Search Results

Search found 19662 results on 787 pages for 'python module'.

Page 67/787 | < Previous Page | 63 64 65 66 67 68 69 70 71 72 73 74  | Next Page >

  • Python 3.1 twitter post with installed library,

    - by Andrew
    I'd like to be able to post twitter messages from python 3.0. None of the twitter API I have looked at support python 3.1. Since the post proceedure only requires this : JSON: curl -u username:password -d status="your message here" http://api.twitter.com/1/statuses/update.json I was wondering if it is possible with the standard libraries to format this so a message could be sent. My head says it should be possible.

    Read the article

  • How can I get the last-modified time with python3 urllib?

    - by Daenyth
    I'm porting over a program of mine from python2 to python3, and I'm hitting the following error: AttributeError: 'HTTPMessage' object has no attribute 'getdate' Here's the code: conn = urllib.request.urlopen(fileslist, timeout=30) last_modified = conn.info().getdate('last-modified') This section worked under python 2.7, and so far I haven't been able to find out the correct method to get this information in python 3.1. The full context is an update method. It pulls new files from a server down to its local database, but only if the file on the server is newer than the local file. If there's a smarter way to achieve this functionality than just comparing local and remote file timestamps, then I'm open to that as well.

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • Python: Is there a way to reflectivly list all attributes of a class

    - by hhafez
    Given a class such as def MyClass text = "hello" number = 123 Is there a way in python to inspect MyClass an determine that it has the two attributes text and number. I can not use something like inspect.getSource(object) because the class I am to get it's attributes for are generate using SWIG (so they are hidden in .so :) ). So I am really looking for something equivalant to Java's [Class.getDeclardFields][1] Any help would be appreciated, otherwise I'll have to solve this problem with SWIG + JAVA instead of SWIG + Python.

    Read the article

  • Eclipse Python Integration

    - by BCS
    I found this python plugin list but thought I'd ask if anyone has any experience with anything listed there? I'm totally new to both python and dynamic programming languages if that makes any difference.

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • copy files to nework path or Drive using python

    - by user218976
    hi , Mine is similar to this question. http://stackoverflow.com/questions/2042342/network-path-and-variables-in-python/2042376 The only difference is my network drive has a password protect with user name and password . I need to copy files to a samba share using python and verify it. if i manually login in then the code works but without logging in the shutil command does not work Thanks

    Read the article

  • Longest common substring from more than two strings - Python

    - by Nicolas Noël
    Hi, I'm looking for a python library for finding the longest common substring from a set of python strings. I'have read that it exist to way to solve this problem : - one using suffix trees - the other using dynamic programming. The method implemented is not important. Otherwise, it is important to have a implementation that can be use for a set of strings and not only two strings Thanks,

    Read the article

  • how to send some data to the Thread module on python and google-map-engine

    - by zjm1126
    from google.appengine.ext import db class Log(db.Model): content = db.StringProperty(multiline=True) class MyThread(threading.Thread): def run(self,request): #logs_query = Log.all().order('-date') #logs = logs_query.fetch(3) log=Log() log.content=request.POST.get('content',None) log.put() def Log(request): thr = MyThread() thr.start(request) return HttpResponse('') error is : Exception in thread Thread-1: Traceback (most recent call last): File "D:\Python25\lib\threading.py", line 486, in __bootstrap_inner self.run() File "D:\zjm_code\helloworld\views.py", line 33, in run log.content=request.POST.get('content',None) NameError: global name 'request' is not defined

    Read the article

  • Latest 100 mentions - Twitter api

    - by laurens
    I'm looking to achieve the following: For a specific person, for example BarackObama, I'd like to get the last 100 times/tweets he was mentioned. Not his own tweets but the tweets of others containing @BarackObama. In the end I'd like to have: the person who mentioned, location, datetime. This content should be written to a flat file. I've been experimenting with the Twitter API and Python, with success but haven't yet succeeded achieving the above problem. I know there is a dev sections on the twitter website but they don't provide any example of code!! https://dev.twitter.com/docs/api/1/get/statuses/mentions count=100 .... For me the scripting language or way of doing is not relevant it's the result. I just read on the internet that python and Twitter api are a good match. Thanks a lot in advance!!

    Read the article

  • Twitter API with urllib2 in python

    - by Dirk Nachbar
    I want to use the Twitter API in Python to lookup user ids from name using the lookup method. I have done similar requests simply using response = urllib2.urlopen('http://search.twitter.com...') but for this one I need authentication. I don't think I can do it through the Google python twitter API because it doesn't have the lookup method. Any ideas how can I can auth with urllib2??

    Read the article

  • Location of global libraries for Python on Mac ?

    - by xTrol
    Hi, Im fighting with installation SIP for Python on Mac OS X. Finally after compilation and installation when I run console form folder of SIP (locally) I can import sipconfig, but when Im in other folder I cant - there is no module called sipconfig. My question is - Where is folder to which I have to copy modules if I want to have them available globally (like "import os"), or how I can check it, because location "/Library/Python/2.6/site-packages/" doesn`t work.

    Read the article

  • How to restore a hidden loadable kernel module from /sys/module and dealing with restoring holders_dir?

    - by user1833005
    I'm playing with kernel module hiding on Linux Kernel 3.x. I try to hide and recover the module from /sys/module. Everything works fine on Kernel Version 3.0 and 3.2.6, I can load and unload the module and hide and unhide it. When I'm unloading the module on kernel 3.6.6 I get the following error: rmmod: ERROR: could not open '/sys/module/xxx/holders': No such file or directory rmmod: ERROR: Module xxx is in use Has anybody an idea how I could restore of the module so that I am able to unload it without errors? Here is my code: /* hide from /sys/module */ kobject_del(&__this_module.mkobj.kobj); list_del(&__this_module.mkobj.kobj.entry); /* add to /sys/module */ kobject_add(&__this_module.mkobj.kobj,__this_module.mkobj.kobj.parent,"xxx"); Thank you four help :)

    Read the article

  • Python required variable style

    - by Adam Nelson
    What is the best style for a Python method that requires the keyword argument 'required_arg': def test_method(required_arg, *args, **kwargs: def test_method(*args, **kwargs): required_arg = kwargs.pop('required_arg') if kwargs: raise ValueError('Unexpected keyword arguments: %s' % kwargs) Or something else? I want to use this for all my methods in the future so I'm kind of looking for the best practices way to deal with required keyword arguments in Python methods.

    Read the article

  • getting previously typed commands in python

    - by womble
    I'm using python 2.5 in windows on a macbook pro with IDLE. How do I get previously typed commands in the python shell? In other operating systems I've managed to do this using 'ctrl' + 'up arrow' or a similar combination. I've tried all likely combinations without success. Thanks.

    Read the article

  • Java's equivalent to bisect in python

    - by systemsfault
    Hello all, Is there a java equivalent to python's bisect library? With python's bisect you can do array bisection with directions. For instance bisect.bisect_left does: Locate the proper insertion point for item in list to maintain sorted order. The parameters lo and hi may be used to specify a subset of the list which should be considered; by default the entire list is used.

    Read the article

  • poplib and email module will not reloop through a message if it has alread read it

    - by user1440925
    I'm currently trying to write a script that gets messages from my gmail account but I'm noticing a problem. If poplib loops through a message in my inbox it will never loop through it again. Here is my code import poplib, string, email user = "[email protected]" password = "p0ckystyx" message = "" mail = poplib.POP3_SSL('pop.gmail.com') mail.user(user) mail.pass_(password) iMessageCount = len(mail.list()[1]) message = "" msg = mail.retr(iMessageCount) str = string.join(msg[1], "\n") frmMail = email.message_from_string(str) for part in frmMail.walk(): if part.get_content_type() == "text/plain": print part.get_payload() mail.quit() Every time I run this script it goes to the next newest email and just skips over the email that was shown last time it was run.

    Read the article

  • programming language implemented in pure python

    - by iamgopal
    hi, i am creating ( researching possibility of ) a highly customizable python client and would like to allow users to actually edit the code in another language to customize the running of program. ( analogous to browser which itself coded in c/c++ and run another language html/js ). so my question is , is there any programming language implemented in pure python which i can see as a reference ( or use directly ? ) -- i need simple language ( simple statements and ifs can do )

    Read the article

  • Python script names in tasklist

    - by Richard
    I am wondering, is there a way to change the name of a script so that it is not called "python.exe" in the tasklist. The reason I am asking is that I am trying to make a batch file that run's a python script. I want the batch file to check to see if the script is already running. if the script is already running then the batch file will do nothing. Thanks

    Read the article

< Previous Page | 63 64 65 66 67 68 69 70 71 72 73 74  | Next Page >