Search Results

Search found 48797 results on 1952 pages for 'read write'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 657/1952 | < Previous Page | 653 654 655 656 657 658 659 660 661 662 663 664  | Next Page >

  • How to detect if 2 news articles have the same topic? (Python language-comparison)

    - by resopollution
    I'm looking for ideas on recommended approach. I'm trying to scrape some headlines and body text from articles for a few specific sites, similar to what Google does with Google News. The problem is across different sites, they may have articles on the same exact subject, worded slightly differently. Can anyone point to me what I need to know in order to write a comparison algorithm to auto-detect similar articles? Thanks very much in advance. I use Python.

    Read the article

  • python programme.

    - by siva
    hi, i am siva this is frist time taken the python programming language i have a small problem please help me the question is **Write two functions, called countSubStringMatch and countSubStringMatchRecursive that take two arguments, a key string and a target string. These functions iteratively and recursively count the number of instances of the key in the target string. You should complete definitions for def countSubStringMatch(target,key): and def countSubStringMatchRecursive (target, key): **

    Read the article

  • NSMutableArray & Multiple Views

    - by Antonio
    I am trying to write an application that has a NSMutableArray that needs to be accessed and modified in a different View. The MainViewController displays a table that gets the information from an NSMutableArray. The SecondaryViewController is used to addObjects into the array. How do I go about this without declaring it as a global variable?

    Read the article

  • upsert with addition

    - by cf_PhillipSenn
    How would you write the following in Microsoft SQL Server 2008? IF EXISTS(SELECT * FROM Table WHERE Something=1000) UPDATE Table SET Qty = Qty + 1 WHERE Something=1000 ELSE INSERT INTO Table(Something,Qty) VALUES(1000,1)

    Read the article

  • Complex SQL query with group by and two rows in one

    - by Ricket
    Okay, I need help. I'm usually pretty good at SQL queries but this one baffles me. By the way, this is not a homework assignment, it's a real situation in an Access database and I've written the requirements below myself. Here is my table layout. It's in Access 2007 if that matters; I'm writing the query using SQL. Id (primary key) PersonID (foreign key) EventDate NumberOfCredits SuperCredits (boolean) There are events that people go to. They can earn normal credits, or super credits, or both at one event. The SuperCredits column is true if the row represents a number of super credits earned at the event, or false if it represents normal credits. So for example, if there is an event which person 174 attends, and they earn 3 normal credits and 1 super credit at the event, the following two rows would be added to the table: ID PersonID EventDate NumberOfCredits SuperCredits 1 174 1/1/2010 3 false 2 174 1/1/2010 1 true It is also possible that the person could have done two separate things at the event, so there might be more than two columns for one event, and it might look like this: ID PersonID EventDate NumberOfCredits SuperCredits 1 174 1/1/2010 1 false 2 174 1/1/2010 2 false 3 174 1/1/2010 1 true Now we want to print out a report. Here will be the columns of the report: PersonID LastEventDate NumberOfNormalCredits NumberOfSuperCredits The report will have one row per person. The row will show the latest event that the person attended, and the normal and super credits that the person earned at that event. What I am asking of you is to write, or help me write, the SQL query to SELECT the data and GROUP BY and SUM() and whatnot. Or, let me know if this is for some reason not possible, and how to organize my data to make it possible. This is extremely confusing and I understand if you do not take the time to puzzle through it. I've tried to simplify it as much as possible, but definitely ask any questions if you give it a shot and need clarification. I'll be trying to figure it out but I'm having a real hard time with it, this is grouping beyond my experience...

    Read the article

  • How to generate a report for particular XHTML tag/attributes ?

    - by jitendra
    I wan to check whole site's image's ALT text. I want to get a report of What is written in all text or ALT is defined or not from all images being used on whole site in every page. Is it possible to get report like this. after getting report i will put ALT or is ALT is already added but blank then will write description text. Other in a big site it will take huge time to go and check each page

    Read the article

  • Generate Javadoc for interfaces only?

    - by ipkiss
    Hi, I am finding a way to write a script that I can generate javadoc for my program's Interfaces only (not for public classes). I have tried Eclipse built-in tool and even JAutodoc tool but have not been successful yet. Does anyone have some ideas, please? Thanks.

    Read the article

  • how to search some character inside string

    - by klox
    i have been type some string inside textfield that is "KD-G435MUN2D"... i already use this code for search "UD" character from that string: <script> var str="KD-R435MUN2D"; var patt1=/UD/gi; document.write(str.match(patt1)); </script> but this code doesn't work..where is my fault?

    Read the article

  • Exit SSH from the script

    - by Kimi
    I Want to exit ssh: Does the below line work: ssh -f -T ${USAGE_2_USER}@${USAGE_2_HOST} Or do i need to write it some other way . Please tell should I use exit with ssh an how?

    Read the article

  • C puzzle: Output of printf should be '5' always

    - by pragadheesh
    Hi, I found this puzzle in a C aptitude paper. void change() { //write something in this function so that output of printf in main function //should always give 5.you can't change the main function } int main() { int i = 5; change(); i = 10; printf("%d", i); return 0; } Any solutions.?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Javascript + Pretty Print JSON

    - by FlySwat
    I'm looking for a jQuery plugin or a standalone script that will take a javascript object and create a navigatable tree like the FireBug plug in does. Does this exist, or will I need to write one? Googling hasn't found much yet.

    Read the article

  • count of paths from A[a,b] to A[c,d] without duplicating?

    - by Sorush Rabiee
    I write a sokoban solver for fun and practice, it uses a simple algorithm (something like BFS). now i want to estimate its running time ( O and omega). but i need to know how to calculate count of paths from a vertex to another in a network. each path from a to b is a sequence of edges with no circuit. for example this is a correct path: http://www.imgplace.com/viewimg143/4789/501k.png but this is not: http://www.imgplace.com/viewimg143/6140/202.png

    Read the article

  • What characters are allowed in ClearCase activity name?

    - by Dmitry
    I want to write script for internal issue tracking system, integrated with ClearCase, that checks activity name (typed by user) for illegal characters. Unfortunatly, I can't find list of characters, allowed by ClearCase. Does anybody know where to get it? UPD: I'm looking for a link to a document, that specifies the allowed characters (or says that all characters are allowed).

    Read the article

  • Parsing external XML file with C#, what's the most aesthetic way?

    - by Itay
    Hi, say there is an xml file, which not created by me, with a known schema (for example, rss). how would you parse it with C#? would you do that manually by XDocument etc, or would you use XMLSerializer and create a correspond class? or would you use Visual Studio tools to generate classes using a dtd file (that you'll write). what do you think the most aesthetic, easy, not error-prone way?

    Read the article

  • Can I use @table variable in SQL Server Report Builder?

    - by edosoft
    Using MS SQL 2008 Reporting services: I'm trying to write a report that displays some correlated data so I thought to use a @table variable like so DECLARE @Results TABLE (Number int, Name nvarchar(250), Total1 money, Total2 money) insert into @Results(Number, Name, Total1) select number, name, sum(total) from table1 group by number, name update @Results set total2 = total from (select number, sum(total) from table2) s where s.number = number select from @results However, Report Builder keeps asking to enter a value for the variable @Results. It this at all possible?

    Read the article

  • Convert multiple eml files to single PST in C#

    - by Ayesha
    I need to write a single function which will take multiple eml files ( may be from a single filesystem folder ) and convert them to a single PST file. Is it possible? if yes can someone provide a sample code? I assume its possible because there are many commercial eml to pst converters out there doing this

    Read the article

  • How do you rotate a two dimensional array?

    - by swilliams
    Inspired by Raymond Chen's post, say you have a 4x4 two dimensional array, write a function that rotates it 90 degrees. Raymond links to a solution in pseudo code, but I'd like to see some real world stuff. [1][2][3][4] [5][6][7][8] [9][0][1][2] [3][4][5][6] Becomes: [3][9][5][1] [4][0][6][2] [5][1][7][3] [6][2][8][4] Update: Nick's answer is the most straightforward, but is there a way to do it better than n^2? What if the matrix was 10000x10000?

    Read the article

  • what's the way to determine if an Int a perfect square in Haskell?

    - by valya
    I need a simple function is_square :: Int -> Bool which determines if an Int N a perfect square (is there an integer x such that x*x = N). Of course I can just write something like is_square n = sq * sq == n where sq = floor $ sqrt $ (fromIntegral n::Double) but it looks terrible! Maybe there is a common simple way to implement such predicate?

    Read the article

  • Found % character in a SQL query

    - by Jensen
    Hi, I've an SQL database and I would like to do a query who show all the datas containing the sign "%". Normally, to find a character (for example: "z") in a database I use a query like this : mysql_query("SELECT * FROM mytable WHERE tag LIKE '%z%'"); But here, I want to found the % character, but in SQL it's a joker so when I write: mysql_query("SELECT * FROM mytable WHERE tag LIKE '%%%'"); It show me all my datas. So how to found the % character in my SQL datas ? Thanks

    Read the article

  • Exporting SQL Server Databases for offline use

    - by WedTM
    I have a desktop application (C# .NET 3.5) that uses a SQL server for it's database. I have had a request from the client, however, to make it possible to export the database as it stands, and be able to use it on a laptop without connectivity. They understand that updates to the parent server will not be reflected in these offline clients. Is there a way I can just save the DataSet's to a binary form and write them to a disk and send those files to the offline clients.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 653 654 655 656 657 658 659 660 661 662 663 664  | Next Page >