Search Results

Search found 18096 results on 724 pages for 'let me be'.

Page 672/724 | < Previous Page | 668 669 670 671 672 673 674 675 676 677 678 679  | Next Page >

  • How do you combine "Revision Control" with "WorkFlow" for R?

    - by Tal Galili
    Hello all, I remember coming across R users writing that they use "Revision control" (e.g: "Source control"), and I am curious to know: How do you combine "Revision control" with your statistical analysis WorkFlow? Two (very) interesting discussions talk about how to deal with the WorkFlow. But neither of them refer to the revision control element: http://stackoverflow.com/questions/1266279/how-to-organize-large-r-programs http://stackoverflow.com/questions/1429907/workflow-for-statistical-analysis-and-report-writing A Long Update To The Question: Following some of the people's answers, and Dirk's question in the comment, I would like to direct my question a bit more. After reading the Wiki article about "revision control" (which I was previously not familiar with), it was clear to me that when using revision control, what one does is to build a development structure of his code. This structure either leads to a "final product" or to several branches. When building something like, let's say, a website. There is usually one end product you work towards (the website), with some prototypes along the way. But when doing a statistical analysis, the work (to my view) is different. Sometimes you know where you want to get to. But more often, you explore. Explore cleaning the dataset. Explore different methods for statistical analysis, and ask various questions of your data (and I am writing this, knowing how Frank Harrell, and other experience statisticians feels about Data dredging). That is way the WorkFlow question with statistical programming is (in my view) a serious and deep question, raising many issues, The simpler ones are technical: Which revision control software do you use (and why) ? Which IDE do you use(and why) ? The more interesting question are about work process: How do you structure your files? What do you keep as a separate file and what as a revision? or asking in a different way - What should be a "branch" and what should be a "sub project" in your code? For example: When starting to explore your data, should a plot be creating and then erased because it didn't lead any where (but kept as a revision) or should there be a backup file of that path? How you solve this tension was my initial curiosity. The second question is "what might I be missing?". What rules (of thumb) should one follow so to avoid common pitfalls doing statistical programming with version control? In my intuition, I feel that statistical programming is inherently different then software development (I am writing this without being a real expert in statistical programming, and even less so in software development). That's way I am unsure which of the lessons I have read here about version control would be applicable. Thanks a lot, Tal

    Read the article

  • Which network protocol to use for lightweight notification of remote apps?

    - by Chris Thornton
    I have this situation.... Client-initiated SOAP 1.1 communication between one server and let's say, tens of thousands of clients. Clients are external, coming in through our firewall, authenticated by certificate, https, etc.. They can be anywhere, and usually have their own firewalls, NAT routers, etc... They're truely external, not just remote corporate offices. They could be in a corporate/campus network, DSL/Cable, even Dialup. Client uses Delphi (2005 + SOAP fixes from 2007), and the server is C#, but from an architecture/design standpoint, that shouldn't matter. Currently, clients push new data to the server and pull new data from the server on 15-minute polling loop. The server currently does not push data - the client hits the "messagecount" method, to see if there is new data to pull. If 0, it sleeps for another 15 min and checks again. We're trying to get that down to 7 seconds. If this were an internal app, with one or just a few dozen clients, we'd write a cilent "listener" soap service, and would push data to it. But since they're external, sit behind their own firewalls, and sometimes private networks behind NAT routers, this is not practical. So we're left with polling on a much quicker loop. 10K clients, each checking their messagecount every 10 seconds, is going to be 1000/sec messages that will mostly just waste bandwidth, server, firewall, and authenticator resources. So I'm trying to design something better than what would amount to a self-inflicted DoS attack. I don't think it's practical to have the server send soap messages to the client (push) as this would require too much configuration at the client end. But I think there are alternatives that I don't know about. Such as: 1) Is there a way for the client to make a request for GetMessageCount() via Soap 1.1, and get the response, and then perhaps, "stay on the line" for perhaps 5-10 minutes to get additional responses in case new data arrives? i.e the server says "0", then a minute later in response to some SQL trigger (the server is C# on Sql Server, btw), knows that this client is still "on the line" and sends the updated message count of "5"? 2) Is there some other protocol that we could use to "ping" the client, using information gathered from their last GetMessageCount() request? 3) I don't even know. I guess I'm looking for some magic protocol where the client can send a GetMessageCount() request, which would include info for "oh by the way, in case the answer changes in the next hour, ping me at this address...". Also, I'm assuming that any of these "keep the line open" schemes would seriously impact the server sizing, as it would need to keep many thousands of connections open, simultaneously. That would likely impact the firewalls too, I think. Is there anything out there like that? Or am I pretty much stuck with polling? TIA, Chris

    Read the article

  • How do I make a full screen scrolling messagebox or window?

    - by chobo2
    Hi First let me start of saying I know absolutely nothing about c++ and I am really just more interested in getting this to work then learning c++(I got enough on my plate to learn). So basically I am trying to make a terms of service for my windows mobile 6 professional application but it seems I need to use c++ to do it. After hours of searching I found a solution but it developed for windows mobile standard. So they somehow used c++ to make a message box and on standard devices(ie non touch screen phones) the message box can have like scrolling. For some reason this is not the case with professional devices(touch screen devices). So my message box goes off the page and you can never accept or decline the terms. So your stuck and on the screen forever till you do some sort of soft restart. http://www.mobilepractices.com/2008/10/setupdll-sample-and-walkthrough-terms.html The above link is the tutorial but here is the actual file that seems to display the message. #include "stdafx.h" #include "ce_setup.h" // This is a variable containing the text to be displayed // in the Terms & Conditions dialog TCHAR Message[] = _T("TERMS & CONDITIONS\r\n ") _T("Selecting YES you're accepting our terms & conditions.\r\n") _T("This is just a sample application.\r\n") _T("From http://www.mobilepractices.com\r\n") _T("You can replace this text with your own.\r\n") _T("We're using a setup.dll to show this dialog.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Last line.\r\n") ; // This function will be called when the user // tries to install the cab. According to its return // value the installation continues or is cancelled. // As this could be called more than once // (i.e. if there is not enough space on the target) // we should take care about fFirstCall parameter // to show the dialog only once. codeINSTALL_INIT Install_Init( HWND hwndParent, BOOL fFirstCall, BOOL fPreviouslyInstalled, LPCTSTR pszInstallDir ) { if (!fFirstCall || ::MessageBoxW(0, Message, _T("SplashScreenSample") , MB_YESNO) == IDYES) return codeINSTALL_INIT_CONTINUE; else return codeINSTALL_INIT_CANCEL; } So I want to change this to something that can scroll. Can I use like a panel control since I know what has scroll or something else? Thanks

    Read the article

  • Google Code + SVN or GitHub + Git

    - by Nazgulled
    Let me start by telling you that I never used anything besides SVN and I'm also a Windows user. I have a couple of simple projects that are open-source, others are on there way when I'm happy enough to release their source code but either way, I was thinking of using Google Code and SVN to share the source code of my projects instead of providing a link to the source on my website. This as always been a pain cause I had to update the binaries and the code every time I released a new version. This would also help me out to have a backup of my code some where instead of just my local machine (I used to have a local Subversion server running). What I want from a service like this is very simple... I just want a place to store my source code that people can download if they want, allows me to control revisions and provide a simple and easy issue system so people can submit bugs and stuff like that. I guess both of them have this. But I don't want to host any binaries in their websites, I want this to be hosted on my website so I can control download statistics with my own scripts, I also don't have the need for wiki pages as I prefer to have all the documentation in my own website. Does anyone of this services provide a way to "disable" features like wiki and downloads and don't show them at all for my project(s)? Now, I'm sure there are lots of pros and cons about using Google Code with SVN and GitHub with Git (of course) but here's what it's important for me on each one and why I like them: Google Code: As with any Google page, the complexity is almost non-existent Everyone (or almost) as a Google account and this is nice if people want to report problems using the issues system GitHub: May (or may not) be a little more complex (not a problem for me though) than Google's pages but... ...has a much prettier interface than Google's service It needs people to be registered on GitHub to post about issues I like the fact that with Git, you have your own revisions locally (can I use TortoiseGit for this or?) Basically that's it, not much I know... What other, most common, pros and cons can you tell me about each site/software? Keep in mind that my projects are simple, I'm probably the only one who will ever develop these projects on these repositories (or maybe not, for now I will)

    Read the article

  • How do i modify the text content within a specified set of nodes using XSL?

    - by user323719
    I have a list of node ids. I want to append "-Selected" to all the text nodes within the given set of node ids. Please let me know how we can achieve the same using XSL? Input: <node1 id="a"> <node2 id="b"> <node3 id="c" /> <node4 id="d"> <node5 id="e">Text node1</node5> <node6 id="f">Text node2</node6> </node4> </node2> <node7 id="g">Text node3 <node8 id="h" align="center">Text node4</node8> <node9 id="i">Text node5</node9> </node7> <node10 id="j">Text node6 </node10> <node11 id="h">Text node7 </node11> Input Param: List of node ids <xsl:param name="pNodes"> <nodes> <node>4</node> <node>7</node> <node>11</node> </nodes> Expected output: <node1 id="a"> <node2 id="b"> <node3 id="c" /> <node4 id="d"> <node5 id="e">Text node1 - Selected</node5> <node6 id="f">Text node2 - Selected</node6> </node4> </node2> <node7 id="g">Text node3 <node8 id="h" align="center">Text node4 - Selected</node8> <node9 id="i">Text node5 - Selected</node9> </node7> <node10 id="j">Text node6 </node10> <node11 id="h">Text node7 - Selected </node11>

    Read the article

  • Multi-threaded Pooled Allocators

    - by Darren Engwirda
    I'm having some issues using pooled memory allocators for std::list objects in a multi-threaded application. The part of the code I'm concerned with runs each thread function in isolation (i.e. there is no communication or synchronization between threads) and therefore I'd like to setup separate memory pools for each thread, where each pool is not thread-safe (and hence fast). I've tried using a shared thread-safe singleton memory pool and found the performance to be poor, as expected. This is a heavily simplified version of the type of thing I'm trying to do. A lot has been included in a pseudo-code kind of way, sorry if it's confusing. /* The thread functor - one instance of MAKE_QUADTREE created for each thread */ class make_quadtree { private: /* A non-thread-safe memory pool for int linked list items, let's say that it's * something along the lines of BOOST::OBJECT_POOL */ pooled_allocator<int> item_pool; /* The problem! - a local class that would be constructed within each std::list as the * allocator but really just delegates to ITEM_POOL */ class local_alloc { public : //!! I understand that I can't access ITEM_POOL from within a nested class like //!! this, that's really my question - can I get something along these lines to //!! work?? pointer allocate (size_t n) { return ( item_pool.allocate(n) ); } }; public : make_quadtree (): item_pool() // only construct 1 instance of ITEM_POOL per // MAKE_QUADTREE object { /* The kind of data structures - vectors of linked lists * The idea is that all of the linked lists should share a local pooled allocator */ std::vector<std::list<int, local_alloc>> lists; /* The actual operations - too complicated to show, but in general: * * - The vector LISTS is grown as a quadtree is built, it's size is the number of * quadtree "boxes" * * - Each element of LISTS (each linked list) represents the ID's of items * contained within each quadtree box (say they're xy points), as the quadtree * is grown a lot of ID pop/push-ing between lists occurs, hence the memory pool * is important for performance */ } }; So really my problem is that I'd like to have one memory pool instance per thread functor instance, but within each thread functor share the pool between multiple std::list objects.

    Read the article

  • drupal (CMS) or codeigniter (MVC) for creating a new web application?

    - by ajsie
    im going to create a new web application that is very customized. it will contain images, that are fully searchable - in a very, very customized way. when you click on the pictures you can add comments and so on. it requires users to be registered, but the registration/login process will be highly customized too. at the moment im using CodeIgniter for this. But i've read a lot of posts about CMS like Drupal and it sounds like i could let it handle basic stuff, maybe design and other front end work. i have no experience with CMS, in fact, i just started to use a MVC framework like CI and was impressed of how much easier it gets to start developing. so i wonder, if i'm going to create this kind of application, could i use drupal and then add the usual stuff, as i was going to do with CodeIgniter, like controllers, views, models, config files, my own libraries and so on? how does it work on a system like Drupal. how do you code PHP with it as with any MVC framework. it sounds like it has a lot of modules, i just wonder, if i can use it as a MVC framework but have the benefit of having all these basic stuff and design ready to use? cause then it sounds like the best "library" to provide for a web application from scratch. or is it difficult to create a customized app with it? i guess it has modules like images and users, but then how could i customize these so that every image has tags on it and country information, or have every user subscribing to changes to an image, that email will be sent to users and so on? cause i guess its easy to install a module. the question is, how do i customize it. maybe i don't need all that table columns. maybe i want to add/remove business logic. what are the pros and cons with using Drupal for this? is it even the right way to go? can you make a Stackoverflow with Drupal? Facebook? Twitter? Youtube? assuming that you know php of course. share your thoughts cause im totally new on creating a web application! thanks

    Read the article

  • How to use Mozilla ActiveX Control without registry

    - by Andrew McKinlay
    I've been using the IE Browser component that is part of Windows. But I'm running into problems with security settings. For example, users get security warnings on pages with Javascript. So I'm looking at using the Mozilla ActiveX control instead. It's especially nice because it has a compatible interface. It works well if I let it install the control in the registry. But my users don't always have administrator rights to install things in the registry. So I'm trying to figure out how to use the control without registry changes. I'm using DllGetClassObject to get the class factory (IID_ICLASSFACTORY) and then CoRegisterClassObject to register it. All the API calls appear to succeed. And when I create an AtlAxWin window with the CLSID, it also appears to work. But when I try to call Navigate on the AtlAxGetControl it doesn't work - the interface doesn't have Navigate. I would show the code but it's in an obscure language (Suneido) so it wouldn't mean much. An example in C or C++ would be easy for me to translate. Or an example in another dynamic language like Python or Ruby might be helpful. Obviously I'm doing something wrong. Maybe I'm passing the wrong thing to CoRegisterClassObject? The MSDN documentation isn't very clear on what to pass and I haven't found any good examples. Or if there is another approach, I'm ok with that too. Note: I'm using the AtlAxWin window class so I'm not directly creating the control and can't use this approach. Another option is registry free com with a manifest. But again, I couldn't find a good example, especially since I'm not using Visual Studio. I tried to use the MT manifest tool, but couldn't figure it out. I don't think I can use DLL redirection since that doesn't get around the registry issue AFAIK. Another possibility is using WebKit but it seems even harder to use.

    Read the article

  • mysql: can't set max_allowed_package to anything grater than 16MB

    - by sas
    I'm not sure if this is the right place to post these kind of questions, if it's not so, please (politely) let me know... :-) I need to save files greater than 16MB on a mysql database from a php site... I've already changed the c:\xampp\mysql\bin\my.cnf and set max_allowed_packet to 16 MB, and everything worked fine then I set it to 32 MB but there´s no way I can handle a file bigger than 16 MB I get the following error: 'MySQL server has gone away' (the same error I had when max_allowed_packet was set to 1MB) there must be some other setting that doesn´t allow me to handle files bigger than 16MB maybe the php client, I guess, but I don't know where to edit it this is the code I'm running when file.txt is smaller than 16.776.192 bytes long, it works fine, but if file.txt has 16.777.216 bytes i get the aforementioned error oh, and the field download.content is a longblob... $file = 'file.txt'; $file_handle = fopen( $file, 'r' ); $content = fread( $file_handle, filesize( $file ) ); fclose( $file_handle ); db_execute( 'truncate table download', true ); $sql = "insert into download( code, title, name, description, original_name, mime_type, size, content, user_insert_id, date_insert, user_update_id, date_update ) values ( 'new file', 'new file', 'sas.jpg', 'new file', '$file', 'mime', " . filesize( $file ) . ", '" . addslashes( $content ) . "', 0, " . db_char_to_sql( now_char(), 'datetime' ) . ", 0, " . db_char_to_sql( now_char(), 'datetime' ) . " )"; db_execute( $sql, true ); (the db_execute funcion just opens the connections and executes the sql stuff) running on windows XP sp2 server version: 5.0.67-community PHP Version 4.4.9 mysql client API version: 3.23.49 using: ApacheFriends XAMPP (Basispaket) version 1.6.8 that comes with + Apache 2.2.9 + MySQL 5.0.67 (Community Server) + PHP 5.2.6 + PHP 4.4.9 + PEAR + phpMyAdmin 2.11.9.2 ... this is part of the content of c:\xampp\mysql\bin\my.cnf # The MySQL server [mysqld] port= 3306 socket= "C:/xampp/mysql/mysql.sock" basedir="C:/xampp/mysql" tmpdir="C:/xampp/tmp" datadir="C:/xampp/mysql/data" skip-locking key_buffer = 16M # max_allowed_packet = 1M max_allowed_packet = 32M table_cache = 128 sort_buffer_size = 512K net_buffer_length = 8K read_buffer_size = 256K read_rnd_buffer_size = 512K myisam_sort_buffer_size = 8M

    Read the article

  • Expandable list with animated effect

    - by Naveen Chauhan
    I am using this animation class to create the animation when i shrink and expand the list on some click event import android.view.View; import android.view.animation.Animation; import android.view.animation.Transformation; import android.widget.LinearLayout.LayoutParams; public class ExpandAnimation extends Animation{ private View mAnimatedView; private LayoutParams mViewLayoutParams; private int mMarginStart, mMarginEnd; private boolean mIsVisibleAfter = false; private boolean mWasEndedAlready = false; public ExpandAnimation(View view, int duration){ setDuration(duration); mAnimatedView = view; System.out.println(view.getVisibility()); mViewLayoutParams = (LayoutParams)view.getLayoutParams(); mIsVisibleAfter = (view.getVisibility() == View.VISIBLE); System.out.println("mIsVisibleAfter:- "+ mIsVisibleAfter); mMarginStart = mViewLayoutParams.bottomMargin; System.out.println("mMarginStart:- "+ mMarginStart); mMarginEnd = (mMarginStart == 0 ?(0 - view.getHeight()):0); System.out.println("mMarginEnd:- "+mMarginEnd); view.setVisibility(View.VISIBLE); } @Override protected void applyTransformation(float interpolatedTime, Transformation t){ super.applyTransformation(interpolatedTime, t); System.out.println("mMarginEnd:- "+interpolatedTime); if(interpolatedTime<1.0f){ System.out.println("Inside if true"); mViewLayoutParams.bottomMargin = mMarginStart + (int) ((mMarginEnd - mMarginStart)*interpolatedTime); System.out.println("mViewLayoutParams.bottomMargin:- "+mViewLayoutParams.bottomMargin); mAnimatedView.requestLayout(); }else if(!mWasEndedAlready){ mViewLayoutParams.bottomMargin = mMarginEnd; mAnimatedView.requestLayout(); System.out.println("mIsVisibleAfter:- "+mIsVisibleAfter); if(mIsVisibleAfter){ mAnimatedView.setVisibility(View.GONE); } mWasEndedAlready = true; } } } i am using following lines on some click event in my activity class to create the object of my animation class View toolbar = (View) findViewById(R.id.toolbar1); ExpandAnimation expandani = new ExpandAnimation(toolbar,500); toolbar.startAnimation(expandani); My probem is that when click event occurs, my list expand and then shrink but it must stop when it grows completely and shrink when i click on up image. please let me know that how my animation class is working. i have also tried myself by using SOP statements which you can see in my animation class.

    Read the article

  • printf anomaly after "fork()"

    - by pechenie
    OS: Linux, Language: pure C I'm moving forward in learning C progpramming in general, and C programming under UNIX in a special case :D So, I detected a strange (as for me) behaviour of the printf() function after using a fork() call. Let's take a look at simple test program: #include <stdio.h> #include <system.h> int main() { int pid; printf( "Hello, my pid is %d", getpid() ); pid = fork(); if( pid == 0 ) { printf( "\nI was forked! :D" ); sleep( 3 ); } else { waitpid( pid, NULL, 0 ); printf( "\n%d was forked!", pid ); } return 0; } In this case the output looks like: Hello, my pid is 1111 I was forked! :DHello, my pid is 1111 2222 was forked! Why the second "Hello" string occured in the child's output? Yes, it is exactly what the parent printed on it's start, with the parent's pid. But! If we place '\n' character in the end of each string we got the expected output: #include <stdio.h> #include <system.h> int main() { int pid; printf( "Hello, my pid is %d\n", getpid() ); // SIC!! pid = fork(); if( pid == 0 ) { printf( "I was forked! :D" ); //removed the '\n', no matter sleep( 3 ); } else { waitpid( pid, NULL, 0 ); printf( "\n%d was forked!", pid ); } return 0; } And the output looks like: Hello, my pid is 1111 I was forked! :D 2222 was forked! Why does it happen? Is it ... ummm ... correct behaviour? Or it's a kind of the 'bug'?

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • Is this postgres function cost efficient or still have to clean

    - by kiranking
    There are two tables in postgres db. english_all and english_glob First table contains words like international,confidential,booting,cooler ...etc I have written the function to get the words from english_all then perform for loop for each word to get word list which are not inserted in anglish_glob table. Word list is like I In Int Inte Inter .. b bo boo boot .. c co coo cool etc.. for some reason zwnj(zero-width non-joiner) is added during insertion to english_all table. But in function I am removing that character with regexp_replace. Postgres function for_loop_test is taking two parameter min and max based on that I am selecting words from english_all table. function code is like DECLARE inMinLength ALIAS FOR $1; inMaxLength ALIAS FOR $2; mviews RECORD; outenglishListRow english_word_list;--custom data type eng_id,english_text BEGIN FOR mviews IN SELECT id,english_all_text FROM english_all where wlength between inMinLength and inMaxLength ORDER BY english_all_text limit 30 LOOP FOR i IN 1..char_length(regexp_replace(mviews.english_all_text,'(?)$','')) LOOP FOR outenglishListRow IN SELECT distinct on (regexp_replace((substring(mviews.english_all_text from 1 for i)),'(?)$','')) mviews.id, regexp_replace((substring(mviews.english_all_text from 1 for i)),'(?)$','') where regexp_replace((substring(mviews.english_all_text from 1 for i)),'(?)$','') not in(select english_glob.english_text from english_glob where i=english_glob.wlength) order by regexp_replace((substring(mviews.english_all_text from 1 for i)),'(?)$','') LOOP RETURN NEXT outenglishListRow; END LOOP; END LOOP; END LOOP; END; Once I get the word list I will insert that into another table english_glob. My question is is there any thing I can add to or remove from function to make it more efficient. edit Let assume english_all table have words like footer,settle,question,overflow,database,kingdom If inMinLength = 5 and inmaxLength=7 then in the outer loop footer,settle,kingdom will be selected. For above 3 words inner two loop will apply to get words like f,fo,foo,foot,foote,footer,s,se,set,sett,settl .... etc. In the final process words which are bold will be entered into english_glob with another parameter like 1 to denote it is a proper word and stored in the another filed of english_glob table. Remaining word will be stored with another parameter 0 because in the next call words which are saved in database should not be fetched again. edit2: This is a complete code CREATE TABLE english_all ( id serial NOT NULL, english_all_text text NOT NULL, wlength integer NOT NULL, CONSTRAINT english_all PRIMARY KEY (id), CONSTRAINT english_all_kan_text_uq_id UNIQUE (english_all_text) ) CREATE TABLE english_glob ( id serial NOT NULL, english_text text NOT NULL, is_prop integer default 1, CONSTRAINT english_glob PRIMARY KEY (id), CONSTRAINT english_glob_kan_text_uq_id UNIQUE (english_text) ) insert into english_all(english_text) values ('ant'),('forget'),('forgive'); on function call with parameter 3 and 6 fallowing rows should fetched a an ant f fo for forg forge forget next is insert to another table based on above row insert into english_glob(english_text,is_prop) values ('a',1),('an',1), ('ant',1),('f',0), ('fo',0),('for',1), ('forg',0),('forge',1), ('forget',1), on function call next time with parameter 3 and 7 fallowing rows should fetched.(because f,fo,for,forg are all entered in english_glob table) forgi forgiv forgive

    Read the article

  • Change the Session Variable Output

    - by user567230
    Hello I am using Dreamweaver CS5 with Coldfusion 9 to build a dynamic website. I have a MS Access Database that stores login information which includes ID, FullName, FirstName, LastName, Username, Pawword, AcessLevels. My question is this: I currently have session variable to track the Username when it is entered into the login page. However I would like to use that Username to pull the User's FullName to display throughout the web pages and use for querying data. How do I change the session variable to read that when they are not entering their FullName on the login page but only Username and password. I have listed my login information code below if there is any additional information needed please let me know. This is the path for which the FullName values reside DataSource "Access" Table "Logininfo" Field "FullName" I want the FullName to be unique based on the Username submitted from the Login page. I apologize in advance for any rookie mistake I may have made I am new to this but learning fast! Ha. <cfif IsDefined("FORM.username")> <cfset MM_redirectLoginSuccess="members_page.cfm"> <cfset MM_redirectLoginFailed="sorry.cfm"> <cfquery name="MM_rsUser" datasource="Access"> SELECT FullName, Username,Password,AccessLevels FROM Logininfo WHERE Username=<cfqueryparam value="#FORM.username#" cfsqltype="cf_sql_clob" maxlength="50"> AND Password=<cfqueryparam value="#FORM.password#" cfsqltype="cf_sql_clob" maxlength="50"> </cfquery> <cfif MM_rsUser.RecordCount NEQ 0> <cftry> <cflock scope="Session" timeout="30" type="Exclusive"> <cfset Session.MM_Username=FORM.username> <cfset Session.MM_UserAuthorization=MM_rsUser.AccessLevels[1]> </cflock> <cfif IsDefined("URL.accessdenied") AND false> <cfset MM_redirectLoginSuccess=URL.accessdenied> </cfif> <cflocation url="#MM_redirectLoginSuccess#" addtoken="no"> <cfcatch type="Lock"> <!--- code for handling timeout of cflock ---> </cfcatch> </cftry> </cfif> <cflocation url="#MM_redirectLoginFailed#" addtoken="no"> <cfelse> <cfset MM_LoginAction=CGI.SCRIPT_NAME> <cfif CGI.QUERY_STRING NEQ ""> <cfset MM_LoginAction=MM_LoginAction & "?" & XMLFormat(CGI.QUERY_STRING)> </cfif> </cfif>

    Read the article

  • Hibernate Communications Link Failure in Restlet-Hibernate Based Java application powered by MySQL

    - by Vatsala
    Let me describe my question - I have a Java application - Hibernate as the DB interfacing layer over MySQL. I get the communications link failure error in my application. The occurence of this error is a very specific case. I get this error , When I leave mysql server unattended for more than approximately 6 hours (i.e. when there are no queries issued to MySQL for more than approximately 6 hours). I am pasting a top 'exception' level description below, and adding a pastebin link for a detailed stacktrace description. javax.persistence.PersistenceException: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: java.net.ConnectException: Connection refused: connect the link to the pastebin for further investigation - http://pastebin.com/4KujAmgD What I understand from these exception statements is that MySQL is refusing to take in any connections after a period of idle/nil activity. I have been reading up a bit about this via google search, and came to know that one of the possible ways to overcome this is to set values for c3p0 properties as c3p0 comes bundled with Hibernate. Specifically, I read from here http://www.mchange.com/projects/c3p0/index.html that setting two properties idleConnectionTestPeriod and preferredTestQuery will solve this for me. But these values dont seem to have had an effect. Is this the correct approach to fixing this? If not, what is the right way to get over this? The following are related Communications Link Failure questions at stackoverflow.com, but I've not found a satisfactory answer in their answers. http://stackoverflow.com/questions/2121829/java-db-communications-link-failure http://stackoverflow.com/questions/298988/how-to-handle-communication-link-failure Note 1 - i dont get this error when I am using my application continuosly. Note 2 - I use JPA with Hibernate and hence my hibernate.dialect,etc hibernate properties reside within the persistence.xml in the META-INF folder (does that prevent the c3p0 properties from working?)

    Read the article

  • Add jquery link to returned text...

    - by Jerry
    Hi all I am trying to add two jquery plugins files to my application. When a user triggers my ajax event, the server will return text with a form button. The plugins (a jquery calendar) will work when the user clicks the form button inside the returned text . I believe I have to add the link inside the return text instead of the main page to let the code work, but not sure how to do this. I am giving out my code and need you experts opinions. Thanks. My main page html //required jquery plugins ...didn't work if I add them in the main application. <script type="text/javascript" src="JS/date.js"></script> <script type="text/javascript" src="JS/datePicker.js"></script> <script type="text/javascript" src="JS/selectWeek.js"></script> <div id="gameInfo"> //return text will be displayed here. </div> My returned text ...part of it.... <form> <div id=returnDiv> // the form input will be added here when a user clicks #addMatch button... </div> <tr> <td><input type="button" id="addMatch" name="addMatch" value="Add Match"/> </td> </tr> </form> My jquery $("#addMatch").live('click', function(){ //the code below will create a calender when a user click the link...I am not sure //where I should add my two jquery plugins link... $("#returnDiv").html("<td><input type='text' size='6' class='date-pick dp-applied'"+ "name='date'><a style='color:white;' class='dp-choose-date' title='Choose Date'"+ "href='#'>Date</a></td>"; return false; }); I hope I explain my question well. +1 to any reply...:D

    Read the article

  • Running daemon through rsh

    - by Max
    I want to run program as daemon in remote machine in Unix. I have rsh connection and I want the program to be running after disconnection. Suppose I have two programs: util.cpp and forker.cpp. util.cpp is some utility, for our purpose let it be just infinite root. util.cpp int main() { while (true) {}; return 0; } forker.cpp takes some program and run it in separe process through fork() and execve(): forker.cpp #include <stdio.h> #include <errno.h> #include <stdlib.h> #include <unistd.h> int main(int argc, char** argv) { if (argc != 2) { printf("./a.out <program_to_fork>\n"); exit(1); } pid_t pid; if ((pid = fork()) < 0) { perror("fork error."); exit(1); } else if (!pid) { // Child. if (execve(argv[1], &(argv[1]), NULL) == -1) { perror("execve error."); exit(1); } } else { // Parent: do nothing. } return 0; } If I run: ./forker util forker is finished very quickly, and bash 'is not paused', and util is running as daemon. But if I run: scp forker remote_server://some_path/ scp program remote_server://some_path/ rsh remote_server 'cd /some_path; ./forker program' then it is all the same (i.e. at the remote_sever forker is finishing quickly, util is running) but my bash in local machine is paused. It is waiting for util stopping (I checked it. If util.cpp is returning than it is ok.), but I don't understand why?! There are two questions: 1) Why is it paused when I run it through rsh? I am sure that I chose some stupid way to run daemon. So 2) How to run some program as daemon in C/C++ in unix-like platforms. Tnx!

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • What's the C strategy to "imitate" a C++ template ?

    - by Andrei Ciobanu
    After reading some examples on stackoverflow, and following some of the answers for my previous questions (1), I've eventually come with a "strategy" for this. I've come to this: 1) Have a declare section in the .h file. Here I will define the data-structure, and the accesing interface. Eg.: /** * LIST DECLARATION. (DOUBLE LINKED LIST) */ #define NM_TEMPLATE_DECLARE_LIST(type) \ typedef struct nm_list_elem_##type##_s { \ type data; \ struct nm_list_elem_##type##_s *next; \ struct nm_list_elem_##type##_s *prev; \ } nm_list_elem_##type ; \ typedef struct nm_list_##type##_s { \ unsigned int size; \ nm_list_elem_##type *head; \ nm_list_elem_##type *tail; \ int (*cmp)(const type e1, const type e2); \ } nm_list_##type ; \ \ nm_list_##type *nm_list_new_##type##_(int (*cmp)(const type e1, \ const type e2)); \ \ (...other functions ...) 2) Wrap the functions in the interface inside MACROS: /** * LIST INTERFACE */ #define nm_list(type) \ nm_list_##type #define nm_list_elem(type) \ nm_list_elem_##type #define nm_list_new(type,cmp) \ nm_list_new_##type##_(cmp) #define nm_list_delete(type, list, dst) \ nm_list_delete_##type##_(list, dst) #define nm_list_ins_next(type,list, elem, data) \ nm_list_ins_next_##type##_(list, elem, data) (...others...) 3) Implement the functions: /** * LIST FUNCTION DEFINITIONS */ #define NM_TEMPLATE_DEFINE_LIST(type) \ nm_list_##type *nm_list_new_##type##_(int (*cmp)(const type e1, \ const type e2)) \ {\ nm_list_##type *list = NULL; \ list = nm_alloc(sizeof(*list)); \ list->size = 0; \ list->head = NULL; \ list->tail = NULL; \ list->cmp = cmp; \ }\ void nm_list_delete_##type##_(nm_list_##type *list, \ void (*destructor)(nm_list_elem_##type elem)) \ { \ type data; \ while(nm_list_size(list)){ \ data = nm_list_rem_##type(list, tail); \ if(destructor){ \ destructor(data); \ } \ } \ nm_free(list); \ } \ (...others...) In order to use those constructs, I have to create two files (let's call them templates.c and templates.h) . In templates.h I will have to NM_TEMPLATE_DECLARE_LIST(int), NM_TEMPLATE_DECLARE_LIST(double) , while in templates.c I will need to NM_TEMPLATE_DEFINE_LIST(int) , NM_TEMPLATE_DEFINE_LIST(double) , in order to have the code behind a list of ints, doubles and so on, generated. By following this strategy I will have to keep all my "template" declarations in two files, and in the same time, I will need to include templates.h whenever I need the data structures. It's a very "centralized" solution. Do you know other strategy in order to "imitate" (at some point) templates in C++ ? Do you know a way to improve this strategy, in order to keep things in more decentralized manner, so that I won't need the two files: templates.c and templates.h ?

    Read the article

  • C++ - Breaking code implementation into different parts

    - by Kotti
    Hi! The question plot (a bit abstract, but answering this question will help me in my real app): So, I have some abstract superclass for objects that can be rendered on the screen. Let's call it IRenderable. struct IRenderable { // (...) virtual void Render(RenderingInterface& ri) = 0; virtual ~IRenderable() { } }; And suppose I also have some other objects that derive from IRenderable, e.g. Cat and Dog. So far so good. I add some Cat and Dog specific methods, like SeekForWhiskas(...) and Bark(...). After that I add specific Render(...) method for them, so my code looks this way: class Cat : public IRenderable { public: void SeekForWhiskas(...) { // Implementation could be here or moved // to a source file (depends on me wanting // to inline it or not) } virtual void Render(...) { // Here comes the rendering routine, that // is specific for cats SomehowDrawAppropriateCat(...); } }; class Dog : public IRenderable { public: void Bark(...) { // Same as for 'SeekForWhiskas(...)' } virtual void Render(...) { // Here comes the rendering routine, that // is specific for dogs DrawMadDog(...); } }; And then somewhere else I can do drawing the way that an appropriate rendering routine is called: IRenderable* dog = new Dog(); dog->Render(...); My question is about logical wrapping of such kind of code. I want to break apart the code, that corresponds to rendering of the current object and it's own methods (Render and Bark in this example), so that my class implementation doesn't turn into a mess (imagine that I have 10 methods like Bark and of course my Render method doesn't fit in their company and would be hard to find). Two ways of making what I want to (as far as I know) are: Making appropriate routines that look like RenderCat(Cat& cat, RenderInterface* ri), joining them to render namespace and then the functions inside a class would look like virtual void Render(...) { RenderCat(*this, ...); }, but this is plain stupid, because I'll lose access to Cat's private members and friending these functions looks like a total design disaster. Using visitor pattern, but this would also mean I have to rebuild my app's design and looks like an inadequate way to make my code complicated from the very beginning. Any brilliant ideas? :)

    Read the article

  • How to discover classes with [Authorize] attributes using Reflection in C#? (or How to build Dynamic

    - by Pretzel
    Maybe I should back-up and widen the scope before diving into the title question... I'm currently writing a web app in ASP.NET MVC 1.0 (although I do have MVC 2.0 installed on my PC, so I'm not exactly restricted to 1.0) -- I've started with the standard MVC project which has your basic "Welcome to ASP.NET MVC" and shows both the [Home] tab and [About] tab in the upper-right corner. Pretty standard, right? I've added 4 new Controller classes, let's call them "Astronomer", "Biologist", "Chemist", and "Physicist". Attached to each new controller class is the [Authorize] attribute. For example, for the BiologistController.cs [Authorize(Roles = "Biologist,Admin")] public class BiologistController : Controller { public ActionResult Index() { return View(); } } These [Authorize] tags naturally limit which user can access different controllers depending on Roles, but I want to dynamically build a Menu at the top of my website in the Site.Master Page based on the Roles the user is a part of. So for example, if JoeUser was a member of Roles "Astronomer" and "Physicist", the navigation menu would say: [Home] [Astronomer] [Physicist] [About] And naturally, it would not list links to "Biologist" or "Chemist" controller Index page. Or if "JohnAdmin" was a member of Role "Admin", links to all 4 controllers would show up in the navigation bar. Ok, you prolly get the idea... Starting with the answer from this StackOverflow topic about Dynamic Menu building in ASP.NET, I'm trying to understand how I would fully implement this. (I'm a newbie and need a little more guidance, so please bare with me.) The answer proposes Extending the Controller class (call it "ExtController") and then have each new WhateverController inherit from ExtController. My conclusion is that I would need to use Reflection in this ExtController Constructor to determine which Classes and Methods have [Authorize] attributes attached to them to determine the Roles. Then using a Static Dictionary, store the Roles and Controllers/Methods in key-value pairs. I imagine it something like this: public class ExtController : Controller { protected static Dictionary<Type,List<string>> ControllerRolesDictionary; protected override void OnActionExecuted(ActionExecutedContext filterContext) { // build list of menu items based on user's permissions, and add it to ViewData IEnumerable<MenuItem> menu = BuildMenu(); ViewData["Menu"] = menu; } private IEnumerable<MenuItem> BuildMenu() { // Code to build a menu SomeRoleProvider rp = new SomeRoleProvider(); foreach (var role in rp.GetRolesForUser(HttpContext.User.Identity.Name)) { } } public ExtController() { // Use this.GetType() to determine if this Controller is already in the Dictionary if (!ControllerRolesDictionary.ContainsKey(this.GetType())) { // If not, use Reflection to add List of Roles to Dictionary // associating with Controller } } } Is this doable? If so, how do I perform Reflection in the ExtController constructor to discover the [Authorize] attribute and related Roles (if any) ALSO! Feel free to go out-of-scope on this question and suggest an alternate way of solving this "Dynamic Site.Master Menu based on Roles" problem. I'm the first to admit that this may not be the best approach.

    Read the article

  • [CakePHP] I am so confused. What should I write in the default.ctp

    - by kwokwai
    Hi all, I am learning cakePHP, everything seems alright except that I am very confused of how to make use of the default.ctp and what should be put inside the Elements folder. Here is the default.ctp file that I have been using since my very first lesson on learning cakePHP: (I copied from this URL http://book.cakephp.org/view/96/Layouts) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title><?php echo $title_for_layout?></title> <link rel="shortcut icon" href="favicon.ico" type="image/x-icon"> <!-- Include external files and scripts here (See HTML helper for more info.) --> <?php echo $scripts_for_layout ?> </head> <body> <!-- If you'd like some sort of menu to show up on all of your views, include it here --> <div id="header"> <div id="menu">...</div> </div> <!-- Here's where I want my views to be displayed --> <?php echo $content_for_layout ?> <!-- Add a footer to each displayed page --> <div id="footer">...</div> </body> </html> But the problem is that the layout will take effect to all web pages that I have created. Let's see the case that I have recently encountered. In one of the .ctp files, I need to use JQuery function and I need to ass some and tags in the .ctp file. Here are the and tags I used: <Script language="javascript"> $(document).ready(function() { // some functions here }); </Script> <style type="text/css"> { #toppage{ width:800px; } But when I followed the default.ctp file, I noticed that these tags (i.e. and ) happened to appear below the tag. As far as I know, the and self-defined Javascript functions should be put inside the tag of the HTML instead. I have considered to add the and in the default.ctp file, but then these codes would appear in every web pages instead of just a particular web page. Please help.

    Read the article

  • Regular expression to convert ul to textindent and back, with a different attribute value for first

    - by chapmanio
    Hi, This is a related to a previous question I have asked here, see the link below for a brief description as to why I am trying to do this. Regular expression from font to span (size and colour) and back (VB.NET) Basically I need a regex replace function (or if this can be done in pure VB then that's fine) to convert all ul tags in a string to textindent tags, with a different attribute value for the first textindent tag. For example: <ul> <li>This is some text</li> <li>This is some more text</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> </ul> Will become: <textformat indent="0"> <li>This is some text</li> <li>This is some more text</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> </textformat> Basically I want the first ul tag to have no indenting, but all nested ul tags to have an indent of 20. I appreciate this is a strange request but hopefully that makes sense, please let me know if you have any questions. Thanks in advance.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Wordpress pages address rewrite

    - by kemp
    UPDATE I tried using the internal wordpress rewrite. What I have to do is an address like this: http://example.com/galleria/artist-name sent to the gallery.php page with a variable containing the artist-name. I used these rules as per Wordpress' documentation: // REWRITE RULES (per gallery) {{{ add_filter('rewrite_rules_array','wp_insertMyRewriteRules'); add_filter('query_vars','wp_insertMyRewriteQueryVars'); add_filter('init','flushRules'); // Remember to flush_rules() when adding rules function flushRules(){ global $wp_rewrite; $wp_rewrite->flush_rules(); } // Adding a new rule function wp_insertMyRewriteRules($rules) { $newrules = array(); $newrules['(galleria)/(.*)$'] = 'index.php?pagename=gallery&galleryname=$matches[2]'; return $newrules + $rules; } // Adding the id var so that WP recognizes it function wp_insertMyRewriteQueryVars($vars) { array_push($vars, 'galleryname'); return $vars; } what's weird now is that on my local wordpress test install, that works fine: the gallery page is called and the galleryname variable is passed. On the real site, on the other hand, the initial URL is accepted (as in it doesn't go into a 404) BUT it changes to http://example.com/gallery (I mean it actually changes in the browser's address bar) and the variable is not defined in gallery.php. Any idea what could possibly cause this different behavior? Alternatively, any other way I couldn't think of which could achieve the same effect described in the first three lines is perfectly fine. Old question What I need to do is rewriting this address: (1) http://localhost/wordpress/fake/text-value to (2) http://localhost/wordpress/gallery?somevar=text-value Notes: the remapping must be transparent: the user always has to see address (1) gallery is a permalink to a wordpress page, not a real address I basically need to rewrite the address first (to modify it) and then feed it back to mod rewrite again (to let wordpress parse it its own way). Problems if I simply do RewriteRule ^fake$ http://localhost/wordpress/gallery [L] it works but the address in the browser changes, which is no good, if I do RewriteRule ^fake$ /wordpress/gallery [L] I get a 404. I tried different flags instead of [L] but to no avail. How can I get this to work? EDIT: full .htaccess # BEGIN WordPress <IfModule mod_rewrite.c> RewriteEngine On RewriteRule ^fake$ /wordpress/gallery [R] RewriteBase /wordpress/ RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule . /wordpress/index.php [L] </IfModule> # END WordPress

    Read the article

< Previous Page | 668 669 670 671 672 673 674 675 676 677 678 679  | Next Page >