Search Results

Search found 24117 results on 965 pages for 'write through'.

Page 688/965 | < Previous Page | 684 685 686 687 688 689 690 691 692 693 694 695  | Next Page >

  • ASP.NET MVC 2 model properties binding order

    - by bniwredyc
    Is there a way to change order in which the default binder binds property values of model? For example I have model class A: class A { public string A1 {get; set;} public string A2 {get; set;} } and action DoSomethig: public ActionResult DoSomething(A model) { ... } I want that A2 property has been bound before the A1 property. Is it possible? Or I need to write custom binder?

    Read the article

  • Absolute URL Generation with Subdirectory in Rails

    - by Hulihan Applications
    Hey Guys - I'm trying to find an easy way(without having to write any plugins or overrides to Rails) to generate an absolute url to a rails application being in a subdirectory. This url is going to be generated for theme images, not links, so I can't url link_to or url_for. Here's an example of what I want to do: <%= theme_image("delete_icon.png", :theme => "my_theme") %> If my app is running at http://localhost, This would return: <img src="/themes/my_theme/images/delete_icon.png"> but If my app is running at http://localhost/myapp, This would return: <img src="/myapp/themes/my_theme/images/delete_icon.png"> Can anyone point me in the right direction to generate a dynamic, absolute url to a non-routed resource?

    Read the article

  • MPI - passing function as a parameter

    - by Hmyzak
    Hi, is there any how how to pass function as a parameter when starting program in C? I am implementing app for integral aproximation, and all I need is to type a function I want to work with, when starting app. I tried (e.g.) 2/(2+2*x), but I only get back "2". When I write to application directly, there is no problem. Is there any simple way of getting this? Maybe redistribute it to more parametres? Like app.c number number*x number *x*x number *x*x*x... ? Thanks

    Read the article

  • Closed Source Java Applications

    - by Paul
    I am taking programming courses and we have been discussing Open Source and having a bit of an argument over the confusion. Just because Java is Open Source, the licensing on developed applications starts at the developer, correct? Someone is arguing about the use of code from a complete program just because "Java is Open Source". If I write a Java application, what are the limitations on how I can distribute it or how someone else can use it? Assume here that I DO NOT want someone having access to my source. Thanks

    Read the article

  • how to store data with many categories and many properties efficiently?

    - by Mickey Shine
    We have a large number of data in many categories with many properties, e.g. category 1: Book properties: BookID, BookName, BookType, BookAuthor, BookPrice category 2: Fruit properties: FruitID, FruitName, FruitShape, FruitColor, FruitPrice We have many categories like book and fruit. Obviously we can create many tables for them (MySQL e.g.), and each category a table. But this will have to create too many tables and we have to write many "adapters" to unify manipulating data. The difficulties are: 1) Every category has different properties and this results in a different data structure. 2) The properties of every categoriy may have to be changed at anytime. 3) Hard to manipulate data if each category a table (too many tables) How do you store such kind of data?

    Read the article

  • Programmatically Untag FB Photos with Javascript

    - by Tal
    Hello! I've spent the past hour hacking away at this: I want to write a Javscript routine to programatically untag myself from photos on Facebook. Once it works, I'll run it in the Firebug console and untag myself from all Facebook photos (there's no way to do this through the GUI). I wanted to see if you guys had some advice to get me on my journey. I have a few methods in mind but haven't come too far along quite yet. I've tried an AJAX approach by creating a new HTML request and pointing it to the remove_tag URL, which looks something like this: /ajax/photo_tagging_ajax.php?pid=(PICTURE_ID)&id=(PICTURE_OWNER_ID)&subject=(SOMETHING)&name=(YOUR+NAME)&action=remove Not surprisingly, this doesn't work (yet). I've been checking the HTTP response in Firebug and it's quite different than the one when I actually untag a picture. It's not even sending a POST request. Will this even be possible or am I dreaming? (it's almost 4AM)

    Read the article

  • Practise Questions for Templates,Functors,CallBack functions in c++?

    - by Eternal Learner
    Hi, I have been reading templates,functors,callback function for the past week and have referred some good books and articles. I however feel that, unless I can get good practice - programming in templates and use functors-callbacks there is no way I can really understand all the concepts or fluently use them while coding. Could anyone suggest some articles or books or websites where , there is a definition of the problem and also a solution to the same. I could just write code for the problem and check later on if my solution is good enough.. I am also aware that some of our stack-overflow members are experts in templates and callback functions. It would be great if they could design a problem and also post a solution , where a lot of template beginners like me could benefit.

    Read the article

  • Does a persons' first programming language affect their programming style and if so, how? [closed]

    - by Scott Walsh
    I was speaking to an experienced lecturer recently who told me he could usually tell which programming language a student had learnt to program in by looking at their coding style (more specifically, when programming in other languages to the one which they were most comfortable with). He said that there have been multiple times when he's witnessed students attempted to write C# in Prolog. So I began to wonder, what specific traits do people gain from their first (or favourite) language which are carried over into their overall programming style, and more interestingly what good or bad habits do you think people would benefit from or should be wary of when learning specific language?

    Read the article

  • Find objects between two dates MongoDB

    - by Tom
    I've been playing around storing tweets inside mongodb, each object looks like this: { "_id" : ObjectId("4c02c58de500fe1be1000005"), "contributors" : null, "text" : "Hello world", "user" : { "following" : null, "followers_count" : 5, "utc_offset" : null, "location" : "", "profile_text_color" : "000000", "friends_count" : 11, "profile_link_color" : "0000ff", "verified" : false, "protected" : false, "url" : null, "contributors_enabled" : false, "created_at" : "Sun May 30 18:47:06 +0000 2010", "geo_enabled" : false, "profile_sidebar_border_color" : "87bc44", "statuses_count" : 13, "favourites_count" : 0, "description" : "", "notifications" : null, "profile_background_tile" : false, "lang" : "en", "id" : 149978111, "time_zone" : null, "profile_sidebar_fill_color" : "e0ff92" }, "geo" : null, "coordinates" : null, "in_reply_to_user_id" : 149183152, "place" : null, "created_at" : "Sun May 30 20:07:35 +0000 2010", "source" : "web", "in_reply_to_status_id" : { "floatApprox" : 15061797850 }, "truncated" : false, "favorited" : false, "id" : { "floatApprox" : 15061838001 } How would I write a query which checks the *created_at* and finds all objects between 18:47 and 19:00? Do I need to update my documents so the dates are stored in a specific format? Thanks

    Read the article

  • Filtering across two ManyToMany fields

    - by KVISH
    I have a User model and an Event model. I have the following for both: class Event(models.Model): ... timestamp = models.DateTimeField() organization_map = models.ManyToManyField(Organization) class User(AuthUser): ... subscribed_orgs = models.ManyToManyField('Organization') I want to find all events that were created in a certain timeframe and find the users who are subscribed to those organizations. I know how to write SQL for this (it's very easy), but whats the pythonic way of doing this using Django ORM? I'm trying as per below: orgs = Organization.objects.all() events = Event.objects.filter(timestamp__gt=min_time) # Min time is the time I want to start from events = events.filter(organization_map__in=orgs) But from there, how do I map to users who have that organization as a subscription? I'm trying to map it like so: users = User.objects.filter(subscribed_orgs__in=...

    Read the article

  • Which file types are worth compressing (zipping) for remote storage? For which of them the compresse

    - by user193655
    I am storing documents in sql server in varbinary(max) fileds, I use filestream optionally when a user has: (DB_Size + Docs_Size) ~> 0.8 * ExpressEdition_Max_DB_Size I am currently zipping all the files, anyway this is done because the Document Read/Write work was developed 10 years ago where Storage was more expensive than now. Many files when zipped are almost as big as the original (a zipped pdf is about 95% of original size). And anyway unzipping has some overhead, that becomes twice when I need also to "Check-in"/Update the file because I need to zip it. So I was thinking of giving to the users the option to choose whether the file type will be zipped or not by providing some meaningful default values. For my experience I would impose the following rules: 1) zip by default: txt, bmp, rtf 2) do not zip by default: jpg, jpeg, Microsoft Office files, Open Office files, png, tif, tiff Could you suggest other file types chosen among the most common or comment on the ones I listed here?

    Read the article

  • Multiple column Union Query without duplicates

    - by Adam Halegua
    I'm trying to write a Union Query with multiple columns from two different talbes (duh), but for some reason the second column of the second Select statement isn't showing up in the output. I don't know if that painted the picture properly but here is my code: Select empno, job From EMP Where job = 'MANAGER' Union Select empno, empstate From EMPADDRESS Where empstate = 'NY' Order By empno The output looks like: EMPNO JOB 4600 NY 5300 MANAGER 5300 NY 7566 MANAGER 7698 MANAGER 7782 MANAGER 7782 NY 7934 NY 9873 NY Instead of 5300 and 7782 appearing twice, I thought empstate would appear next to job in the output. For all other empno's I thought the values in the fields would be (null). Am I not understanding Unions correctly, or is this how they are supposed to work? Thanks for any help in advance.

    Read the article

  • How to set Single GtkLebel Color to while using gtkrc?

    - by PP
    How to set Single GtkLebel Color to while using gtkrc? I tried to set as follows: In rc file: style "tc-theme-label-white" { xthickness = 1 ythickness = 1 font_name = "Sans Bold 8" text[NORMAL] = "#FFFFFF" text[INSENSITIVE] = "#434346" text[PRELIGHT] = "#FFFFFF" text[SELECTED] = "#FFFFFF" text[ACTIVE] = "#FFFFFF" } widget "*.my-theme-label" style:highest "my-theme-label" //And in code i have written. Gtk *label = gtk_new_label(null); gtk_widget_set_name(label_ptr, "my-theme-label"); Is this the write way of doing it? as usual it is not working. :p Thanks, PP.

    Read the article

  • Override decimal ToString() method

    - by Jimbo
    I have a decimal datatype with a precision of (18, 8) in my database and even if its value is simply 14.765 it will still get displayed as 14.76500000 when I use Response.Write to return its value into a webpage. Is it possible to override its default ToString method to return the number in the format #,###,##0.######## so that it only displays relevant decimal places? UPDATE I'm assuming that when one outputs number on a page like <%= item.price %> (where item.price is a number) that the number's ToString method is being called? I'm trying to avoid having to change every instance where the value is displayed by defaulting the ToString() format somehow.

    Read the article

  • Group by clause return latest row information

    - by I Like PHP
    below is my table structure table_movie_info i_movie_id |movie_actor_id |movie_actress_id |movie_director_id | movie_producer_id 48 | 5 | 9 | 66 | 21 48 | 6 | 15 | 88 | 22 48 | 7 | 12 | 77 | 23 one more table is table_movie movie_id | movie_year | movie_genre_id |movie_rating 1 | 2009 | 6 | 8 2 | 2001 | 5 | 7.5 48 | 2007 | 3 | 6.8 now i need total movie information using both table,i write below query SELECT * FROM table_movie_info LEFT JOIN table_movie ON movie_id = i_movie_id WHERE i_movie_id=48 GROUP BY i_movie_id above query return only one row , but i need such type of information movie_id=48, actors_id list=5,6,7 acttress_id list=9,15,12 etc.. please tell me the optimized query which h return complete information i need. thanks for helping me always.

    Read the article

  • Is there any memory restrictions on an ASP.Net application? HttpHandler?

    - by tpower
    I have an ASP.Net MVC application that allows users to upload images. When I try to upload a really large file (400MB) I get an error. I assumed that my image processing code (home brew) was very inefficient, so I decided I would try using a third party library to handle the image processing parts. Because I'm using TDD, I wanted to first write a test that fails. But when I test the controller action with the same large file it is able to do all the image processing without any trouble. The error I get is "Out of memory". I'm sure my code is probably using a lot more memory than it needs to but I just want to know why my test passes. The other difference is that I'm using SWFUpload which is not used with the test. Could this be the cause?

    Read the article

  • Working with Japanese filenames in PHP 5.3 and Windows Vista?

    - by Jon
    I'm currently trying to write a simple script that looks in a folder, and returns a list of all the file names in an RSS feed. However I've hit a major wall... Whenever I try to read filenames with Japanese characters in them, it shows them as ?'s. I've tried the solutions mentioned here: http://stackoverflow.com/questions/482342/php-readdir-problem-with-japanese-language-file-name - however they do not work for some reason, even with: header('Content-Type: text/html; charset=UTF-8'); setlocale(LC_ALL, 'en_US.UTF8'); mb_internal_encoding("UTF-8"); At the top (Exporting as plain text until I can sort this out). What can I do? I need this to work and I don't have much time.

    Read the article

  • Help using preg_match for phone numbers

    - by Kirk
    how would i write an if statement that would find phone numbers and store them to a variable. Here is what i have so far but its not working. if (preg_match('/^(?:(?:\+?1\s*(?:[.-]\s*)?)?(?:\(\s*([2-9]1[02-9]|[2-9][02-8]1|[2-9][02-8][02-9])\s*\)|([2-9]1[02-9]|[2-9][02-8]1|[2-9][02-8][02-9]))\s*(?:[.-]\s*)?)?([2-9]1[02-9]|[2-9][02-9]1|[2-9][02-9]{2})\s*(?:[.-]\s*)?([0-9]{4})(?:\s*(?:#|x\.?|ext\.?|extension)\s*(\d+))?$ /', $buffer, $matches)) { $phonenumber = html_entity_decode($matches[1]); }

    Read the article

  • Cannot make sense out a Delphi windows file name

    - by Philippe Watel
    I am trying to copy from a file X to this name C:\RIP2\France Clidat\Les Plus Belles Oeuvres - France Clidat\(01)3_ Un Sospiro.flac I have checked that there is no bad characters, If I force directorires it creates C:\RIP2\France Clidat\Les Plus Belles Oeuvres - France Clidat but it refuses to write the file and I do not understand why a simple test procedure foo(str: string); var f:File; begin Assign(f,str); Rewrite(f); CloseFile(f); end; will crash saying it is not a valid file name but it is! If I remove ALL blank spaces it works I am lost please Help

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • CSV file download ignored in ie8/9

    - by JBB
    I have some code in a button click event which gets a csv string from a hidden input and writes it to the response as a CSV file. This work fine in Chrome, Firefox, ie7, ie9 in quirks mode. However it does not work in ie8 or ie9 default. Looking at this in fiddler the csv is being written to the response but the another get request is being made immediately after and the page reloads. No file saving dialog appears. protected void btnCsvHidden_Click(object sender, EventArgs e) { var csv = csvString.Value; var filename = "Reporting"; Response.Clear(); Response.ClearHeaders(); Response.AddHeader("Cache-Control", "no-store, no-cache"); Response.AddHeader("content-disposition", "attachment; filename=\"" + filename + ".csv\""); Response.ContentType = "text/csv"; Response.Write(csv); Response.End(); }

    Read the article

  • Boost ASIO read X bytes synchroniously into a vector

    - by xeross
    Hey, I've been attempting to write a client/server app with boost now, so far it sends and receives but I can't seem to just read X bytes into a vector. If I use the following code vector<uint8_t> buf; for (;;) { buf.resize(4); boost::system::error_code error; size_t len = socket.read_some(boost::asio::buffer(buf), error); if (error == boost::asio::error::eof) break; // Connection closed cleanly by peer. else if (error) throw boost::system::system_error(error); // Some other error. } And the packet is bigger then 4 bytes then it seems it keeps writing into those 4 bytes until the entire packet has been received, however I want it to fetch 4 bytes, then allow me to parse them, and then get the rest of the packet. Can anyone provide me with a working example, or at least a pointer on how to make it work properly ? Regards, Xeross

    Read the article

  • Extension methods on a static object

    - by Max Malygin
    I know (or so I hear) that writing extension methods for a single stand alone .net class (not an implementation of IEnumerable) is potential code smell. However, for the sake of making the life easier I need to attach a method to the ConfigurationManager class in asp.net. It's a static object so this won't work: public static List<string> GetSupportedDomains(this ConfigurationManager manager) { //the manager needs to be static. } So the question is - is it possible to write an extension method for a static class in .net?

    Read the article

  • Get child elements from a parent but not first and last

    - by Cleiton
    I would like to know how could I write a jQuery selector that get all children from a parent element except first and last child? Example of my current HTML: <div id="parent"> <div>first child( i don't want to get)</div> <div>another child</div> <div>another child</div> <div>another child</div> (...) <div>another child</div> <div>another child</div> <div>last child (i dont want to get neither)</div> </div>

    Read the article

< Previous Page | 684 685 686 687 688 689 690 691 692 693 694 695  | Next Page >