Search Results

Search found 24117 results on 965 pages for 'write through'.

Page 688/965 | < Previous Page | 684 685 686 687 688 689 690 691 692 693 694 695  | Next Page >

  • Making a many-to-many relationship using DataRelations object

    - by dotnetdev
    Hi, I have about 200 tables which need to relate to another table in a many-to-many fashion. I have the tables (including the intersection table) ready IN SQL Server. How can I write code using the data relation object to make the relationship? The tables are: PartStatPartName PartsMaterialsIntersection << Materials The materials table needs to have a foreign key from the PartStatPartName table. I tried various approaches using the DataRelation class but the change did not sync to SQL Server, despite being connected and adding the relation, and then calling AcceptChanges() on the dataset. Any guidance much appreciated. I have seen some threads covering the same problem but need an example in code so I can follow the right method. Thanks

    Read the article

  • Absolute URL Generation with Subdirectory in Rails

    - by Hulihan Applications
    Hey Guys - I'm trying to find an easy way(without having to write any plugins or overrides to Rails) to generate an absolute url to a rails application being in a subdirectory. This url is going to be generated for theme images, not links, so I can't url link_to or url_for. Here's an example of what I want to do: <%= theme_image("delete_icon.png", :theme => "my_theme") %> If my app is running at http://localhost, This would return: <img src="/themes/my_theme/images/delete_icon.png"> but If my app is running at http://localhost/myapp, This would return: <img src="/myapp/themes/my_theme/images/delete_icon.png"> Can anyone point me in the right direction to generate a dynamic, absolute url to a non-routed resource?

    Read the article

  • Does a persons' first programming language affect their programming style and if so, how? [closed]

    - by Scott Walsh
    I was speaking to an experienced lecturer recently who told me he could usually tell which programming language a student had learnt to program in by looking at their coding style (more specifically, when programming in other languages to the one which they were most comfortable with). He said that there have been multiple times when he's witnessed students attempted to write C# in Prolog. So I began to wonder, what specific traits do people gain from their first (or favourite) language which are carried over into their overall programming style, and more interestingly what good or bad habits do you think people would benefit from or should be wary of when learning specific language?

    Read the article

  • Need help in c# code

    - by vaibhav
    I have a function protected void bindCurrencies(DropDownList drp) { drp.DataSource = dtCurrencies; drp.DataTextField = "CurrencyName"; drp.DataValueField = "CurrencyID"; drp.DataBind(); drp.Items.Insert(0, new ListItem("Please Select")); } I am binding a dropdown list using this. But sometimes I need to bind a ListBox also. I dont want to write a different function for listbox. How should I do this. I think Generics method is to be used here. But I dont have any idea about generics.

    Read the article

  • Does a servlet-based stack have significant overheads?

    - by John
    I don't know if it's simply because page-loads take a little time, or the way servlets have an abstraction framework above the 'bare metal' of HTTP, or just because of the "Enterprise" in Jave-EE, but in my head I have the notion that a servlet-based app is inherently adding overhead compared to a Java app which simply deals with sockets directly. Forget web-pages, imagine instead a Java server app where you send it a question over an HTTP request and it looks up an answer from memory and returns the answer in the response. You can easily write a Java socket-based app which does this, you can also do a servlet approach and get away from the "bare metal" of sockets. Is there any measurable performance impact to be expected implementing the same approach using Servlets rather than a custom socket-based HTTP listening app? And yes, I am hazy on the exact data sent in HTTP requests and I know it's a vague question. It's really about whether servlet implementations have lots of layers of indirection or anything else that would add up to a significant overhead per call, where by significant I mean maybe an additional 0.1s or more.

    Read the article

  • Closed Source Java Applications

    - by Paul
    I am taking programming courses and we have been discussing Open Source and having a bit of an argument over the confusion. Just because Java is Open Source, the licensing on developed applications starts at the developer, correct? Someone is arguing about the use of code from a complete program just because "Java is Open Source". If I write a Java application, what are the limitations on how I can distribute it or how someone else can use it? Assume here that I DO NOT want someone having access to my source. Thanks

    Read the article

  • Run a site on Scheme

    - by Lajla
    I can't find this on Google (so maybe it doesn't exist), but I basically'd like to install something on a web server such that I can run a site on Scheme, PHP is starting to annoy me, I want to get rid off it, what I want is: Run Scheme sources towards UTF-8 output (duh) Support for SXML, SXLT et cetera, I plan to compose the damned thing in SXML and - to normal representation on at the end. Ability to read other files from the server, write them, set permissions et cetera Also some things to for instance determine the filesize of files, height of images, mime-types and all that mumbo-jumbo (optionally) connect to a database, but for what I want to do storing the entire database in S-expressions itself is feasible enough I don't need any fancy libraries and other things that come with it like CMS'es and what-not, except the support for SXML but I'm sure I can just find a lib for that anyway that I can load.

    Read the article

  • Help using preg_match for phone numbers

    - by Kirk
    how would i write an if statement that would find phone numbers and store them to a variable. Here is what i have so far but its not working. if (preg_match('/^(?:(?:\+?1\s*(?:[.-]\s*)?)?(?:\(\s*([2-9]1[02-9]|[2-9][02-8]1|[2-9][02-8][02-9])\s*\)|([2-9]1[02-9]|[2-9][02-8]1|[2-9][02-8][02-9]))\s*(?:[.-]\s*)?)?([2-9]1[02-9]|[2-9][02-9]1|[2-9][02-9]{2})\s*(?:[.-]\s*)?([0-9]{4})(?:\s*(?:#|x\.?|ext\.?|extension)\s*(\d+))?$ /', $buffer, $matches)) { $phonenumber = html_entity_decode($matches[1]); }

    Read the article

  • Cannot make sense out a Delphi windows file name

    - by Philippe Watel
    I am trying to copy from a file X to this name C:\RIP2\France Clidat\Les Plus Belles Oeuvres - France Clidat\(01)3_ Un Sospiro.flac I have checked that there is no bad characters, If I force directorires it creates C:\RIP2\France Clidat\Les Plus Belles Oeuvres - France Clidat but it refuses to write the file and I do not understand why a simple test procedure foo(str: string); var f:File; begin Assign(f,str); Rewrite(f); CloseFile(f); end; will crash saying it is not a valid file name but it is! If I remove ALL blank spaces it works I am lost please Help

    Read the article

  • Idea for doing almost same work in both catch & finally(C#3.0)

    - by Newbie
    I have a requirement. I am processing some files and after the processing are done I am archiving those files into an archive folder with timestamp appended. The file archiving and putting time stamp portion I am doing in the Finally block. Now a new requirement has come where I need to mail if something wrong goes in the original files and then I need to archive the same. Now this piece of code I need to handle in the catch block. But if I write the code entirely in the catch block, then it will fire only if there is an exception; otherwise not. So basically I am writing the same pice of code in both the catch and finally block. What is the standard and recommended approach you people think will be better in this case? I am using C#3.0 Thanks.

    Read the article

  • Override decimal ToString() method

    - by Jimbo
    I have a decimal datatype with a precision of (18, 8) in my database and even if its value is simply 14.765 it will still get displayed as 14.76500000 when I use Response.Write to return its value into a webpage. Is it possible to override its default ToString method to return the number in the format #,###,##0.######## so that it only displays relevant decimal places? UPDATE I'm assuming that when one outputs number on a page like <%= item.price %> (where item.price is a number) that the number's ToString method is being called? I'm trying to avoid having to change every instance where the value is displayed by defaulting the ToString() format somehow.

    Read the article

  • Which file types are worth compressing (zipping) for remote storage? For which of them the compresse

    - by user193655
    I am storing documents in sql server in varbinary(max) fileds, I use filestream optionally when a user has: (DB_Size + Docs_Size) ~> 0.8 * ExpressEdition_Max_DB_Size I am currently zipping all the files, anyway this is done because the Document Read/Write work was developed 10 years ago where Storage was more expensive than now. Many files when zipped are almost as big as the original (a zipped pdf is about 95% of original size). And anyway unzipping has some overhead, that becomes twice when I need also to "Check-in"/Update the file because I need to zip it. So I was thinking of giving to the users the option to choose whether the file type will be zipped or not by providing some meaningful default values. For my experience I would impose the following rules: 1) zip by default: txt, bmp, rtf 2) do not zip by default: jpg, jpeg, Microsoft Office files, Open Office files, png, tif, tiff Could you suggest other file types chosen among the most common or comment on the ones I listed here?

    Read the article

  • Practise Questions for Templates,Functors,CallBack functions in c++?

    - by Eternal Learner
    Hi, I have been reading templates,functors,callback function for the past week and have referred some good books and articles. I however feel that, unless I can get good practice - programming in templates and use functors-callbacks there is no way I can really understand all the concepts or fluently use them while coding. Could anyone suggest some articles or books or websites where , there is a definition of the problem and also a solution to the same. I could just write code for the problem and check later on if my solution is good enough.. I am also aware that some of our stack-overflow members are experts in templates and callback functions. It would be great if they could design a problem and also post a solution , where a lot of template beginners like me could benefit.

    Read the article

  • Group by clause return latest row information

    - by I Like PHP
    below is my table structure table_movie_info i_movie_id |movie_actor_id |movie_actress_id |movie_director_id | movie_producer_id 48 | 5 | 9 | 66 | 21 48 | 6 | 15 | 88 | 22 48 | 7 | 12 | 77 | 23 one more table is table_movie movie_id | movie_year | movie_genre_id |movie_rating 1 | 2009 | 6 | 8 2 | 2001 | 5 | 7.5 48 | 2007 | 3 | 6.8 now i need total movie information using both table,i write below query SELECT * FROM table_movie_info LEFT JOIN table_movie ON movie_id = i_movie_id WHERE i_movie_id=48 GROUP BY i_movie_id above query return only one row , but i need such type of information movie_id=48, actors_id list=5,6,7 acttress_id list=9,15,12 etc.. please tell me the optimized query which h return complete information i need. thanks for helping me always.

    Read the article

  • Is there any memory restrictions on an ASP.Net application? HttpHandler?

    - by tpower
    I have an ASP.Net MVC application that allows users to upload images. When I try to upload a really large file (400MB) I get an error. I assumed that my image processing code (home brew) was very inefficient, so I decided I would try using a third party library to handle the image processing parts. Because I'm using TDD, I wanted to first write a test that fails. But when I test the controller action with the same large file it is able to do all the image processing without any trouble. The error I get is "Out of memory". I'm sure my code is probably using a lot more memory than it needs to but I just want to know why my test passes. The other difference is that I'm using SWFUpload which is not used with the test. Could this be the cause?

    Read the article

  • Working with Japanese filenames in PHP 5.3 and Windows Vista?

    - by Jon
    I'm currently trying to write a simple script that looks in a folder, and returns a list of all the file names in an RSS feed. However I've hit a major wall... Whenever I try to read filenames with Japanese characters in them, it shows them as ?'s. I've tried the solutions mentioned here: http://stackoverflow.com/questions/482342/php-readdir-problem-with-japanese-language-file-name - however they do not work for some reason, even with: header('Content-Type: text/html; charset=UTF-8'); setlocale(LC_ALL, 'en_US.UTF8'); mb_internal_encoding("UTF-8"); At the top (Exporting as plain text until I can sort this out). What can I do? I need this to work and I don't have much time.

    Read the article

  • How to set Single GtkLebel Color to while using gtkrc?

    - by PP
    How to set Single GtkLebel Color to while using gtkrc? I tried to set as follows: In rc file: style "tc-theme-label-white" { xthickness = 1 ythickness = 1 font_name = "Sans Bold 8" text[NORMAL] = "#FFFFFF" text[INSENSITIVE] = "#434346" text[PRELIGHT] = "#FFFFFF" text[SELECTED] = "#FFFFFF" text[ACTIVE] = "#FFFFFF" } widget "*.my-theme-label" style:highest "my-theme-label" //And in code i have written. Gtk *label = gtk_new_label(null); gtk_widget_set_name(label_ptr, "my-theme-label"); Is this the write way of doing it? as usual it is not working. :p Thanks, PP.

    Read the article

  • Programmatically Untag FB Photos with Javascript

    - by Tal
    Hello! I've spent the past hour hacking away at this: I want to write a Javscript routine to programatically untag myself from photos on Facebook. Once it works, I'll run it in the Firebug console and untag myself from all Facebook photos (there's no way to do this through the GUI). I wanted to see if you guys had some advice to get me on my journey. I have a few methods in mind but haven't come too far along quite yet. I've tried an AJAX approach by creating a new HTML request and pointing it to the remove_tag URL, which looks something like this: /ajax/photo_tagging_ajax.php?pid=(PICTURE_ID)&id=(PICTURE_OWNER_ID)&subject=(SOMETHING)&name=(YOUR+NAME)&action=remove Not surprisingly, this doesn't work (yet). I've been checking the HTTP response in Firebug and it's quite different than the one when I actually untag a picture. It's not even sending a POST request. Will this even be possible or am I dreaming? (it's almost 4AM)

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Filtering across two ManyToMany fields

    - by KVISH
    I have a User model and an Event model. I have the following for both: class Event(models.Model): ... timestamp = models.DateTimeField() organization_map = models.ManyToManyField(Organization) class User(AuthUser): ... subscribed_orgs = models.ManyToManyField('Organization') I want to find all events that were created in a certain timeframe and find the users who are subscribed to those organizations. I know how to write SQL for this (it's very easy), but whats the pythonic way of doing this using Django ORM? I'm trying as per below: orgs = Organization.objects.all() events = Event.objects.filter(timestamp__gt=min_time) # Min time is the time I want to start from events = events.filter(organization_map__in=orgs) But from there, how do I map to users who have that organization as a subscription? I'm trying to map it like so: users = User.objects.filter(subscribed_orgs__in=...

    Read the article

  • how to store data with many categories and many properties efficiently?

    - by Mickey Shine
    We have a large number of data in many categories with many properties, e.g. category 1: Book properties: BookID, BookName, BookType, BookAuthor, BookPrice category 2: Fruit properties: FruitID, FruitName, FruitShape, FruitColor, FruitPrice We have many categories like book and fruit. Obviously we can create many tables for them (MySQL e.g.), and each category a table. But this will have to create too many tables and we have to write many "adapters" to unify manipulating data. The difficulties are: 1) Every category has different properties and this results in a different data structure. 2) The properties of every categoriy may have to be changed at anytime. 3) Hard to manipulate data if each category a table (too many tables) How do you store such kind of data?

    Read the article

  • Find objects between two dates MongoDB

    - by Tom
    I've been playing around storing tweets inside mongodb, each object looks like this: { "_id" : ObjectId("4c02c58de500fe1be1000005"), "contributors" : null, "text" : "Hello world", "user" : { "following" : null, "followers_count" : 5, "utc_offset" : null, "location" : "", "profile_text_color" : "000000", "friends_count" : 11, "profile_link_color" : "0000ff", "verified" : false, "protected" : false, "url" : null, "contributors_enabled" : false, "created_at" : "Sun May 30 18:47:06 +0000 2010", "geo_enabled" : false, "profile_sidebar_border_color" : "87bc44", "statuses_count" : 13, "favourites_count" : 0, "description" : "", "notifications" : null, "profile_background_tile" : false, "lang" : "en", "id" : 149978111, "time_zone" : null, "profile_sidebar_fill_color" : "e0ff92" }, "geo" : null, "coordinates" : null, "in_reply_to_user_id" : 149183152, "place" : null, "created_at" : "Sun May 30 20:07:35 +0000 2010", "source" : "web", "in_reply_to_status_id" : { "floatApprox" : 15061797850 }, "truncated" : false, "favorited" : false, "id" : { "floatApprox" : 15061838001 } How would I write a query which checks the *created_at* and finds all objects between 18:47 and 19:00? Do I need to update my documents so the dates are stored in a specific format? Thanks

    Read the article

  • In Perl, can I limit the length of a line as I read it in from a file (like fgets)

    - by SB
    I'm trying to write a piece of code that reads a file line by line and stores each line, up to a certain amount of input data. I want to guard against the end-user being evil and putting something like a gig of data on one line in addition to guarding against sucking in an abnormally large file. Doing $str = <FILE> will still read in a whole line, and that could be very long and blow up my memory. fgets lets me do this by letting me specify a number of bytes to read during each call and essentially letting me split one long line into my max length. Is there a similar way to do this in perl? I saw something about sv_gets but am not sure how to use it (though I only did a cursory Google search). Thanks.

    Read the article

  • Boost ASIO read X bytes synchroniously into a vector

    - by xeross
    Hey, I've been attempting to write a client/server app with boost now, so far it sends and receives but I can't seem to just read X bytes into a vector. If I use the following code vector<uint8_t> buf; for (;;) { buf.resize(4); boost::system::error_code error; size_t len = socket.read_some(boost::asio::buffer(buf), error); if (error == boost::asio::error::eof) break; // Connection closed cleanly by peer. else if (error) throw boost::system::system_error(error); // Some other error. } And the packet is bigger then 4 bytes then it seems it keeps writing into those 4 bytes until the entire packet has been received, however I want it to fetch 4 bytes, then allow me to parse them, and then get the rest of the packet. Can anyone provide me with a working example, or at least a pointer on how to make it work properly ? Regards, Xeross

    Read the article

< Previous Page | 684 685 686 687 688 689 690 691 692 693 694 695  | Next Page >