Search Results

Search found 17924 results on 717 pages for 'z order'.

Page 664/717 | < Previous Page | 660 661 662 663 664 665 666 667 668 669 670 671  | Next Page >

  • Cannot work for 2nd iteration because of writing delay.

    - by karikari
    My code's IF-THEN does not work for 2nd iteration. This is due to, the jar processing take some time to write it result inside the output.txt. Since the writing is a bit late, my code's 2nd iteration will always read the previous written value inside the output.txt in order to pass it to the IF-THEN. For example, in 1st iteration: output.txt -- 0.9888 twrite.txt -- msg: ok 2nd iteration: output.txt -- 0.5555 twrite.txt -- msg: ok //the IF-THEN still gives this result which is based on previous iteration. it should be msg: not ok . since it is < 0.7 I need help, how to solve this 'delay' problem? HRESULT CButtonDemoBHO::onDocumentComplete(IDispatch *pDisp, VARIANT *vUrl){ ATLTRACE("CButtonDemoBHO::onDocumentComplete %S\n", vUrl->bstrVal); WinHttpClient client(vUrl->bstrVal); client.SendHttpRequest(); wstring httpResponseHeader = client.GetHttpResponseHeader(); wstring httpResponse = client.GetHttpResponse(); writeToLog(httpResponse.c_str()); if (isMainFrame(pDisp)){ m_normalPageLoad=false; FILE *child = _popen("javaw -jar c:\\simmetrics.jar c:\\chtml.txt c:\\thtml.txt > c:\\output.txt", "r"); fclose(child); char readnumber[10]; float f = 0; FILE *file11 = fopen("c:\\output.txt","r"); char* p = fgets(readnumber,10,file11); std::istringstream iss(p); iss >> f; if (f > 0.7) { wfstream file12 ("c:\\twrite.txt", ios_base::out); file12 << "Msg: ok"; file12.close(); } else { wfstream file12 ("c:\\twrite.txt", ios_base::out); file12 << "Msg: not ok"; file12.close(); } iss.clear(); fclose(file11); return S_OK; } return S_OK; }

    Read the article

  • Sandbox "Sorry — your last action could not be completed"

    - by aron
    My site was working fine with PayPal's sandbox, and then all of a sudden it stopped. Now I get the wonderful error Sandbox "Sorry — your last action could not be completed" This is my HTML: <body onload="document.Paypal.submit();"> <!-- item_number should get passed back --> <form name="Paypal" method="post" action="https://www.sandbox.paypal.com cgi-bin/webscr" id="Paypal"> <div> <input type="hidden" name="__VIEWSTATE" id="__VIEWSTATE" value="/wEPDwUKLTkyNTEyNzc0NGRk0LKGvSMTla6LgHpbOsdk7iC0iXE=" /> </div> <div> <input type="hidden" name="__EVENTVALIDATION" id="__EVENTVALIDATION" value="/wEWCALKhatPArLPtrsEAreImG4CweeH+AkCgMPhowcC+NaM4gQC+Y2VqwoCouzSnwEVXI9UvQxqI2UcdQ4SmcSWqfEZNw==" /> </div> <input type="hidden" name="cmd" value="_cart" /> <input type="hidden" name="upload" value="1" /> <!-- The following is for itemized PayPal data instead of the aggregated version --> <input type="hidden" name="item_name_1" value="LEADING SKILLS 4/10/2012 6:00 PM Section: Members " /> <input type="hidden" name="amount_1" value="250.00" /> <input type="hidden" name="quantity_1" value="2" /> <input type="hidden" name="handling_cart" value="7.00" /> <input type="hidden" name="tax_cart" value="35.00" /> <!-- STANDARD DATA --> <input name="business" type="hidden" id="business" value="[email protected]" /> <input name="invoice" type="hidden" id="invoice" value="TS-1E8B59A0-B" /> <input type="hidden" name="no_note" value="0" /> <input name="currency_code" type="hidden" id="currency_code" value="USD" /> <input name="shipCountry" type="hidden" id="shipCountry" /> <input type="hidden" name="return" value="http://rockclimbing.venueblue.com/Gateway/paypal/Complete.aspx?id=db86c0bf-beb8-4e37-b495-bed1d3e7e6f3" /> <input name="cancel_returnUrl" type="hidden" id="cancel_returnUrl" value="http://rockclimbing.venueblue.com/ShoppingCart.aspx" /> <input type="hidden" name="cn" value="How did you hear about us?" /> <input name="custom" type="hidden" id="custom" value="db86c0bf-beb8-4e37-b495-bed1d3e7e6f3" /> <input name="notify_url" type="hidden" id="notify_url" value="http://rockclimbing.venueblue.com/Gateway/Paypal/IPN.aspx" /> <input type="submit" value="Submit Payment Info" style="display:none;" /> Processing Order.... </form> </body> Anyone have a clue what happened?

    Read the article

  • shipping and handling fee calculation

    - by Newb
    Here is the question: Many companies normally charge a shipping and handling fee for purchases. Create a Web page that allows a user to enter a purchase price into a text box - include a JavaScript function that calculates shipping and handling. Add functionality to the script that adds a minimum shipping and handling fee of $1.50 for any purchase that is less than or equal to $25.00. For any orders over $25.00, add 10% to the total purchase price for shipping and handling, but do not include the $1.50 minimum shipping and handling fee. After you determine the total cost of the order (purchase plus shipping and handling), display it in an alert dialog box. I am beginner at JavaScript and struggling to get my code to work. It does display an alert box with the value entered by the user but doesn't add anything. Although, I don't know why the formula doesn't work. Please help. <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Calculating Shipping & Handling</title> <script type="text/javascript"> /* <![CDATA[ */ var price=[]; var shipping=[]; var total=price+shipping; function calculateShipping(){ if (price <= 25){ shipping = (price + 1.5); } else { shipping = (price * 10 / 100); } window.alert("The purchase price with shipping is " + document.calculate.ent.value); } /* ]]> */ </script> </head> <body> <form name ="calculate" action="" > <p>Enter Purchase Price</p> <input type="text" name="ent" > <input type="button" name="button" value="Submit" onClick="calculateShipping()" /> </form> </body> </html>

    Read the article

  • can this code be broken?

    - by user105165
    Consider the below html string <p>This is a paragraph tag</p> <font>This is a font tag</font> <div>This is a div tag</div> <span>This is a span tag</span> This string is processed to tokanize the text found in it and we get 2 results as below 1) Token Array : $tokenArray == array( 'This is a paragraph tag', 'This is a div tag', '<font>This is a font tag</font>', '<span>This is a span tag</span>' ); 2) Tokenized template : $templateString == "<p>{0}</p>{2}<div>{1}</div>{3}"; If you observe, the sequence of the text strings segments from the original HTML strings is different from the tokenized template The PHP code below is used to order the tokenized template and accordingly the token array to match the original html string class CreateTemplates { public static $tokenArray = array(); public static $tokenArrayNew = array(); function foo($templateString,$tokenArray) { CreateTemplates::$tokenArray = $tokenArray; $ptn = "/{[0-9]*}*/"; // Search Pattern from the template string $templateString = preg_replace_callback($ptn,array(&$this, 'callbackhandler') ,$templateString); // function call return $templateString; } // Function defination private static function callbackhandler($matches) { static $newArr = array(); static $cnt; $tokenArray = CreateTemplates::$tokenArray; array_push($newArr, $matches[0]); CreateTemplates::$tokenArrayNew[count($newArr)] = $tokenArray[substr($matches[0],1,(strlen($matches[0])-2))]; $cnt = count($newArr)-1; return '{'.$cnt.'}'; } // function ends } // class ends Final output is (ordered template and token array) $tokenArray == array('This is a paragraph tag', '<font>This is a font tag</font>', 'This is a div tag', '<span>This is a span tag</span>' ); $templateString == "<p>{0}</p>{1}<div>{2}</div>{3}"; Which is the expected result. Now, I am not confident whether this is the right way to achieve this. I want to see how this code can be broken or not. Under what conditions will this code break? (important) Is there any other way to achieve this? (less important)

    Read the article

  • Specifying a Single Request To Use Credentials with HttpClient

    - by jiduvah
    I am using OAuth2 on my android project. The idea is to use a singleton HttpClient used with a ThreadSafeClientConnManager. For a normal request to the server we construct an Authorization header and send that. The header is constructed from values received from the server. This works fine. However every 15 minutes we must get new values from the server to construct the header. To Received these values I must set the credentials like so. client.getCredentialsProvider().setCredentials( new AuthScope(AuthScope.ANY_HOST, AuthScope.ANY_PORT), new UsernamePasswordCredentials(creds.clientId, creds.clientSecret)); In order for this to work I must set up and new DefaultHttpClient. If I use the original singleton httpclient I receive some errors. My question is.. is it possible to set the credentials to be used only on this one request? I noticed that there is an AuthScope. The host and port would not be suitable for this but maybe the realm would? I can't find anything that tells me what a realm is or how to use it. 06-05 10:12:55.969: W/System.err(23843): org.apache.http.NoHttpResponseException: The target server failed to respond 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.conn.DefaultResponseParser.parseHead(DefaultResponseParser.java:85) 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.io.AbstractMessageParser.parse(AbstractMessageParser.java:174) 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.AbstractHttpClientConnection.receiveResponseHeader(AbstractHttpClientConnection.java:179) 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.conn.DefaultClientConnection.receiveResponseHeader(DefaultClientConnection.java:235) 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.conn.AbstractClientConnAdapter.receiveResponseHeader(AbstractClientConnAdapter.java:259) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.protocol.HttpRequestExecutor.doReceiveResponse(HttpRequestExecutor.java:279) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.protocol.HttpRequestExecutor.execute(HttpRequestExecutor.java:121) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.impl.client.DefaultRequestDirector.execute(DefaultRequestDirector.java:504) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:555) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:487) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:465) So After more testing I have found where the problem lies. I want to configure a pooled connection manager like so SchemeRegistry schemeRegistry = new SchemeRegistry(); schemeRegistry.register( new Scheme("http", PlainSocketFactory.getSocketFactory(), 80)); schemeRegistry.register( new Scheme("https", PlainSocketFactory.getSocketFactory(), 443)); ClientConnectionManager conManager = new ThreadSafeClientConnManager(new BasicHttpParams(), schemeRegistry); DefaultHttpClient httpClient = new DefaultHttpClient(); But when configure like this, I get the error above. If I use the normal default httpclient like so DefaultHttpClient httpClient = new DefaultHttpClient(); Then it works fine. Any ideas?

    Read the article

  • IPhone Development Profile Expired

    - by theiphoneguy
    I really combed this site and others. I read and re-read the related links here and the Apple docs. I'm sorry, but either I am obviously missing something right under my nose, or this Apple profile/certificate stuff is a bit convoluted. Here it is: I have a product in the App Store. I have updated it several times and users like it. My development profile recently expired just when I was improving the app for its next release. I can run the app in the simulator. I can compile and put the distribution build on my iPhone just fine. I went to the Apple portal and renewed the development profile. I downloaded it and installed it in Xcode. I see it in the Organize window. I see it on my iPhone. I CANNOT put the debug build on my iPhone to debug or run with Instruments. The message is that either there is not a valid signed profile or it is untrusted. I subsequently tried to download and install the certificate to my Mac's keychain. Still no success. I checked the code signing section of Project settings and also for the target and the root. All appears to indicate that it is using the expected development profile for debug. Yes, I had deleted the old profile from my iPhone, from the Organizer. I cleaned the Xcode cache and all targets. I have done all of this several times and in varying sequences to try to cover every possibility. I am ready to do anything to be able to debug with Instruments in order to check for leaks or high memory usage. Even though the distribution compile runs fine on my iPhone and plays well with other running processes, I will not release anything without a leaks/memory test. Any ideas will be appreciated. If I missed something obvious, please forgive me - it was not due to just posting a question without searching for similar postings. Thanks!

    Read the article

  • How does Sentry aggregate errors?

    - by Hugo Rodger-Brown
    I am using Sentry (in a django project), and I'd like to know how I can get the errors to aggregate properly. I am logging certain user actions as errors, so there is no underlying system exception, and am using the culprit attribute to set a friendly error name. The message is templated, and contains a common message ("User 'x' was unable to perform action because 'y'"), but is never exactly the same (different users, different conditions). Sentry clearly uses some set of attributes under the hood to determine whether to aggregate errors as the same exception, but despite having looked through the code, I can't work out how. Can anyone short-cut my having to dig further into the code and tell me what properties I need to set in order to manage aggregation as I would like? [UPDATE 1: event grouping] This line appears in sentry.models.Group: class Group(MessageBase): """ Aggregated message which summarizes a set of Events. """ ... class Meta: unique_together = (('project', 'logger', 'culprit', 'checksum'),) ... Which makes sense - project, logger and culprit I am setting at the moment - the problem is checksum. I will investigate further, however 'checksum' suggests that binary equivalence, which is never going to work - it must be possible to group instances of the same exception, with differenct attributes? [UPDATE 2: event checksums] The event checksum comes from the sentry.manager.get_checksum_from_event method: def get_checksum_from_event(event): for interface in event.interfaces.itervalues(): result = interface.get_hash() if result: hash = hashlib.md5() for r in result: hash.update(to_string(r)) return hash.hexdigest() return hashlib.md5(to_string(event.message)).hexdigest() Next stop - where do the event interfaces come from? [UPDATE 3: event interfaces] I have worked out that interfaces refer to the standard mechanism for describing data passed into sentry events, and that I am using the standard sentry.interfaces.Message and sentry.interfaces.User interfaces. Both of these will contain different data depending on the exception instance - and so a checksum will never match. Is there any way that I can exclude these from the checksum calculation? (Or at least the User interface value, as that has to be different - the Message interface value I could standardise.) [UPDATE 4: solution] Here are the two get_hash functions for the Message and User interfaces respectively: # sentry.interfaces.Message def get_hash(self): return [self.message] # sentry.interfaces.User def get_hash(self): return [] Looking at these two, only the Message.get_hash interface will return a value that is picked up by the get_checksum_for_event method, and so this is the one that will be returned (hashed etc.) The net effect of this is that the the checksum is evaluated on the message alone - which in theory means that I can standardise the message and keep the user definition unique. I've answered my own question here, but hopefully my investigation is of use to others having the same problem. (As an aside, I've also submitted a pull request against the Sentry documentation as part of this ;-)) (Note to anyone using / extending Sentry with custom interfaces - if you want to avoid your interface being use to group exceptions, return an empty list.)

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • Displaying pic for user through a question's answer

    - by bgadoci
    Ok, I am trying to display the profile pic of a user. The application I have set up allows users to create questions and answers (I am calling answers 'sites' in the code) the view in which I am trying to do so is in the /views/questions/show.html.erb file. It might also be of note that I am using the Paperclip gem. Here is the set up: Associations Users class User < ActiveRecord::Base has_many :questions, :dependent => :destroy has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :through => :sites , :dependent => :destroy has_many :pics, :dependent => :destroy has_many :likes, :dependent => :destroy end Questions class Question < ActiveRecord::Base has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy belongs_to :user end Answers (sites) class Site < ActiveRecord::Base belongs_to :question belongs_to :user has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy has_attached_file :photo, :styles => { :small => "250x250>" } end Pics class Pic < ActiveRecord::Base has_attached_file :profile_pic, :styles => { :small => "100x100" } belongs_to :user end The /views/questions/show.html.erb is rendering the partial /views/sites/_site.html.erb which is calling the Answer (site) with: <% div_for site do %> <%=h site.description %> <% end %> I have been trying to do things like: <%=image_tag site.user.pic.profile_pic.url(:small) %> <%=image_tag site.user.profile_pic.url(:small) %> etc. But that is obviously wrong. My error directs me to the Questions#show action so I am imagining that I need to define something in there but not sure what. Is is possible to call the pic given the current associations, placement of the call, and if so what Controller additions do I need to make, and what line of code will call the pic? UPDATE: Here is the QuestionsController#show code: def show @question = Question.find(params[:id]) @sites = @question.sites.all(:select => "sites.*, SUM(likes.like) as like_total", :joins => "LEFT JOIN likes AS likes ON likes.site_id = sites.id", :group => "sites.id", :order => "like_total DESC") respond_to do |format| format.html # show.html.erb format.xml { render :xml => @question } end end

    Read the article

  • What is fastest way to convert bool to byte?

    - by Amir Rezaei
    What is fastest way to convert bool to byte? I want this mapping: False=0, True=1 Note: I don't want to use any if statement. Update: I don't want to use conditional statement. I don't want the CPU to halt or guess next statement. I want to optimize this code: private static string ByteArrayToHex(byte[] barray) { char[] c = new char[barray.Length * 2]; byte k; for (int i = 0; i < barray.Length; ++i) { k = ((byte)(barray[i] >> 4)); c[i * 2] = (char)(k > 9 ? k + 0x37 : k + 0x30); k = ((byte)(barray[i] & 0xF)); c[i * 2 + 1] = (char)(k > 9 ? k + 0x37 : k + 0x30); } return new string(c); } Update: The length of the array is very large, it's in terabyte order! Therefore I need to do optimization if possible. I shouldn't need to explain my self. The question is still valid. Update: I'm working on a project and looking at others code. That's why I didn't provide with the function at first place. I didn't want to spend time on explaining for people when they have opinion about the code. I shouldn’y need to provide in my question the background of my work, and a function that is not written by me. I have started to optimize it part by part. If I needed help with the whole function I would asked that in another question. That is why I asked this very simple at the beginning. Unfortunately people couldn’t keep themselves to the question. So please if you want to help answer the question. Update: For dose who want to see the point of this question. This example shows how two if statement are reduced from the code. byte A = k > 9 ; //If it was possible (k>9) == 0 || 1 c[i * 2] = A * (k + 0x30) - (A - 1) * (k + 0x30);

    Read the article

  • highlighting search results in php error

    - by fusion
    i'm trying to figure out what is wrong in this code. it either doesn't highlight the search result OR it outputs html tags surrounding the highlighted text. . $search_result = ""; $search_result = trim($search_result); $special_cases = array( '%', '_', '+' ); $search_result = str_replace( $special_cases, '', $_GET["q"] ); //Check if the string is empty if ($search_result == "") { echo "<p>Search Error</p><p>Please enter a search...</p>" ; exit(); } $result = mysql_query('SELECT cQuotes, vAuthor, cArabic, vReference FROM thquotes WHERE cQuotes LIKE "%' . mysql_real_escape_string($search_result) .'%" ORDER BY idQuotes DESC', $conn) or die ('Error: '.mysql_error()); //eliminating special characters function h($s) { echo htmlspecialchars($s, ENT_QUOTES); } function highlightWords($string, $word) { $string = str_replace($word, "<span style='background-color: #FFE066;font-weight:bold;'>".$word."</span>", $string); /*** return the highlighted string ***/ return $string; } ?> <div class="caption">Search Results</div> <div class="center_div"> <table> <?php while ($row= mysql_fetch_array($result, MYSQL_ASSOC)) { $cQuote = highlightWords($row['cQuotes'], $search_result); ?> <tr> <td style="text-align:right; font-size:15px;"><?php h($row['cArabic']); ?></td> <td style="font-size:16px;"><?php h($cQuote); ?></td> <td style="font-size:12px;"><?php h($row['vAuthor']); ?></td> <td style="font-size:12px; font-style:italic; text-align:right;"><?php h($row['vReference']); ?></td> </tr> <?php } ?> </table> </div> on the browser, it is outputted as: A good <span style='background-color: #FFE066;font-weight:bold;'>action</span> is an ever-remaining store and a pure yield or if a div is used with class: A good <div class='highlight'>action</div> is an ever-remaining store and a pure yield

    Read the article

  • Finding the most frequent subtrees in a collection of (parse) trees

    - by peter.murray.rust
    I have a collection of trees whose nodes are labelled (but not uniquely). Specifically the trees are from a collection of parsed sentences (see http://en.wikipedia.org/wiki/Treebank). I wish to extract the most common subtrees from the collection - performance is not (yet) an issue. I'd be grateful for algorithms (ideally Java) or pointers to tools which do this for treebanks. Note that order of child nodes is important. EDIT @mjv. We are working in a limited domain (chemistry) which has a stylised language so the varirty of the trees is not huge - probably similar to children's readers. Simple tree for "the cat sat on the mat". <sentence> <nounPhrase> <article/> <noun/> </nounPhrase> <verbPhrase> <verb/> <prepositionPhrase> <preposition/> <nounPhrase> <article/> <noun/> </nounPhrase> </prepositionPhrase> </verbPhrase> </sentence> Here the sentence contains two identical part-of-speech subtrees (the actual tokens "cat". "mat" are not important in matching). So the algorithm would need to detect this. Note that not all nounPhrases are identical - "the big black cat" could be: <nounPhrase> <article/> <adjective/> <adjective/> <noun/> </nounPhrase> The length of sentences will be longer - between 15 to 30 nodes. I would expect to get useful results from 1000 trees. If this does not take more than a day or so that's acceptable. Obviously the shorter the tree the more frequent, so nounPhrase will be very common. EDIT If this is to be solved by flattening the tree then I think it would be related to Longest Common Substring, not Longest Common Sequence. But note that I don't necessarily just want the longest - I want a list of all those long enough to be "interesting" (criterion yet to be decided).

    Read the article

  • How to salvage SQL server 2008 query from KILLED/ROLLBACK state without waiting half a day?

    - by littlegreen
    I have a stored procedure that inserts batches of millions of rows, emerging from a certain query, into an SQL database. It has one parameter selecting the batch; when this parameter is omitted, it will gather a list of batches and recursively call itself, in order to iterate over batches. In (pseudo-)code, it looks something like this: CREATE PROCEDURE spProcedure AS BEGIN IF @code = 0 BEGIN ... WHILE @@Fetch_Status=0 BEGIN EXEC spProcedure @code FETCH NEXT ... INTO @code END END ELSE BEGIN -- Disable indexes ... INSERT INTO table SELECT (...) -- Enable indexes ... Now it can happen that this procedure is slow, for whatever reason: it can't get a lock, one of the indexes it uses is misdefined or disabled. In that case, I want to be able kill the procedure, truncate and recreate the resulting table, and try again. However, when I try and kill the procedure, the process frequently oozes into a KILLED/ROLLBACK state from which there seems to be no return. From Google I have learned to do an sp_lock, find the spid, and then kill it with KILL <spid>. But when I try to kill it, it tells me SPID 75: transaction rollback in progress. Estimated rollback completion: 0%. Estimated time remaining: 554 seconds. I did find a forum message hinting that another spid should be killed before the other one can start a rollback. But that didn't work for me either, plus I do not understand, why that would be the case... could it be because I am recursively calling my own stored procedure? (But it should be having the same spid, right?) In any case, my process is just sitting there, being dead, not responding to kills, and locking the table. This is very frustrating, as I want to go on developing my queries, not waiting hours on my server sitting dead while pretending to be finishing a supposed rollback. Is there some way in which I can tell the server not to store any rollback information for my query? Or not to allow any other queries to interfere with the rollback, so that it will not take so long? Or how to rewrite my query in a better way, or how kill the process successfully without restarting the server?

    Read the article

  • Values of generated column not appearing in table

    - by msh210
    I'm using mysql version 5.1.41-3ubuntu12.10 (Ubuntu). mysql> show create table tt\G *************************** 1. row *************************** Table: tt Create Table: CREATE TABLE `tt` ( `pz` int(8) DEFAULT NULL, `os` varchar(8) DEFAULT NULL, `uz` int(11) NOT NULL, `p` bigint(21) NOT NULL DEFAULT '0', `c` decimal(23,0) DEFAULT NULL, KEY `pz` (`pz`), KEY `uz` (`uz`), KEY `os` (`os`), KEY `pz_2` (`pz`,`uz`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 1 row in set (0.00 sec) mysql> select pz,uz,pz*uz, -> if(pz*uz,1,.5), -> left(pz,2) pl,left(lpad(uz,5,0),2) ul, -> p from tt limit 10; +-------+----+-------+----------------+--------+----+--------+ | pz | uz | pz*uz | if(pz*uz,1,.5) | pl | ul | p | +-------+----+-------+----------------+--------+----+--------+ | NULL | 0 | NULL | 0.5 | NULL | 00 | 4080 | | NULL | 0 | NULL | 0.5 | NULL | 00 | 323754 | | 89101 | 0 | 0 | 0.5 | 89 | 00 | 6880 | | 0 | 0 | 0 | 0.5 | 0 | 00 | 11591 | | 89110 | 0 | 0 | 0.5 | 89 | 00 | 72 | | 78247 | 0 | 0 | 0.5 | 78 | 00 | 27 | | 90062 | 0 | 0 | 0.5 | 90 | 00 | 5 | | 63107 | 0 | 0 | 0.5 | 63 | 00 | 4 | | NULL | 0 | NULL | 0.5 | NULL | 00 | 54561 | | 94102 | 0 | 0 | 0.5 | 94 | 00 | 12499 | +-------+----+-------+----------------+--------+----+--------+ So far so good. As you see, 0.5 appears as a value of if(pz*uz,1,.5). The problem is: mysql> select os, -> if(pz*uz,left(pz,2)<=>left(lpad(uz,5,0),2),.5) uptwo, -> if(pz*uz,left(pz,3)<=>left(lpad(uz,5,0),3),.5) upthree, -> sum(p) p,sum(c) c -> from tt t -> group by os,uptwo,upthree order by null; +----+-------+---------+---------+-------+ | os | uptwo | upthree | p | c | +----+-------+---------+---------+-------+ | u | 1 | 1 | 52852 | 318 | | i | 1 | 1 | 7046563 | 21716 | | m | 1 | 1 | 1252166 | 7337 | | i | 0 | 0 | 1830284 | 4033 | | m | 0 | 0 | 294612 | 1714 | | i | 1 | 0 | 911486 | 3560 | | m | 1 | 0 | 145182 | 1136 | | u | 0 | 0 | 12144 | 23 | | u | 1 | 0 | 1571 | 8 | +----+-------+---------+---------+-------+ Although I group by uptwo, 0.5 doesn't appear in that column. What happened to the 0.5 values? Edit: As noted in the comments to Todd Gibson's answer, I also tried it with if(pz*uz,cast(left(pz,2)<=>left(lpad(uz,5,0),2) as decimal),.5) instead of if(pz*uz,left(pz,2)<=>left(lpad(uz,5,0),2),.5), but it, too, didn't work.

    Read the article

  • Using Core Data Concurrently and Reliably

    - by John Topley
    I'm building my first iOS app, which in theory should be pretty straightforward but I'm having difficulty making it sufficiently bulletproof for me to feel confident submitting it to the App Store. Briefly, the main screen has a table view, upon selecting a row it segues to another table view that displays information relevant for the selected row in a master-detail fashion. The underlying data is retrieved as JSON data from a web service once a day and then cached in a Core Data store. The data previous to that day is deleted to stop the SQLite database file from growing indefinitely. All data persistence operations are performed using Core Data, with an NSFetchedResultsController underpinning the detail table view. The problem I am seeing is that if you switch quickly between the master and detail screens several times whilst fresh data is being retrieved, parsed and saved, the app freezes or crashes completely. There seems to be some sort of race condition, maybe due to Core Data importing data in the background whilst the main thread is trying to perform a fetch, but I'm speculating. I've had trouble capturing any meaningful crash information, usually it's a SIGSEGV deep in the Core Data stack. The table below shows the actual order of events that happen when the detail table view controller is loaded: Main Thread Background Thread viewDidLoad Get JSON data (using AFNetworking) Create child NSManagedObjectContext (MOC) Parse JSON data Insert managed objects in child MOC Save child MOC Post import completion notification Receive import completion notification Save parent MOC Perform fetch and reload table view Delete old managed objects in child MOC Save child MOC Post deletion completion notification Receive deletion completion notification Save parent MOC Once the AFNetworking completion block is triggered when the JSON data has arrived, a nested NSManagedObjectContext is created and passed to an "importer" object that parses the JSON data and saves the objects to the Core Data store. The importer executes using the new performBlock method introduced in iOS 5: NSManagedObjectContext *child = [[NSManagedObjectContext alloc] initWithConcurrencyType:NSPrivateQueueConcurrencyType]; [child setParentContext:self.managedObjectContext]; [child performBlock:^{ // Create importer instance, passing it the child MOC... }]; The importer object observes its own MOC's NSManagedObjectContextDidSaveNotification and then posts its own notification which is observed by the detail table view controller. When this notification is posted the table view controller performs a save on its own (parent) MOC. I use the same basic pattern with a "deleter" object for deleting the old data after the new data for the day has been imported. This occurs asynchronously after the new data has been fetched by the fetched results controller and the detail table view has been reloaded. One thing I am not doing is observing any merge notifications or locking any of the managed object contexts or the persistent store coordinator. Is this something I should be doing? I'm a bit unsure how to architect this all correctly so would appreciate any advice.

    Read the article

  • Tag Cloud JS + Flash. Not clickable?

    - by Alex
    Hello all, I've implemented a tag cloud on a site of mine, and I'm using a JS script to populate it, but for some reason, the actual text in the tag cloud is not clickable. It displays and works correctly, but the actual text of the cloud is not getting treated as a link for some odd reason. My question is: In my script below, do you see anything that I need to fix in order to make my tag cloud's text actually be links? The site I've implemented it on is a stackexhange site that I run, it is supposed to be a cloud of the "recent tags." CloudPopulator.js <script type="text/javascript"> var divRecentTags = document.getElementById("recent-tags"); if (divRecentTags) { var cloud = new SWFObject("https://kynetx-images.s3.amazonaws.com/tagcloud.swf", "tagcloudflash", "200", "200", "9", "#ffffff"); cloud.addParam("allowScriptAccess", "always"); cloud.addVariable("tcolor", "0x0a94d6"); cloud.addVariable("tcolor2", "0xC0C0C0"); cloud.addVariable("hicolor", "0x000000"); cloud.addVariable("tspeed", "150"); cloud.addVariable("distr", "true"); cloud.addVariable("mode", "tags"); var aTags = divRecentTags.getElementsByTagName("a"); var tagHtml = ""; for(var i = 0; i < aTags.length; i++) { var hrefText = aTags[i].getAttribute("href"); var cssText = aTags[i].className; var tagName = $(aTags[i]).text(); var styleText = "style=\'font-size: 8pt;\'"; if (cssText == "post-tag pop1") { var styleText = "style=\'font-size: 15pt;\'"; } else if (cssText == "post-tag pop2") { var styleText = "style=\'font-size: 22pt;\'"; } var newLinkText = "<a href=\'"+hrefText+"\'"+styleText+">"+tagName+"</a>"; tagHtml = tagHtml + newLinkText; } cloud.addVariable("tagcloud", escape("<tags>" + tagHtml + "</tags>")); cloud.write("recent-tags"); }

    Read the article

  • Stored procedure optimization

    - by George Zacharia
    Hi, i have a stored procedure which takes lot of time to execure .Can any one suggest a better approch so that the same result set is achived. ALTER PROCEDURE [dbo].[spFavoriteRecipesGET] @USERID INT, @PAGENUMBER INT, @PAGESIZE INT, @SORTDIRECTION VARCHAR(4), @SORTORDER VARCHAR(4),@FILTERBY INT AS BEGIN DECLARE @ROW_START INT DECLARE @ROW_END INT SET @ROW_START = (@PageNumber-1)* @PageSize+1 SET @ROW_END = @PageNumber*@PageSize DECLARE @RecipeCount INT DECLARE @RESULT_SET_TABLE TABLE ( Id INT NOT NULL IDENTITY(1,1), FavoriteRecipeId INT, RecipeId INT, DateAdded DATETIME, Title NVARCHAR(255), UrlFriendlyTitle NVARCHAR(250), [Description] NVARCHAR(MAX), AverageRatingId FLOAT, SubmittedById INT, SubmittedBy VARCHAR(250), RecipeStateId INT, RecipeRatingId INT, ReviewCount INT, TweaksCount INT, PhotoCount INT, ImageName NVARCHAR(50) ) INSERT INTO @RESULT_SET_TABLE SELECT FavoriteRecipes.FavoriteRecipeId, Recipes.RecipeId, FavoriteRecipes.DateAdded, Recipes.Title, Recipes.UrlFriendlyTitle, Recipes.[Description], Recipes.AverageRatingId, Recipes.SubmittedById, COALESCE(users.DisplayName,users.UserName,Recipes.SubmittedBy) As SubmittedBy, Recipes.RecipeStateId, RecipeReviews.RecipeRatingId, COUNT(RecipeReviews.Review), COUNT(RecipeTweaks.Tweak), COUNT(Photos.PhotoId), dbo.udfGetRecipePhoto(Recipes.RecipeId) AS ImageName FROM FavoriteRecipes INNER JOIN Recipes ON FavoriteRecipes.RecipeId=Recipes.RecipeId AND Recipes.RecipeStateId <> 3 LEFT OUTER JOIN RecipeReviews ON RecipeReviews.RecipeId=Recipes.RecipeId AND RecipeReviews.ReviewedById=@UserId AND RecipeReviews.RecipeRatingId= ( SELECT MAX(RecipeReviews.RecipeRatingId) FROM RecipeReviews WHERE RecipeReviews.ReviewedById=@UserId AND RecipeReviews.RecipeId=FavoriteRecipes.RecipeId ) OR RecipeReviews.RecipeRatingId IS NULL LEFT OUTER JOIN RecipeTweaks ON RecipeTweaks.RecipeId = Recipes.RecipeId AND RecipeTweaks.TweakedById= @UserId LEFT OUTER JOIN Photos ON Photos.RecipeId = Recipes.RecipeId AND Photos.UploadedById = @UserId AND Photos.RecipeId = FavoriteRecipes.RecipeId AND Photos.PhotoTypeId = 1 LEFT OUTER JOIN users ON Recipes.SubmittedById = users.UserId WHERE FavoriteRecipes.UserId=@UserId GROUP BY FavoriteRecipes.FavoriteRecipeId, Recipes.RecipeId, FavoriteRecipes.DateAdded, Recipes.Title, Recipes.UrlFriendlyTitle, Recipes.[Description], Recipes.AverageRatingId, Recipes.SubmittedById, Recipes.SubmittedBy, Recipes.RecipeStateId, RecipeReviews.RecipeRatingId, users.DisplayName, users.UserName, Recipes.SubmittedBy; WITH SortResults AS ( SELECT ROW_NUMBER() OVER ( ORDER BY CASE WHEN @SORTDIRECTION = 't' AND @SORTORDER='a' THEN TITLE END ASC, CASE WHEN @SORTDIRECTION = 't' AND @SORTORDER='d' THEN TITLE END DESC, CASE WHEN @SORTDIRECTION = 'r' AND @SORTORDER='a' THEN AverageRatingId END ASC, CASE WHEN @SORTDIRECTION = 'r' AND @SORTORDER='d' THEN AverageRatingId END DESC, CASE WHEN @SORTDIRECTION = 'mr' AND @SORTORDER='a' THEN RecipeRatingId END ASC, CASE WHEN @SORTDIRECTION = 'mr' AND @SORTORDER='d' THEN RecipeRatingId END DESC, CASE WHEN @SORTDIRECTION = 'd' AND @SORTORDER='a' THEN DateAdded END ASC, CASE WHEN @SORTDIRECTION = 'd' AND @SORTORDER='d' THEN DateAdded END DESC ) RowNumber, FavoriteRecipeId, RecipeId, DateAdded, Title, UrlFriendlyTitle, [Description], AverageRatingId, SubmittedById, SubmittedBy, RecipeStateId, RecipeRatingId, ReviewCount, TweaksCount, PhotoCount, ImageName FROM @RESULT_SET_TABLE WHERE ((@FILTERBY = 1 AND SubmittedById= @USERID) OR ( @FILTERBY = 2 AND (SubmittedById <> @USERID OR SubmittedById IS NULL)) OR ( @FILTERBY <> 1 AND @FILTERBY <> 2)) ) SELECT RowNumber, FavoriteRecipeId, RecipeId, DateAdded, Title, UrlFriendlyTitle, [Description], AverageRatingId, SubmittedById, SubmittedBy, RecipeStateId, RecipeRatingId, ReviewCount, TweaksCount, PhotoCount, ImageName FROM SortResults WHERE RowNumber BETWEEN @ROW_START AND @ROW_END print @ROW_START print @ROW_END SELECT @RecipeCount=dbo.udfGetFavRecipesCount(@UserId) SELECT @RecipeCount AS RecipeCount SELECT COUNT(Id) as FilterCount FROM @RESULT_SET_TABLE WHERE ((@FILTERBY = 1 AND SubmittedById= @USERID) OR (@FILTERBY = 2 AND (SubmittedById <> @USERID OR SubmittedById IS NULL)) OR (@FILTERBY <> 1 AND @FILTERBY <> 2)) END

    Read the article

  • Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

    - by jboyd
    Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • OpenGL, how to set a monochrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • 2nd Year College - Learning - Microsoft Server Products

    - by Ryan
    As the title says, I just finished my first year of college (majoring in Software Engineering). Fortunately my school likes Microsoft enough, and I can get pretty much anything I want that Microsoft sells. I also can get IBM Websphere and the like for free as well. Earlier this year, I set up an oldish computer (2.6 Pentium D, x64) to run ubuntu server headless. I'm predominately a Java developer, so Apache, Maven, Nexus, Sonar, SVN, etc made it onto the machine. It worked really well for personal and school projects, especially team projects (quick ramp up). Anyways, I started to pick up C# to complement my Java knowledge (don't judge me :P), and am interested in working with some of the associated Microsoft equivalents. The machine currently has the Ubuntu install, as well as Windows 7 Ultimate. I do all of my actual development work off my laptop, also running Windows 7 Ultimate. I was wondering what software you would recommend putting on the machine. I’m not actually serving anything off the machine itself, but in Ubuntu I had it doing integration tests with Hudson on every commit, and profiling my applications, etc, etc. The machine would be running headless, and I would remote into it. Here is what I am currently leaning towards / wondering about: Windows 7 Ultimate vs Windows Server 2008 (R2) (no one is really clear why I should go with one over the other) Windows Team Foundation Sharepoint (Never used it before, kind of meh about it) IBM Websphere or Glassfish (Some Java EE web server) SQL Server 2008 A DVCS In order to better control product conflicts / limit resource use, I’m wondering if I should install things into virtual machines (I can get VmWare or Microsoft Virtualization Products) I also plan on installing everything I had running under Linux (it’s almost entirely Java based development software, so it’ll run on both, only reason I went with ubuntu during the year was because the apache build seemed better). I’m primarily looking to become familiar with enterprise software development tools, as well as get something functional that will help my development process. (IE, I’ll still use project and assign tasks even though I might be the only one to assign tasks to, just to practice doing so). Is there any other software / configuration details I should explore? Opinions on my current list? I primarily use C#, Java, and PHP. I'm familiar with ruby, and python as well. Thanks!

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Get data from aspx.cs page to aspx page.

    - by Brad8118
    So I am using a jquery plug in that allows me to change the order of things in a list by dragging and dropping them. So my goal is to be able to grab a list of my objects (AlertInfo) and using it in a javascript function. I was able to use a json webservice call in a test project to pass the data to the page. But we don't have a webservice page now so I tried to grab it from a aspx.cs page and it hasn't worked. ///Aspx page: $.ajax({ type: "POST", url: "~/Alerts/GetAlerts", data: "{}", contentType: "application/json; charset=utf-8", dataType: "json", success: function (msg) { var data = eval("(" + msg.d + ")"); jQuery.each(data, function (rec) { AlertList[AlertList.length] = new objAlert(this.id, this.title, this.details, JSONDateSerializationFix(this.startdate), JSONDateSerializationFix(this.enddate)); UpdateDisplayList(); }) }, error: function (msg) { alert("BRAD" + msg); } The issue is that the Alerts page in "URL /Alerts/GetAlerts" is Alerts.aspx.cs. I can't figure out if I can use this ajax command to call a method in a aspx.cs page. //Code behind page aspx.cs [WebMethod] //[ScriptMethod(ResponseFormat = ResponseFormat.Json)] public string GetAlerts() { List list = AlertInfo.GetTestAlerts(); return new JavaScriptSerializer().Serialize(list); } public List GetAlertsList() { List list = AlertInfo.GetTestAlerts(); return list; ; } So I was hoping that I could load data into an asp control (dataList) and then grab the data //code behind page protected void Page_Load(object sender, EventArgs e) { dataListAlertList.DataSource = GetAlertsList(); dataListAlertList.DataBind(); } public static List<AlertInfo> GetTestAlerts() { List<AlertInfo> list = new List<AlertInfo>(); list.Add(new AlertInfo("0", "Alert 1 Title", "Alert 1 Detail", "10/10/2010", "10/10/2011")); list.Add(new AlertInfo("1", "Alert 2 Title", "Alert 2 Detail", "10/10/2010", "10/10/2011")); return list; } //.aspx page $(document).ready(function () { var a1 = $("#dataListAlertList").val(); // do fun stuff now. } But I keep getting undefined....

    Read the article

  • Having a Link Only Appear If a Logged-In User Appears on a Dynamic List

    - by John
    Hello, For the function below, I would like the link <div class="footervote"><a href="http://www...com/.../footervote.php">Vote</a></div> to only appear if the logged in user currently appears on editorlist.php. (I. e. if the loginid in the function corresponds to any of the usernames that currently appear in editorlist.php.) Appearing on editorlist.php is something that is dynamic. How can I do this? Thanks in advance, John function show_userbox() { // retrieve the session information $u = $_SESSION['username']; $uid = $_SESSION['loginid']; // display the user box echo '<div id="userbox"> <div class="username">'.$u.'</div> <div class="submit"><a href="http://www...com/.../submit.php">Submit an item.</a></div> <div class="changepassword"><a href="http://www...com/.../changepassword.php">Change Password</a></div> <div class="logout"><a href="http://www...com/.../logout.php">Logout</a></div> <div class="footervote"><a href="http://www...com/.../footervote.php">Vote</a></div> </div>'; } On editorlist.php: $sqlStr = "SELECT l.loginid, l.username, l.created, DATEDIFF(NOW(), l.created) AS days, COALESCE(s.total, 0) AS countSubmissions, COALESCE(c.total, 0) AS countComments, COALESCE(s.total, 0) * 10 + COALESCE(c.total, 0) AS totalScore, DATEDIFF(NOW(), l.created) + COALESCE(s.total, 0) * 10 + COALESCE(c.total, 0) AS totalScore2 FROM login l LEFT JOIN ( SELECT loginid, COUNT(1) AS total FROM submission GROUP BY loginid ) s ON l.loginid = s.loginid LEFT JOIN ( SELECT loginid, COUNT(1) AS total FROM comment GROUP BY loginid ) c ON l.loginid = c.loginid GROUP BY l.loginid ORDER BY totalScore2 DESC LIMIT 10"; $result = mysql_query($sqlStr); $arr = array(); echo "<table class=\"samplesrec1edit\">"; while ($row = mysql_fetch_array($result)) { echo '<tr>'; echo '<td class="sitename1edit1"><a href="http://www...com/.../members/index.php?profile='.$row["username"].'">'.stripslashes($row["username"]).'</a></td>'; echo '<td class="sitename1edit2">'.($row["countSubmissions"]).'</td>'; echo '<td class="sitename1edit2">'.($row["countComments"]).'</td>'; echo '<td class="sitename1edit2">'.($row["days"]).'</td>'; echo '<td class="sitename1edit2">'.($row["totalScore2"]).'</td>'; echo '</tr>'; } echo "</table>";

    Read the article

< Previous Page | 660 661 662 663 664 665 666 667 668 669 670 671  | Next Page >