Search Results

Search found 19662 results on 787 pages for 'python module'.

Page 67/787 | < Previous Page | 63 64 65 66 67 68 69 70 71 72 73 74  | Next Page >

  • Python: Is there a way to reflectivly list all attributes of a class

    - by hhafez
    Given a class such as def MyClass text = "hello" number = 123 Is there a way in python to inspect MyClass an determine that it has the two attributes text and number. I can not use something like inspect.getSource(object) because the class I am to get it's attributes for are generate using SWIG (so they are hidden in .so :) ). So I am really looking for something equivalant to Java's [Class.getDeclardFields][1] Any help would be appreciated, otherwise I'll have to solve this problem with SWIG + JAVA instead of SWIG + Python.

    Read the article

  • Using Python to add/remove Ubuntu login script items

    - by codebox_rob
    I have written a Python application and would like to give my users the option of having the app automatically launch itself when the user logs in. It is important that the user is able to toggle this option on/off from within the app itself, rather than having to manually edit login scripts, so this needs to be done from within the Python code rather than from a shell script. The app is deployed on Ubuntu Linux, any suggestions for the best way of doing this?

    Read the article

  • How can I get the last-modified time with python3 urllib?

    - by Daenyth
    I'm porting over a program of mine from python2 to python3, and I'm hitting the following error: AttributeError: 'HTTPMessage' object has no attribute 'getdate' Here's the code: conn = urllib.request.urlopen(fileslist, timeout=30) last_modified = conn.info().getdate('last-modified') This section worked under python 2.7, and so far I haven't been able to find out the correct method to get this information in python 3.1. The full context is an update method. It pulls new files from a server down to its local database, but only if the file on the server is newer than the local file. If there's a smarter way to achieve this functionality than just comparing local and remote file timestamps, then I'm open to that as well.

    Read the article

  • programming language implemented in pure python

    - by iamgopal
    hi, i am creating ( researching possibility of ) a highly customizable python client and would like to allow users to actually edit the code in another language to customize the running of program. ( analogous to browser which itself coded in c/c++ and run another language html/js ). so my question is , is there any programming language implemented in pure python which i can see as a reference ( or use directly ? ) -- i need simple language ( simple statements and ifs can do )

    Read the article

  • How to send raw XML in Python?

    - by davywahd
    Hi, I am trying to send raw xml to a service in Python. I have a the address of the service and my question is how would I wrap XML in python and send it to the service. The address is in the format below. 192.1100.2.2:54239 And say the XML is: <xml version="1.0" encoding="UTF-8"><header/><body><code><body/> Anyone know what to do?

    Read the article

  • Twitter API with urllib2 in python

    - by Dirk Nachbar
    I want to use the Twitter API in Python to lookup user ids from name using the lookup method. I have done similar requests simply using response = urllib2.urlopen('http://search.twitter.com...') but for this one I need authentication. I don't think I can do it through the Google python twitter API because it doesn't have the lookup method. Any ideas how can I can auth with urllib2??

    Read the article

  • Parse (extract) DTMF in Python

    - by Joseph
    If I have a recorded audio file (MP3), is there any way to get the figure out the DTMF tones that were recorded in pure Python? (If pure python is not available, then Java is okay too. The point being that it should be able to run in Google Appengine)

    Read the article

  • Longest common substring from more than two strings - Python

    - by Nicolas Noël
    Hi, I'm looking for a python library for finding the longest common substring from a set of python strings. I'have read that it exist to way to solve this problem : - one using suffix trees - the other using dynamic programming. The method implemented is not important. Otherwise, it is important to have a implementation that can be use for a set of strings and not only two strings Thanks,

    Read the article

  • Location of global libraries for Python on Mac ?

    - by xTrol
    Hi, Im fighting with installation SIP for Python on Mac OS X. Finally after compilation and installation when I run console form folder of SIP (locally) I can import sipconfig, but when Im in other folder I cant - there is no module called sipconfig. My question is - Where is folder to which I have to copy modules if I want to have them available globally (like "import os"), or how I can check it, because location "/Library/Python/2.6/site-packages/" doesn`t work.

    Read the article

  • Latest 100 mentions - Twitter api

    - by laurens
    I'm looking to achieve the following: For a specific person, for example BarackObama, I'd like to get the last 100 times/tweets he was mentioned. Not his own tweets but the tweets of others containing @BarackObama. In the end I'd like to have: the person who mentioned, location, datetime. This content should be written to a flat file. I've been experimenting with the Twitter API and Python, with success but haven't yet succeeded achieving the above problem. I know there is a dev sections on the twitter website but they don't provide any example of code!! https://dev.twitter.com/docs/api/1/get/statuses/mentions count=100 .... For me the scripting language or way of doing is not relevant it's the result. I just read on the internet that python and Twitter api are a good match. Thanks a lot in advance!!

    Read the article

  • How to parse json data in Python?

    - by backcross
    Please help me to parse this json in python. { "IT" : [ { "firstName" : "ajay", "lastName" : "stha", "age" : 24 }, { "firstName" : "Michiel", "lastName" : "Og", "age" : 35 } ], "sales" : [ { "firstName" : "Guru", "lastName" : "red", "age" : 27 }, { "firstName" : "Jim", "lastName" : "Galley", "age" : 34 } ] } How to parse this json in Python?Please help me

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how to send some data to the Thread module on python and google-map-engine

    - by zjm1126
    from google.appengine.ext import db class Log(db.Model): content = db.StringProperty(multiline=True) class MyThread(threading.Thread): def run(self,request): #logs_query = Log.all().order('-date') #logs = logs_query.fetch(3) log=Log() log.content=request.POST.get('content',None) log.put() def Log(request): thr = MyThread() thr.start(request) return HttpResponse('') error is : Exception in thread Thread-1: Traceback (most recent call last): File "D:\Python25\lib\threading.py", line 486, in __bootstrap_inner self.run() File "D:\zjm_code\helloworld\views.py", line 33, in run log.content=request.POST.get('content',None) NameError: global name 'request' is not defined

    Read the article

  • how to go back to first if statement if no choices are valid - python

    - by wondergoat77
    how can i have python move to the top of an if statement if nothing is satisfied correctly i have a basic if/else statement like this: print "pick a number, 1 or 2" a = int(raw_input("> ") if a == 1: print "this" if a == 2: print "that" else: print "you have made an invalid choice, try again." what i want is to prompt the user to make another choice for 'a' this if statement without them having to restart the entire program, but am very new to python and am having trouble finding the answer online anywhere.

    Read the article

  • Python and displaying HTML

    - by Tyler Seymour
    I've gotten pretty comfortable with Python and now I'm looking to make a rudimentary web application. I was somewhat scared of Django and the other Python frameworks so I went caveman on it and decided to generate the HTML myself using another Python script. Maybe this is how you do it anyways - but I'm just figuring this stuff out. I'm really looking for a tip-off on, well, what to do next. My Python script PRINTS the HTML (is this even correct? I need it to be on a webpage!), but now what? Thanks for your continued support during my learning process. One day I will post answers! -Tyler Here's my code: from SearchPhone import SearchPhone phones = ["Iphone 3", "Iphone 4", "Iphone 5","Galaxy s3", "Galaxy s2", "LG Lucid", "LG Esteem", "HTC One S", "Droid 4", "Droid RAZR MAXX", "HTC EVO", "Galaxy Nexus", "LG Optimus 2", "LG Ignite", "Galaxy Note", "HTC Amaze", "HTC Rezound", "HTC Vivid", "HTC Rhyme", "Motorola Photon", "Motorola Milestone", "myTouch slide", "HTC Status", "Droid 3", "HTC Evo 3d", "HTC Wildfire", "LG Optimus 3d", "HTC ThunderBolt", "Incredible 2", "Kyocera Echo", "Galaxy S 4g", "HTC Inspire", "LG Optimus 2x", "Samsung Gem", "HTC Evo Shift", "Nexus S", "LG Axis", "Droid 2", "G2", "Droid x", "Droid Incredible" ] print """<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>table of phones</title> </head> <body> </body> </html> """ #table print '<table width="100%" border="1">' for x in phones: y = SearchPhone(x) print "\t<tr>" print "\t\t<td>" + str(y[0]) + "</td>" print "\t\t<td>" + str(y[1]) + "</td>" print "\t\t<td>" + str(y[2]) + "</td>" print "\t\t<td>" + str(y[3]) + "</td>" print "\t\t<td>" + str(y[4]) + "</td>" print "\t</tr>" print "</table>

    Read the article

  • listing network shares with python

    - by Gearoid Murphy
    Hello, if I explicitly attempt to list the contents of a shared directory on a remote host using python on a windows machine, the operation succeeds, for example, the following snippet works fine: os.listdir("\\\\remotehost\\share") However, if I attempt to list the network drives/directories available on the remote host, python fails, an example of which is shown in the following code snippet: os.listdir("\\\\remotehost") Is anyone aware of why this doesn't work?, any help/workaround is appreciated.

    Read the article

  • Paste Excel clip to body of an email through Python

    - by Twinkle
    I am using win32com.client in Python to send an email. However I want the body of the email to be a table (HTML- formatted table), I can do it in an Excel first and then copy and paste (but how?), or directly edit the corresponding Pandas data frame. newMail.body = my_table which is a Pandas data frame didn't work. So I'm wondering if there is smarter ways for example, to combine Excel with Outlook apps within Python? Cheers,

    Read the article

  • Java's equivalent to bisect in python

    - by systemsfault
    Hello all, Is there a java equivalent to python's bisect library? With python's bisect you can do array bisection with directions. For instance bisect.bisect_left does: Locate the proper insertion point for item in list to maintain sorted order. The parameters lo and hi may be used to specify a subset of the list which should be considered; by default the entire list is used.

    Read the article

  • Executing Multiple Lines in Python

    - by metashockwave
    When Python is first installed, the default setting executes users' code input line-by-line. But sometimes I need to write programs that executes multiple lines at once. Is there a setting in Python where I can change the code execution to one block at once? Thanks if (n/2) * 2 == n:; print 'Even'; else: print 'Odd' SyntaxError: invalid syntax When I tried to run the above code, I got an invalid syntax error on ELSE

    Read the article

  • Python: saving and loading a class definition

    - by Peterstone
    Hi! I am interested in saving and load objects using the pickle module as you can read in a question I asked before: Python: Errors saving and loading objects with pickle module Someone commment: 1, In an other way: the error is raise because pickle wanted to load an instance of the class Fruits and search for the class definition where it was defined, but it didn't find it so it raise the error Now I want to save and load a class definition in order to solve the problem I describe in the question mentioned before. Thank you so much!

    Read the article

< Previous Page | 63 64 65 66 67 68 69 70 71 72 73 74  | Next Page >