Search Results

Search found 6622 results on 265 pages for 'match'.

Page 69/265 | < Previous Page | 65 66 67 68 69 70 71 72 73 74 75 76  | Next Page >

• Tune cindent "switch" indentation

  - by Don Reba

  Nemerle is a C-like language and mostly works very well with cindent. However, its construct analogous to switch is called match: match (x) { | "Hello World" => ... | _ => ... } Is it possible to get the cinoptions for switch statements to apply to this construct, instead? Maybe there is a regular expression I can set somewhere. If not, can I get the vertical bars to align with the braces another way?

  Read the article

• mysql - check if data exists across multiple tables

  - by Dd Daym

  I am currently running this query inside MySQL to check if the specified values exists within the table associated with them. SELECT COUNT(artist.artist_id), COUNT(album.album_id), COUNT(tracks.track_id) FROM artist, album, tracks WHERE artist.artist_id = 320295 OR album.album_id = 1234 OR tracks.track_id = 809 The result I get from running this query is all 1, meaning that all the statements after the WHERE clause is true. To further check the query's reliability, I changed the tracks.track_ = 809 to 802, which I know does not match. However the results displayed are still all 1, meaning that they were all successfully matched even when I purposefully inserted a value which would not have matched. How do I get it to show 1 for a match and 0 for no matches within the same query? EDIT: I have inserted an image of the query running

  Read the article

• Property hiding and reflection (C#)

  - by tehMick

  Declaring a property in a derived class that matches the name of a property in the base class "hides" it (unless it overrides it with the override keyword). Both the base and derived class properties will be returned by Type.GetProperties() if their types don't match. However, if their types do match, shockingly only the derived class's property is returned. For instance: class A { protected double p; public int P { get { return (int)p; } set { p = value; } } } class B : A { public new int P { get { return (int)p; } set { p = value; } } } class C : B { public new float P { get { return (float)p; } set { p = value; } } } Calling typeof(C).GetProperties() will only return B.P and C.P. Is it possible to call GetProperties() in a way that returns all three? There is almost certainly a way to do it by traversing the inheritance hierarchy, but is there a cleaner solution?

  Read the article

• What is a regular express that matches all us phone numbers. No extension

  - by Kirk

  It needs to match 3334445555, 333.444.5555, 333-444-5555, 333 444 5555, (333) 444 5555 and all combinations thereof.

  Read the article

• Patterns for avoiding jQuery silent fails

  - by Matias

  Is there any good practice to avoid your jQuery code silently fail? For example: $('.this #is:my(complexSelector)').doSomething(); I know that every time this line get executed, the selector is intended to match at least one element, or certain amount of elements. Is there any standard or good way to validate that? I thought about something like this: var $matchedElements = $('.this #is:my(complexSelector)'); if ($matchedElements.length < 0) throw 'No matched elements'; $matchedElements.doSomething(); Also I think unit testing would be a valid option instead of messing the code. My question may be silly, but I wonder whether there is a better option than the things that I'm currently doing or not. Also, maybe I'm in the wrong way checking if any element match my selector. However, as the page continues growing, the selectors could stop matching some elements and pieces of functionality could stop working inadvertently.

  Read the article

• Why is my regex so much slower compiled than interpreted ?

  - by miket2e

  I have a large and complex C# regex that runs OK when interpreted, but is a bit slow. I'm trying to speed this up by setting RegexOptions.Compiled, and this seems to take about 30 seconds for the first time and instantly after that. I'm trying to negate this by compiling the regex to an assembly first, so my app can be as fast as possible. My problem is when the compiling delay takes place: Regex myComplexRegex = new Regex(regexText, RegexOptions.Compiled); MatchCollection matches = myComplexRegex.Matches(searchText); foreach (Match match in matches) // <--- when the one-time long delay kicks in { } This is making compiling to an assembly basically useless, as I still get the delay on the first foreach call. What I want is for all the compiling delay to be done in advance when I compile to the assembly, not when the user runs the app. Where am I going wrong ? (The code I'm using to compile to an assembly is similar to http://www.dijksterhuis.org/regular-expressions-advanced/ , if that's relevant ).

  Read the article

• boost variant static_visitor problem picking correct function

  - by Steve

  I'm sure I'm having a problem with template resolution here, but I'm not sure why I'm having the problem. I have a static visitor I'm passing to boost variant where i've had to do template specialization for certain cases. The case for everything except for MyClass should throw in the static_visitor below. Unfortunately, when the visitor is applied to pull a MyClass out, it selects the most generic case rather than the exact match. I would type each case explicitly, but that will be rather long. So, why is the compiler resolving the most generic case over the exact match, and is there anyway to fix it template<> class CastVisitor<MyClass>:public boost::static_visitor<MyClass> { public: template<typename U> MyClass operator()(const U & i) const { throw std::exception("Unable to cast"); } MyClass operator()(const MyClass& i) { return i; } };

  Read the article

• Allow a new line anywhere in the regex?

  - by Scott Chamberlain

  I am having a find a replace in a bunch of RTF documents, The basic pattern I need is \{(?:\\\*)?\\field\\fldlock\{\\\*\\fldinst ?MERGEFIELD ?((?:\\.*?)?[\w\[\]]+?)(?:\\.*?)?\}(?:\{\\fldrslt\})?\} However I then found out there could potentialy be a newline before each slash, so it turned in to this. \{(?:\s*\\\*)?\s*\\field\s*\\fldlock\s*\{\s*\\\*\s*\\fldinst\s*MERGEFIELD\s*((?:\\.*?)?[\w\[\]]+?(?:\s*\\.*?)?)?\s*\}(?:\s*\{\s*\\fldrslt\s*\})?\s*\} But then I hit this it fails fees totaling $\protect {\field\fldlock{\*\fldinst MERGEFIELD ENTEROUTSTANDINGVETERINARYF EES}}\plain\f0\fs24\prot Is there way have to have it match a new line anywhere in the search too without adding (?:\r?\n)? everywhere? EDIT To clear up confusion on the new lines. I need to keep the newlines in the document, I only want to remove the newlines if they are inside my match, so in the final example I posted it should replace fees totaling $\protect {\field\fldlock{\*\fldinst MERGEFIELD ENTEROUTSTANDINGVETERINARYF EES}}\plain\f0\fs24\prot with fees totaling $\protect ENTEROUTSTANDINGVETERINARYFEES\plain\f0\fs24\prot

  Read the article

• Query with multiple IN-statements but without the cartesian product

  - by Janne

  How could I make this kind of query e.g. in MySQL SELECT * FROM Table t WHERE t.a IN (1,2,3) AND t.b IN (4,5,6) AND t.c IN (7,8,9) ... so that the result would contain only the three rows: t.a|t.b|t.c ---+---+--- 1 | 4 | 7 2 | 5 | 8 3 | 6 | 9 The above query of course returns all the combinations of the values in the IN clauses but I would like to get just the ones where the first elements of each tuple match, second elements of each tuple match and so on. Is there any efficient way to do this? By the way is there some common term for this kind of query or concept? I'm having hard time coming up with the question's title because I can't put this into words..

  Read the article

• Java: How do I get the IP of the local interface that can reach a remote IP?

  - by Per Fagrell

  I have a Java application that registers a server component in a service provider, and then sends the service name to a client. The client uses the service name to get an address out of the service provider to the server. However, the server has several interfaces only 1 of which the client get get at, so the service must be registered with the right IP. We discovered the client through a broadcast, so I have the client IP and an Enumeration of the computers network interfaces. How do I match the IP to an interface, not knowing what the netmask of the client IP is? Spontaneously I imagine turning all the addresses to ints and chomping the local ips with their netmask and looking for a 'best match', but I wonder if there is a better way? (this is an enterprise(tm) solution, so cutting out the service provider isn't an option, at least not w/o a political campaign first ;) )

  Read the article

• How to display the found matches of preg_match function in PHP?

  - by Eric

  I am using the following to check if links exist on file.php: $fopen = fopen('file.php', 'r'); $fread = fread($fopen, filesize('file.php')); $pattern = "/^<a href=/i"; if (preg_match($pattern, $fread)) { echo 'Match Found'; } else { echo 'Match Not Found'; } if I echo preg_match($pattern, $fread) I get a boolean value, not the found matches. I tried what was on the php.net manual and did this: preg_match($pattern, $fread, $matches); then when I echoed $matches I got "Array" message. So I tried a foreach loop and when that didn't display anything I tried $matches[0] and that too outputted nothing. So how does one go about displaying the matches found?

  Read the article

• How can I implement a tail-recursive list append?

  - by martingw

  A simple append function like this (in F#): let rec app s t = match s with | [] -> t | (x::ss) -> x :: (app ss t) will crash when s becomes big, since the function is not tail recursive. I noticed that F#'s standard append function does not crash with big lists, so it must be implemented differently. So I wondered: How does a tail recursive definition of append look like? I came up with something like this: let rec comb s t = match s with | [] -> t | (x::ss) -> comb ss (x::t) let app2 s t = comb (List.rev s) t which works, but looks rather odd. Is there a more elegant definition?

  Read the article

• perl negative look behind with groupings

  - by user1539348

  I have a problem trying to get a certain match to work with negative look behind example @list = qw( apple banana cherry); $comb_tlist = join ("|", @tlist); $string1 = "include $(dir)/apple"; $string2 = "#include $(dir)/apple"; if( string1 =~ /^(?<!#).*($comb_tlist)/) #matching regex I tried, works The array holds a set of variables that is matched against the string. I need the regex to match $string1, but not $string2. It matches $string1, but it ALSO matches $string2. Can anyone tell me what I am attempting wrong here. Thanks!

  Read the article

• Regular expression question

  - by llm

  Please help me construct a regex to match: some text(x,x,x,x) where x can be any integer either positive or negative.

  Read the article

• What is the REGEX of a CSS selector

  - by user421563

  I'd like to parce a CSS file and add before every CSS selector another selector. From: p{margin:0 0 10px;} .lead{margin-bottom:20px;font-size:21px;font-weight:200;line-height:30px;} I'd like: .mySelector p{margin:0 0 10px;} .mySelector .lead{margin-bottom:20px;font-size:21px;font-weight:200;line-height:30px;} But my CSS file is really complex (in fact it is the bootstrap css file) so the regex should match all CSS selectors. For now I have this regex: ([^\r\n,{};]+)(,|{) and you can see the result here http://regexr.com?328ps but as you can see there are a lot of matches that shouldn't match for example: text-shadow:0 -1px 0 rgba(0, matchs positive but it shouldn't Does someone have a solution ? THX

  Read the article

• Is there a way to pass a regex capture to a block in Ruby?

  - by Gordon Fontenot

  I have a hash with a regex for the key and a block for the value. Something like the following: { 'test (.+?)' => { puts $1 } } Not exactly like that, obviously, since the block is being stored as a Proc, but that's the idea. I then have a regex match later on that looks a lot like this hash.each do |pattern, action| if /#{pattern}/i.match(string) action.call end end The idea was to store the block away in the hash to make it a bit easier for me to expand upon in the future, but now the regex capture doesn't get passed to the block. Is there a way to do this cleanly that would support any number of captures I put in the regex (as in, some regex patterns may have 1 capture, others may have 3)?

  Read the article

• meaning of (\/?) in regex / is (\w+)([^>]*?) a redundancy?

  - by thomas

  this regular expression should match an html start tag, I think. var results = html.match(/<(\/?)(\w+)([^>]*?)>/); I see it should first capture the <, but then I am confused what this capture (\/?) accomplishes. Am I correct in reasoning that the ([^>]*?)> searches for every character except > = 0 times? If so, why is the (\w+) capture necessary? Doesn't it fall within the purview of [^>]*?

  Read the article

• Best way to search a point across several polygons

  - by user1474341

  I have a requirement whereby I need to match a given point (lat,lon) against several polygons to decide if there is a match. The easiest way would be to iterative over each polygon and apply the point-in-polygon check algorithm, but that is prohibitively expensive. The next optimization that I did was to define a bounding rectangle for each polygon (upper bound, lower bound) and iteratively check the point against the bounding box (fewer comparisons as against checking all the points in the polygon). Is there any other optimization possible? Would a spatial index on the bound rectangle points or a geohash help ? Any guidance would be greatly appreciated. Thanks!

  Read the article

• Reverse Search Best Practices?

  - by edub

  I'm making an app that has a need for reverse searches. By this, I mean that users of the app will enter search parameters and save them; then, when any new objects get entered onto the system, if they match the existing search parameters that a user has saved, a notification will be sent, etc. I am having a hard time finding solutions for this type of problem. I am using Django and thinking of building the searches and pickling them using Q objects as outlined here: http://www.djangozen.com/blog/the-power-of-q The way I see it, when a new object is entered into the database, I will have to load every single saved query from the db and somehow run it against this one new object to see if it would match that search query... This doesn't seem ideal - has anyone tackled such a problem before?

  Read the article

• Substitute all matches with values in Ruby regular expression

  - by Lewisham

  Hi all, I'm having a problem with getting a Ruby string substitution going. I'm writing a preprocessor for a limited language that I'm using, that doesn't natively support arrays, so I'm hacking in my own. I have a line: x[0] = x[1] & x[1] = x[2] I want to replace each instance with a reformatted version: x__0 = x__1 & x__1 = x__2 The line may include square brackets elsewhere. I've got a regex that will match the array use: array_usage = /(\w+)\[(\d+)\]/ but I can't figure out the Ruby construct to replace each instance one by one. I can't use .gsub() because that will match every instance on the line, and replace every array declaration with whatever the first one was. .scan() complains that the string is being modified if you try and use scan with a .sub()! inside a block. Any ideas would be appreciated!

  Read the article

• extracting string occurrence in c

  - by David78

  I have a string from a text file that look something like this: long_str = "returns between paragraphs 20102/34.23" - 9203 1232 "test" "basic HTML" Note: Quotes are part of the string. int match(char *long_str){ char * str; if ((str = strchr(long_str, '"')) != NULL) str++; // last " ? else return 1; return 0; } Using strstr I'm trying to get the whole substring between the last two quotes: "basic HTML". I'm just not quite sure what would be a good and efficient way of getting that match. I'm open to any other ideas on how to approach this. Thanks

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Unable to replace & with &amp; in XML uses Preg_replace in PHP

  - by Raind

  Hi, Need help here. Am not able to replace the '&' with '&' uses Preg_replace in PhP. But, if i do it manually (edited) on the xml file, it works out fine. Here are the sample: $XMLCharactersPreg = "/[&<\"\'()^*@+]/"; $XMLPregReplace = "&"; $d_Description = "50% offer & 20% further reduction for member"; if (preg_match($XMLCharactersPreg, $d_Description)) { echo "A match was found."; $XMLDealDescription = preg_replace($XMLCharactersPreg , $XMLPregReplace, $d_Description); echo "$XMLDealDescription "; } else { echo "A match was not found."; } Thanks.

  Read the article

• VS2010 (older) installer project - two or more objects have the same target location.

  - by Hamish Grubijan

  This installer project was created back in 2004 and upgraded ever since. There are two offending dll files, which produce a total of 4 errors. I have searched online for this warning message and did not find a permanent fix (I did manage to make it go away once until I have done something like a clean, or built in Release, and then in Debug). I also tried cleaning, and then refreshing the dependencies. The duplicated entries are still in there. I also did not find a good explanation for what this error means. Additional warnings are of this nature: Warning 36 The version of the .NET Framework launch condition '.NET Framework 4' does not match the selected .NET Framework bootstrapper package. Update the .NET Framework launch condition to match the version of the .NET Framework selected in the Prerequisites Dialog Box. So, where is this prerequisites box? I want to make both things agree on .Net 4.0, just having a hard time locating both of them.

  Read the article

• Rails Routes Mappings

  - by rdasxy

  I'm a rails newbie, and I have a controller called resource_links that I've mapped to resources: resources :resources, :as => :resource_links, :controller => :resource_links And this works (basically /resources works as /resource_links). However, trying to go to /resources/tags does not work. To get around this, I added more mappings as: match 'resource_links/tag/:tag(.:format)' => 'resource_links#tag', :via => :get, :as => 'resource_links_tagged', :constraints => {:tag => /.*/} match 'resource_links/tags' => 'resource_links#tags', :via => :get, :as => 'resource_links_tags' Is there any way I can get /resources/tags to be mapped to /resource_links/tag?

  Read the article

< Previous Page | 65 66 67 68 69 70 71 72 73 74 75 76  | Next Page >