Search Results

Search found 32375 results on 1295 pages for 'dnn module development'.

Page 673/1295 | < Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >

  • Ruby's autoload not working in 1.8.7 or Ruby Enterprise?

    - by webren
    I've written a gem and within a file I am doing this to autoload my main gem logic: $:.push File.expand_path('lib', __FILE__) require "oa-casport/version" require 'omniauth/core' module OmniAuth module Strategies autoload :Casport, 'omniauth/strategies/casport' end end For Ruby versions 1.8.7 and ree, it prints out "no such file to load - omniauth/strategies/casport' But it doesn't print out this message on version 1.9.2. Is there something off with the location of calling autoload? The repo for the gem is located at https://github.com/stevenhaddox/oa-casport

    Read the article

  • logger chain in python

    - by Zaar Hai
    I'm writing python package/module and would like the logging messages mention what module/class/function they come from. I.e. if I run this code: import mymodule.utils.worker as worker w = worker.Worker() w.run() I'd like to logging messages looks like this: 2010-06-07 15:15:29 INFO mymodule.utils.worker.Worker.run <pid/threadid>: Hello from worker How can I accomplish this? Thanks.

    Read the article

  • How to get all usages/references of control in DotNetNuke?

    - by macias
    Sorry for lame question but I am literally starting with DNN. When you are in admin/design mode you can list all modules used, and when you click on module at the end you will see the list of controls used in this module with info about filename of the source. The problem I have is in reverse -- I already know the filename with source, I would like to list all modules which use this control. How to do it?

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • selecting the first of multiple classes

    - by gleddy
    Not sure if you can do this, but I want to select the first of two classes of an element with jQuery and return it's first class only. <div class="module blue"> I want to return 'module'. tried this: var state = $('body').attr('class').first(); but none of that seems to work, thanks for any advice.

    Read the article

  • ruby nested classes and modules

    - by ash34
    Hi, I am familiar with the concept of nesting classes and modules within another module and grouping them in a namespace. What is the idea / purpose behind Nesting classes within another class class A class B def method_B ... end end end 2.Nesting modules within another class class A module c def method_c ... end end end thanks, ash

    Read the article

  • Corrupt UTF-8 Characters with PHP 5.2.10 and MySQL 5.0.81

    - by jkndrkn
    We have an application hosted on both a local development server and a live site. We are experiencing UTF-8 corruption issues and are looking to figure out how to resolve them. The system is run using symfony 1.0 with Propel. On our development server, we are running PHP 5.2.0 and MySQL 5.0.32. We do not experience corrupted UTF-8 characters there. On our live site, PHP 5.2.10 and MySQL 5.0.81 is running. On that server, certain characters such as ô´ and S are corrupted once they are stored in the database. The corrupted characters are showing up as either question marks or approximations of the original character with adjacent question marks. Examples of corruption: Uncorrupted: ô´ Corrupted: ô? Uncorrupted: S Corrupted: ? We are currently using the following techniques on both development and live servers: Executing the following queries prior to execution of any other queries: SET NAMES 'utf8' COLLATE 'utf8_unicode_ci' SET CHARSET 'utf8' Setting the <meta> Content-Type value to: <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> Adding the following to our .htaccess file: AddDefaultCharset utf-8 Using mb_* (multibyte) PHP functions where necessary. Being sure to set database columns to use utf8_unicode_ci collation. These techniques are sufficient for our development site, but do not work on the live site. On the live site I've also tried adding mysql_set_encoding('ut8', $mysql_connection) but this does not help either. I have found some evidence that newer versions of PHP and MySQL are mishandling UTF-8 character encodings.

    Read the article

  • Silverlight vs Flex

    - by 1kevgriff
    My company develops several types of applications. A lot of our business comes from doing multimedia-type apps, typically done in Flash. However, now that side of the house is starting to migrate towards doing Flex development. Most of our other development is done using .NET. I'm trying to make a push towards doing Silverlight development instead, since it would take better advantage of the .NET developers on staff. I prefer the Silverlight platform over the Flex platform for the simple fact that Silverlight is all .NET code. We have more .NET developers on staff than Flash/Flex developers, and most of our Flash/Flex developers are graphic artists (not real programmers). Only reason they push towards Flex right now is because it seems like the logical step from Flash. I've done development using both, and I honestly believe Silverlight is easier to work with. But I'm trying to convince people who are only Flash developers. So here's my question: If I'm going to go into a meeting to praise Silverlight, why would a company want to go with Silverlight instead of Flex? Other than the obvious "not everyone has Silverlight", what are the pros and cons for each?

    Read the article

  • AngularJS service returning promise unit test gives error No more request expected

    - by softweave
    I want to test a service (Bar) that invokes another service (Foo) and returns a promise. The test is currently failing with this error: Error: Unexpected request: GET foo.json No more request expected Here are the service definitions: // Foo service returns new objects having get function returning a promise angular.module('foo', []). factory('Foo', ['$http', function ($http) { function FooFactory(config) { var Foo = function (config) { angular.extend(this, config); }; Foo.prototype = { get: function (url, params, successFn, errorFn) { successFn = successFn || function (response) {}; errorFn = errorFn || function (response) {}; return $http.get(url, {}).then(successFn, errorFn); } }; return new Foo(config); }; return FooFactory; }]); // Bar service uses Foo service angular.module('bar', ['foo']). factory('Bar', ['Foo', function (Foo) { var foo = Foo(); return { getCurrentTime: function () { return foo.get('foo.json', {}, function (response) { return Date.parse(response.data.now); }); } }; }]); Here is my current test: 'use strict'; describe('bar tests', function () { var currentTime, currentTimeInMs, $q, $rootScope, mockFoo, mockFooFactory, Foo, Bar, now; currentTime = "March 26, 2014 13:10 UTC"; currentTimeInMs = Date.parse(currentTime); beforeEach(function () { // stub out enough of Foo to satisfy Bar service: // create mock object with function get: function(url, params, successFn, errorFn) // that promises to return a response with this property // { data: { now: "March 26, 2014 13:10 UTC" }}) mockFoo = { get: function (url, params, successFn, errorFn) { successFn = successFn || function (response) {}; errorFn = errorFn || function (response) {}; // setup deferred promise var deferred = $q.defer(); deferred.resolve({data: { now: currentTime }}); return (deferred.promise).then(successFn, errorFn); } }; // create mock Foo service mockFooFactory = function(config) { return mockFoo; }; module(function ($provide) { $provide.value('Foo', mockFooFactory); }); module('bar'); inject(function (_$q_, _$rootScope_, _Foo_, _Bar_) { $q = _$q_; $rootScope = _$rootScope_; Foo = _Foo_; Bar = _Bar_; }); }); it('getCurrentTime should return currentTimeInMs', function () { Bar.getCurrentTime().then(function (serverCurrentTime) { now = serverCurrentTime; }); $rootScope.$apply(); // resolve Bar promise expect(now).toEqual(currentTimeInMs); }); }); The error is being thrown at $rootScope.$apply(). I also tried using $rootScope.$digest(), but it gives the same error. Thanks in advance for any insight you can give me.

    Read the article

  • APE engine Mysql push data to channel on insert

    - by Fotis
    Hello, i am working with APE Engine (http://www.ape-project.org) and up until now i had no actual problem. The problem is that i would like to use the MySQL module and push data to a channel each time a row is inserted into a table. I've tried to setup a server side module, i created an SQL query but data is fetched only when the server boots. How can i make this work?

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • Use symfony 1.4 without changing apache configuration

    - by aRagnis
    Is it possible to set the /web directory as webroot whithout changing apache configuration file? I tried using the following .htaccess code, but if i go to localhost/module/, it displays 404 error. But if i go to localhost/web/module/ then everything works. <IfModule mod_rewrite.c> RewriteEngine on RewriteRule sf/(.*) lib/vendor/symfony/data/web/sf/$1 [L] RewriteRule ^$ web/ [L] RewriteRule (.*) web/$1 [L] </IfModule>

    Read the article

  • Error when loading YAML config files in Rails

    - by ZelluX
    I am configuring Rails with MongoDB, and find a strange problem when paring config/mongo.yml file. config/mongo.yml is generated by executing script/rails generate mongo_mapper:config, and it looks like following: defaults: &defaults host: 127.0.0.1 port: 27017 development: <<: *defaults database: tc_web_development test: <<: *defaults database: tc_web_test From the config file we can see the objects development and test should both have a database field. But when it is parsed and loaded in config/initializers/mongo.db, config = YAML::load(File.read(Rails.root.join('config/mongo.yml'))) puts config.inspect MongoMapper.setup(config, Rails.env) the strange thing comes: the output of puts config.inspect is {"defaults"=>{"host"=>"127.0.0.1", "port"=>27017}, "development"=>{"host"=>"127.0.0.1", "port"=>27017}, "test"=>{"host"=>"127.0.0.1", "port"=>27017}} which does not contain database attribute. But when I execute the same statements in a plain ruby console, instead of using rails console, mongo.yml is parsed in a right way. {"defaults"=>{"host"=>"127.0.0.1", "port"=>27017}, "development"=>{"host"=>"127.0.0.1", "port"=>27017, "database"=>"tc_web_development"}, "test"=>{"host"=>"127.0.0.1", "port"=>27017, "database"=>"tc_web_test"}} I am wondering what may be the cause of this problem. Any ideas? Thanks.

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • How to compare two file structures in PHP?

    - by OM The Eternity
    I have a function which gives me the complete file structure upto n-level, function getDirectory($path = '.', $ignore = '') { $dirTree = array (); $dirTreeTemp = array (); $ignore[] = '.'; $ignore[] = '..'; $dh = @opendir($path); while (false !== ($file = readdir($dh))) { if (!in_array($file, $ignore)) { if (!is_dir("$path/$file")) { //display of file and directory name with their modification time $stat = stat("$path/$file"); $statdir = stat("$path"); $dirTree["$path"][] = $file. " === ". date('Y-m-d H:i:s', $stat['mtime']) . " Directory == ".$path."===". date('Y-m-d H:i:s', $statdir['mtime']) ; } else { $dirTreeTemp = getDirectory("$path/$file", $ignore); if (is_array($dirTreeTemp))$dirTree = array_merge($dirTree, $dirTreeTemp); } } } closedir($dh); return $dirTree; } $ignore = array('.htaccess', 'error_log', 'cgi-bin', 'php.ini', '.ftpquota'); //function call $dirTree = getDirectory('.', $ignore); //file structure array print print_r($dirTree); Now here my requirement is , I have two sites The Development/Test Site- where i do testing of all the changes The Production Site- where I finally post all the changes as per test in development site Now, for example, I have tested an image upload in the Development/test site, and i found it appropriate to publish on Production site then i will completely transfer the Development/Test DB detail to Production DB, but now I want to compare the files structure as well to transfer the corresponding image file to Production folder. There could be the situation when I update the image by editing the image and upload it with same name, now in this case the image file would be already present there, which will restrict the use of "file_exist" logic, so for these type of situations....HOW CAN I COMPARE THE TWO FILE STRUCTURE TO GET THE SYNCHRONIZATION DONE AS PER REQUIREMENT??

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • Tips for making administration of Drupal site easier

    - by Busk
    I'm creating a Drupal site for a client, and I'd like to make administrating the site as easy as possible for them. Examples of what they'd want to do with the site is: Add/Edit/Remove content which will be displayed on various pages Manage a forum - Just the basic Drupal Forum module Add / Ban Users Respond to comments left using the webforum I see there is an Admin module, that looks pretty promising. But I was wondering if anyone has any other helpful tips. Thanks

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >