do a touch git-daemon-export-ok CD to /home/foo Run the command git-daemon --verbose --reuseaddr --base-path=/home/foo --enable=receive-pack On Windows Client w tortoise Git Do git.exe clone --progress -v "git://servername/bar" "C:\source\myFolderName" (works) Create file a.txt, add it to git, and commit (works) Do a git.exe pull "origin" master and then get fatal: Couldn't find remote ref master (makes sense, master isn't there yet) Do a git.exe push "origin" master:master and tortoise hangs forever without do anything I realize why I can't pull from master yet on the remote branch.. but why can't I push my first commit into the remote repo? #4 really should work. Tried it both with tortoise and the mysysgit command line, both cases I hang forever. What am I missing? Server has no useful log

    Read the article

  • iptables blocking ssh communication

    - by Michal Sapsa
    I'm using this script for iptables: #!/bin/sh echo "1" > /proc/sys/net/ipv4/ip_forward iptables -F iptables -X iptables -F -t nat iptables -X -t nat iptables -F -t filter iptables -X -t filter iptables -t filter -P FORWARD DROP iptables -t filter -A FORWARD -s 192.168.0.0/255.255.0.0 -d 0/0 -j ACCEPT iptables -t filter -A FORWARD -s 0/0 -d 192.168.0.0/255.255.0.0 -j ACCEPT iptables -t nat -A POSTROUTING -s 10.8.0.1/255.255.255.0 -j MASQUERADE iptables -A FORWARD -s 10.8.0.1/255.255.255.0 -j ACCEPT iptables -t nat -A POSTROUTING -s 192.168.0.0/24 -d 0/0 -j MASQUERADE iptables -I FORWARD -p tcp --tcp-flags SYN,RST SYN -j TCPMSS --clamp-mss-to-pmtu iptables -t nat -A PREROUTING -i eth1 -p udp --dport 16161 -j DNAT --to 192.168.0.251:16161 iptables -t nat -A PREROUTING -i eth1 -p udp --sport 16161 -j DNAT --to 192.168.0.251:16161 #openvpn iptables -I INPUT -p tcp --dport 1194 -j ACCEPT iptables -I INPUT -p udp --dport 1194 -j ACCEPT I end up with some iptables rules that should work but don't work - probably because of me. # Generated by iptables-save v1.4.12 on Mon May 26 13:15:43 2014 *raw :PREROUTING ACCEPT [1657523:1357257330] :OUTPUT ACCEPT [36804:34834370] -A PREROUTING -p icmp -j TRACE -A PREROUTING -p tcp -j TRACE -A OUTPUT -p icmp -j TRACE -A OUTPUT -p tcp -j TRACE COMMIT # Completed on Mon May 26 13:15:43 2014 # Generated by iptables-save v1.4.12 on Mon May 26 13:15:43 2014 *nat :PREROUTING ACCEPT [5033:345623] :INPUT ACCEPT [154:34662] :OUTPUT ACCEPT [6:1968] :POSTROUTING ACCEPT [2:120] -A PREROUTING -i eth0 -p tcp -m tcp --dport 16161 -j DNAT --to-destination 192.168.0.251:22 -A PREROUTING -i eth1 -p tcp -m tcp --dport 16161 -j DNAT --to-destination 192.168.0.251:22 -A POSTROUTING -s 10.8.0.0/24 -j MASQUERADE -A POSTROUTING -s 192.168.0.0/24 -j MASQUERADE COMMIT # Completed on Mon May 26 13:15:44 2014 # Generated by iptables-save v1.4.12 on Mon May 26 13:15:44 2014 *filter :INPUT ACCEPT [548:69692] :FORWARD DROP [8:384] :OUTPUT ACCEPT [2120:1097479] -A INPUT -p udp -m udp --dport 1194 -j ACCEPT -A INPUT -p tcp -m tcp --dport 1194 -j ACCEPT -A FORWARD -p tcp -m tcp --tcp-flags SYN,RST SYN -j TCPMSS --clamp-mss-to-pmtu -A FORWARD -s 192.168.0.0/16 -j ACCEPT -A FORWARD -d 192.168.0.0/16 -j ACCEPT -A FORWARD -s 10.8.0.0/24 -j ACCEPT -A FORWARD -i eth0 -o eth1 -p tcp -m tcp --dport 22 -j ACCEPT -A FORWARD -i eth1 -o eth0 -p tcp -m tcp --dport 22 -j ACCEPT COMMIT TRACE at PREROUTEING AND OUTPUT are only for debuging this thing. When I ssh at public ip with port 16161 I don't get any message, only TimeOut so it looks like I don't get communication back to remote server. ETH0 is the world, ETH1 is LAN Any IPTABLES Masters willing to give a hand ? iptables -vL Chain INPUT (policy ACCEPT 20548 packets, 3198K bytes) pkts bytes target prot opt in out source destination 38822 7014K ACCEPT udp -- any any anywhere anywhere udp dpt:openvpn 0 0 ACCEPT tcp -- any any anywhere anywhere tcp dpt:openvpn Chain FORWARD (policy DROP 1129 packets, 64390 bytes) pkts bytes target prot opt in out source destination 214K 11M TCPMSS tcp -- any any anywhere anywhere tcpflags: SYN,RST/SYN TCPMSS clamp to PMTU 4565K 1090M ACCEPT all -- any any 192.168.0.0/16 anywhere 5916K 7315M ACCEPT all -- any any anywhere 192.168.0.0/16 0 0 ACCEPT all -- any any 10.8.0.0/24 anywhere 0 0 ACCEPT tcp -- any any anywhere 192.168.0.251 tcp dpt:16161 Chain OUTPUT (policy ACCEPT 59462 packets, 19M bytes) pkts bytes target prot opt in out source destination

    Read the article

  • RHEL Cluster FAIL after changing time on system

    - by Eugene S
    I've encountered a strange issue. I had to change the time on my Linux RHEL cluster system. I've done it using the following command from the root user: date +%T -s "10:13:13" After doing this, some message appeared relating to <emerg> #1: Quorum Dissolved however I didn't capture it completely. In order to investigate the issue I looked at /var/log/messages and I've discovered the following: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] entering GATHER state from 0. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] Creating commit token because I am the rep. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] Storing new sequence id for ring 354 Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] entering COMMIT state. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] entering RECOVERY state. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] position [0] member 192.168.1.49: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] previous ring seq 848 rep 192.168.1.49 Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] aru 61 high delivered 61 received flag 1 Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] Did not need to originate any messages in recovery. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] Sending initial ORF token Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] CLM CONFIGURATION CHANGE Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] New Configuration: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] #011r(0) ip(192.168.1.49) Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] Members Left: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] #011r(0) ip(192.168.1.51) Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] Members Joined: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CMAN ] quorum lost, blocking activity Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] CLM CONFIGURATION CHANGE Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] New Configuration: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] #011r(0) ip(192.168.1.49) Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] Members Left: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] Members Joined: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [SYNC ] This node is within the primary component and will provide service. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] entering OPERATIONAL state. Mar 22 16:40:42 hsmsc50sfe1a kernel: dlm: closing connection to node 2 Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] got nodejoin message 192.168.1.49 Mar 22 16:40:42 hsmsc50sfe1a clurgmgrd[25809]: <emerg> #1: Quorum Dissolved Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CPG ] got joinlist message from node 1 Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Cluster is not quorate. Refusing connection. Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Error while processing connect: Connection refused Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Invalid descriptor specified (-21). Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Someone may be attempting something evil. Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Error while processing disconnect: Invalid request descriptor Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] entering GATHER state from 9. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] Creating commit token because I am the rep. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] Storing new sequence id for ring 358 Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] entering COMMIT state. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] entering RECOVERY state. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] position [0] member 192.168.1.49: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] previous ring seq 852 rep 192.168.1.49 Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] aru f high delivered f received flag 1 Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] position [1] member 192.168.1.51: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] previous ring seq 852 rep 192.168.1.51 Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] aru f high delivered f received flag 1 Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] Did not need to originate any messages in recovery. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] Sending initial ORF token Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] CLM CONFIGURATION CHANGE Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] New Configuration: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] #011r(0) ip(192.168.1.49) Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] Members Left: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] Members Joined: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] CLM CONFIGURATION CHANGE Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] New Configuration: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] #011r(0) ip(192.168.1.49) Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] #011r(0) ip(192.168.1.51) Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] Members Left: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] Members Joined: Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] #011r(0) ip(192.168.1.51) Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [SYNC ] This node is within the primary component and will provide service. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [TOTEM] entering OPERATIONAL state. Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [MAIN ] Node chb_sfe2a not joined to cman because it has existing state Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] got nodejoin message 192.168.1.49 Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CLM ] got nodejoin message 192.168.1.51 Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CPG ] got joinlist message from node 1 Mar 22 16:40:42 hsmsc50sfe1a openais[25715]: [CPG ] got joinlist message from node 2 Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Cluster is not quorate. Refusing connection. Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Error while processing connect: Connection refused Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Invalid descriptor specified (-111). Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Someone may be attempting something evil. Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Error while processing get: Invalid request descriptor Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Invalid descriptor specified (-21). Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Someone may be attempting something evil. Mar 22 16:40:42 hsmsc50sfe1a ccsd[25705]: Error while processing disconnect: Invalid request descriptor How could this be related to the time change procedure I performed?

    Read the article

  • Attempting to caue packet loss with netem doesn't work - possibly because of NAT (but delay does work)

    - by tomdee
    I have traffic from a WIFI access point routed via an Ubuntu box. I have two network interfaces which are NATed *filter :INPUT ACCEPT [11:690] :FORWARD ACCEPT [0:0] :OUTPUT ACCEPT [37:6224] -A FORWARD -s 192.168.2.0/24 -i eth1 -o eth0 -m conntrack --ctstate NEW -j ACCEPT -A FORWARD -m conntrack --ctstate RELATED,ESTABLISHED -j ACCEPT COMMIT # Completed on Thu Mar 15 13:37:21 2012 # Generated by iptables-save v1.4.10 on Thu Mar 15 13:37:21 2012 *nat :PREROUTING ACCEPT [0:0] :INPUT ACCEPT [0:0] :OUTPUT ACCEPT [0:0] :POSTROUTING ACCEPT [0:0] -A POSTROUTING -j MASQUERADE COMMIT If I run a ping app on an Android device connected to the WIFI network I can happily ping google. If I use netem to introduce some delay tc qdisc change dev eth0 root netem delay 100ms I can clearly see pings taking longer. If I use netem to introduce some packet loss tc qdisc change dev ifb0 root netem loss 50% then I see no change. Packet loss does work fine for locally generated traffic, just not for traffic coming in over the network that's being NATed. Any ideas how to sort this out?

    Read the article

< Previous Page | 61 62 63 64 65 66 67 68 69 70 71 72  | Next Page >