Search Results

Search found 37048 results on 1482 pages for 'whole line'.

Page 687/1482 | < Previous Page | 683 684 685 686 687 688 689 690 691 692 693 694  | Next Page >

• Zend Framework: How to handle exceptions in Ajax requests?

  - by understack

  Normally when an exception is thrown, Error controller takes command and displays error page with regular common header and footer. This behavior is not wanted in Ajax request. Because in case of error, whole html page is sent over. And in cases where I'm directly loading the content of http response in a div, this is even more unwanted. Instead in case of Ajax request, I just want to receive 'the actual error' thrown by exception. How can I do this? I think, one dirty way could be: set a var in ajax request and process accordingly. Not a good solution.

  Read the article

• Flash Builder 'building' html files...

  - by Frank

  I'm using Flash Builder 3 to edit my Flex app, but I noticed that every time I make a change on the .html files (index.template.html for example), even if it's not in the IDE but with another program, Flash Builder rebuilds the whole project. Is there anyway to stop this? Why would it need to rebuild the workspace everytime a html file changes? If it was too long it wouldn't bother me, but it takes a lot of time (more than 1 minute) every time. For your information the html file is 95 lines of 'code'. Thanks

  Read the article

• LibGDX: transform Texture to TextureRegion

  - by FeRo2991

  I am creating a TowerDefence Game in LibGDX and am now trying to replace the old Tile with a new StaticTiledMapTile. But to create a StaticTiledMapTile I need a TextureRegion, not a Texture. Now I'm trying to create a TextureRegion, which contains the whole Texture, but it doesn't seem to work. It always appears distorted. I have tried the following: TextureRegion region = new TextureRegion(new Texture("someImg.png"), 0, 0, 32, 32); StaticTileMapTile tile = new StaticTiledMapTile(region); getLayer().getCell(x,y).setTile(tile); //setting the new tile In my opinion this should work (if the image, as it is, is 32px wide and 32px high).

  Read the article

• TPageControl tab area OnMouseEnter OnMouseLeave events

  - by daemon_x

  Hello, I need to catch the "OnMouseEnter" and "0nMouseLeave" for a certain area of the TPageControl component. With that specific area I mean the whole "tab header" rectangle. The problem is, that the page control doesn't catch the messages (I'm catching internal control messages CM_MOUSEENTER and CM_MOUSELEAVE) in the "empty" space. The aim for me is to draw a small arrow in the right empty side when user hovers in the red framed area (and drawing is just piece of cake) and erase it when leaves this area. And I'm don't care about the overflow of the tabs (which causes to draw scrolling double button) - that will never happen.

  Read the article

• Jquery, ajax() and each(), how to wait untill all info is really loaded?

  - by Moustard

  Hello, I have a function using $.ajax() to get values from an XML file, when the info is loaded and success event is fired, I use $(xml).find('').each(function(){}); to populate some vars... function getData() { $.ajax({ type: 'GET', url : 'info.xml', dataType: 'xml', success: function(xml) { $(xml).find('DATAS').each(function() { date = new Date($(this).attr('DATE')); alert(date); }) //Here I have a bigger find/each that should take more time }, error: function() { return false; } }); } In this case, when I trigger the function from the document ready function, the alert shows the right data, but If I remove the alert from the function and try this instead, date wont be defined yet: $(document).ready(function() { if(getData() != false) { alert(date); } }); I guess in this case the data is not ready yet? Is there a way to keep control on when the whole each() traversing is finished and ready?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Are Domain Specific Languages (DSL) bad for the Common Programmer?

  - by iestyn

  I have lately been delving into F# and the new DSL stuff as in the Microsoft SQL Server Modelling CTP, and have some concerns. Will this new idea that will come about be bad for skilled programmers? Is code going to be dumbed down? I know I sound like a luddite, but this does worry me, after spending years of time practising in my craft, and now might be scuttled by genius from within. I am afraid, very afraid. Will I be now trapped in a job that only programs against a DSL and therefore every job that I work on, I have to learn a whole new DSL based on top of a Framework (.net Java), that I will only be allowed to touch certain parts of. I don't think the world is ready for DSL, but the sales pitch is deafening!

  Read the article

• How to change the font size in table cells according to cells content ?

  - by misha-moroshko

  I have an HTML table which has incrementing numbers starting from 0 in its cells (left to right, up to bottom). I fixed in CSS the width and the height of the cells (40px width, 25px height, in my case). When the table becomes larger, the numbers inside it becomes large also (for example, the last number is 1266356). This causes the cells to be wider than I defined in the CSS, which expands the whole table accordingly. Instead, I would like the font of the numbers to be smaller to keep the width of the cell 40px. How can I accomplish this using CSS / Javascript / jQuery ?

  Read the article

• Strange Locking Behaviour in SQL Server 2005

  - by SQL Learner

  Can anyone please tell me why does the following statement inside a given stored procedure returns repeated results even with locks on the rows used by the first SELECT statement? BEGIN TRANSACTION DECLARE @Temp TABLE ( ID INT ) INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue <= 10 INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue >= 5 SELECT * FROM @Temp COMMIT TRANSACTION Any values in SomeTable for which SomeValue is between 5 and 10 will be returned twice, even though they were locked in the first SELECT. I thought that locks were in place for the whole transaction, and so I wasn't expecting the query to return repeated results. Why is this happening?

  Read the article

• HTML5 drag & drop: The dragged element content is missing in Webkit browsers.

  - by Cibernox

  I'm trying to implement something similar to a cart where you can drop items from a list. This items (<li> elements) has some elements inside (divs, span, and that stuff). The drag and drop itself works great. But the dragged element's image doesn't show its content in Webkit browsers. My list element has a border an a background color. In Firefox, the image is the whole item. In Webkit browsers, only the dragged element without content. I see the background and border, but without text inside. I tried to make a copy of the element and force it to be the image, but doesn't work. var dt = ev.originalEvent.dataTransfer; dt.setDragImage( $(ev.target).clone()[0], 0, 0); I have a simplified example that exhibit the same behavior: http://jsfiddle.net/ksnJf/1/

  Read the article

• how to sort an existing table in greasemonkey ?

  - by user570512

  i'm writing a greasemonkey user.js for a page with a table in it. (table is 100 rows by 18 columns.) now what i want to do is to make it sortable on column. and also have it run in both chrome and firefox. all searches for answers sofar resulted in suggestions to use jquery/dojo or something alike. can i be done without any external code? after all it's just a matter of replacing the row's in a different order, right? or is that a silly thing to say? the thing is that i'm already using dojo for some query needs but since i want it to run in both firefox and chrome, i just copy paste the whole dojo thing in my script.. also, most of the solutions i found sofar seem to be more for use when building a table. not for altering an existing one. any help is appreciated.

  Read the article

• Is it possible to *optionally* override a theme in Drupal 6?

  - by David Semeria

  I want to override the theming of only one (custom) menu. I can do this with phptemplate_menu_tree() but - of course - it overrides the rendering of all menus. I've tried returning FALSE (an obvious technique IMO) if the menu is not the specific one I want to override - but this doesn't cause the overridden theme function to be called. My only alternative (when the menu is anything other than the specific one) is to call the overridden function from within phptemplate_menu_tree() - but this seems to defeat the whole point of the override system, since the default rendering function will be hard-coded therein. I hope the explanation is clear, and any help is greatly appreciated - tks.

  Read the article

• What is the quikest method to see actual color of any hex code #a7a7a7?

  - by metal-gear-solid

  What is the quikest method to see actual color of any hex code #a7a7a7? When i work on other's CSS then if i deal with color codes then i quickly wan to see the color of that particular hex code. suppose if i'm editing css in notepad and i found code #a7a7a7 then how can i know what is the color of this code. If i have a color on my screen then i quickly know what would be hex code for this with the help of some tools ,but i need just opposite of this. i'm not talking about to see whole color chart of site. I want to see color of particular hex code.

  Read the article

• How do I launch unicorn_rails as a startup script with rvm installed on my ubuntu 12.04 machine?

  - by ne0lithic_coder

  I have a rails app on my server. I have a script startup.sh which launches unicorn_rails and then nginx. In order to get my server to launch on system boot, I've added a line to call my startup script to /etc/rc.local However, this doesn't work. I added some checks to make sure the script is being called and it is. It's the call to unicorn_rails which I think is failing. Does anyone have experience with this?

  Read the article

• Would you tell your prospective boss your SO username?

  - by Sebi

  Today I met a friend who is also using stackoverflow. He had a job interview today at a small business and during the interview, the prospective boss asked him how he assures that he's alawys up-to-date concerning technical questions and what he's doing to seek for a solution for a problem he can't solve by its own. Besides some magazines, journals, books and blogs my friend also mentioned stackoverflow. The prospective boss seems very interested about that and asked him if he could tell him his username. It appears that was the most difficult during the whole interview ;) Would you tell your prospective boss your username? An the pro side one can mention that the boss sees that you're very involved in your business and community but on the other hand it is a really private thing and you cant post anymore in thread like "what was the worst working environment?" My friend circumnaviagted this question by a rather lame answer (more or less: i use autologin, thats why i have to check the username later at home, ill maybe send you an email)

  Read the article

• download authentication?

  - by Sahat

  Hi I am sorry if this question has been asked before but I am looking for some sort of download authentication. In other words if I am going to give the user a link to a file, I want to make sure only that person will get it, and get it only once! Is there a simple solution without setting up the whole database. Even better if it's possible to have an ecrypted web link that will let you download a file from my FTP server just once, after that the link becomes invalid. Thanks.

  Read the article

• Confused on the basics of AJAX

  - by Doug

  So right now, I'm just using a basic form to check a password. I want it to check the password and basically remain on page.html so I can use JavaScript to alert incorrect password or something. I'm not really sure how to do that. It seems it would bring me to check.php. I'm not too sure on the whole process, any help appreciated! Thanks! Page.html <form action="check.php" method="post"> <input type="password" name="password" /> <input type="submit" value="Submit" /> </form> check.php <?php $password = $_POST['password']; if ( $password != "testing" ) { die(); } ?>

  Read the article

• XML/XSL nub: Is it possible to create an COMPOSITE XML/XSLT document?

  - by jmweekes

  I have just recently (like 2 days) started using XSLT documents with XML. I understand the basics and am able to generate a formatted document using an .XML document that references a separate .XSLT document. My question, as in the subject, is "Is it possible to create a SINGLE, composite document that contains both the XML data and XSLT processing/formatting/styling and displays as formatted HTML?" I am writing a desktop application in which I need to generate a formatted document on the fly from XML stored in the database. I want to do this without creating or referencing any actual physical files. I will generate a text string containing the XML/XSLT document and feed this to a WebBrowser component for formatted display. Hopefully what I want to do doesn't totally go against the whole XML/XSLT methodology. Any information, direction or suggestions will be greatly appreciated.

  Read the article

• How to combine two 32-bit integers into one 64-bit integer?

  - by Bei337

  I have a count register, which is made up of two 32-bit unsigned integers, one for the higher 32 bits of the value (most significant word), and other for the lower 32 bits of the value (least significant word). What is the best way in C to combine these two 32-bit unsigned integers and then display as a large number? In specific: leastSignificantWord = 4294967295; //2^32-1 printf("Counter: %u%u", mostSignificantWord,leastSignificantWord); This would print fine. When the number is incremented to 4294967296, I have it so the leastSignificantWord wipes to 0, and mostSignificantWord (0 initially) is now 1. The whole counter should now read 4294967296, but right now it just reads 10, because I'm just concatenating 1 from mostSignificantWord and 0 from leastSignificantWord. How should I make it display 4294967296 instead of 10?

  Read the article

• forcing to Not to process an event

  - by BDotA

  C# WinApps: the main form has a key binding to CTRL-V ...so anywhere in the main app when I press CTRL-V something runs..good ... but also there are some MDI apps that are opening inside this main app ... in one of those there is a test box...ah! now CTRL-V also has a meanining for text box which is "Paste" ... so I added PreViewKeyDown to textbox and handled it, so now it is pasting BUT it is ALSO doing the main CTRL-V key binding that I had defined for the whole app ... but I do no want this to happen.... what can I do? ( I cannot change the key binding od the main app. I must keep it.)

  Read the article

• Easily view a list of changes of upgraded packages.

  - by D Connors

  So, let's say I run sudo apt-get upgrade on my Lucid Lynx and it upgrades a couple of packages I'm interested in. Is there a command to run that will open some kind of info or manual that tells me what changes were made in this new version of the package? For instance, if run the apt-get upgrade and it installs a new version of empathy. Do I have to go over to their site to review the changes made in this version, or is there a quicker command line way?

  Read the article

• Website defaced, what can I do?

  - by SteD

  My company's website has been defaced, provided I have the apache raw access log, is there anything I could do to analyze when and what went wrong? I mean what to look out for among all those thousands and thousands line of log? Thanks for the help

  Read the article

• Website defaced, what can I do?

  - by SteD

  My company's website has been defaced, provided I have the apache raw access log, is there anything I could do to analyze when and what went wrong? I mean what to look out for among all those thousands and thousands line of log? Thanks for the help

  Read the article

• How can I change this method to get rid of the warning without anything changing?

  - by user3591323

  So this question:Warning-used as the name of the previous parameter rather than as part of the selector answers part of my problem, but I really don't want anything to change inside this method and I'm a bit confused on how this works. Here's the whole method: -(void) SetRightWrong:(sqzWord *)word: (int) rightWrong { if (self.mastered==nil) { self.mastered = [[NSMutableArray alloc]initWithCapacity:10]; } //if right change number right if (rightWrong == 1) { word.numberCorrect++; //if 3 right move to masterd list [self.onDeck removeObject:word]; if(word.numberCorrect >= 3 ) { [self.mastered addObject:word]; } else { //if not 3 right move to end of ondeck [self.onDeck addObject:word]; } } else if(rightWrong == 0) { //if wrong remove one from number right unless 0 NSUInteger i; i=[self.onDeck indexOfObject:word]; word = [self.onDeck objectAtIndex:i]; if (word.numberCorrect >0) { word.numberCorrect--; } } } The warning I am getting is: 'word' used as the name of the previous parameter than as part of the selector.

  Read the article

• Bugzilla not sending emails, even to the test file?

  - by donutdan4114

  I have installed and setup Bugzilla3 for my domain. Everything is working properly except for the email functionality. The server uses Postfix, and that works for my PHP application, and command line. In Bugzilla, I have tried setting the mail_delivery_method to 'test', and nothing shows up in data/mailer.testfile, it is completely blank... I have no idea where to go from here, any ideas on what to try next?

  Read the article

< Previous Page | 683 684 685 686 687 688 689 690 691 692 693 694  | Next Page >