Search Results

Search found 9156 results on 367 pages for 'partial match'.

Page 69/367 | < Previous Page | 65 66 67 68 69 70 71 72 73 74 75 76  | Next Page >

  • Perl : get substring which matches regex error

    - by Michael Mao
    I am very new to Perl, so please bear with my simple question: Here is the sample output: Most successful agents in the Emarket climate are (in order of success): 1. agent10896761 ($-8008) 2. flightsandroomsonly ($-10102) 3. agent10479475hv ($-10663) Most successful agents in the Emarket climate are (in order of success): 1. agent10896761 ($-7142) 2. agent10479475hv ($-8982) 3. flightsandroomsonly ($-9124) I am interested only in agent names as well as their corresponding balances, so I am hoping to get the following output: agent10896761 -8008 flightsandroomsonly -10102 agent10479475hv -10663 agent10896761 -7142 agent10479475hv -8982 flightsandroomsonly -9124 For later processes. This is the code I've got so far: #!/usr/bin/perl -w open(MYINPUTFILE, $ARGV[0]); while(<MYINPUTFILE>) { my($line) = $_; chomp($line); # regex match test if($line =~ m/agent10479475/) { if($line =~ m/($-[0-9]+)/) { print "$1\n"; } } if($line =~ m/flightsandroomsonly/) { print "$line\n"; } } The second regex match has nothing wrong, 'cause that is printing out the whole line. However, for the first regex match, I've got some other output such like: $ ./compareResults.pl 3.txt 2. flightsandroomsonly ($-10102) 0479475 0479475 3. flightsandroomsonly ($-9124) 1. flightsandroomsonly ($-8053) 0479475 1. flightsandroomsonly ($-6126) 0479475 If I "escape" the braces like this if($line =~ m/\($-[0-9]+\)/) { print "$1\n"; } Then there is never a match for the first regex... So I'm stuck with a problem of making that particular regex work. Any hints for this? Many thanks in advance.

    Read the article

  • Python - Code snippet not working on Python 2.5.6, using IDLE

    - by Francisco P.
    Hello, everyone I am using a piece of self-modifying code for a college project. Here it is: import datetime import inspect import re import sys def main(): # print the time it is last run lastrun = 'Mon Jun 8 16:31:27 2009' print "This program was last run at ", print lastrun # read in the source code of itself srcfile = inspect.getsourcefile(sys.modules[__name__]) f = open(srcfile, 'r') src = f.read() f.close() # modify the embedded timestamp timestamp = datetime.datetime.ctime(datetime.datetime.now()) match = re.search("lastrun = '(.*)'", src) if match: src = src[:match.start(1)] + timestamp + src[match.end(1):] # write the source code back f = open(srcfile, 'w') f.write(src) f.close() if __name__=='__main__': main() Unfortunately, it doesn't work. Error returned: # This is the script's output This program is last run at Mon Jun 8 16:31:27 2009 # This is the error message Traceback (most recent call last): File "C:\Users\Rui Gomes\Desktop\teste.py", line 30, in <module> main() File "C:\Users\Rui Gomes\Desktop\teste.py", line 13, in main srcfile = inspect.getsourcefile(sys.modules[__name__]) File "C:\Python31\lib\inspect.py", line 439, in getsourcefile filename = getfile(object) File "C:\Python31\lib\inspect.py", line 401, in getfile raise TypeError('{!r} is a built-in module'.format(object)) TypeError: <module '__main__' (built-in)> is a built-in module I'd be thankful for any solutions.

    Read the article

  • PHP PCRE differences on testing and hosting servers

    - by Gary Pearman
    Hi all, I've got the following regular expression that works fine on my testing server, but just returns an empty string on my hosted server. $text = preg_replace('~[^\\pL\d]+~u', $use, $text); Now I'm pretty sure this comes down to the hosting server version of PCRE not being compiled with Unicode property support enabled. The differences in the two versions are as follows: My server: PCRE version 7.8 2008-09-05 Compiled with UTF-8 support Unicode properties support Newline sequence is LF \R matches all Unicode newlines Internal link size = 2 POSIX malloc threshold = 10 Default match limit = 10000000 Default recursion depth limit = 10000000 Match recursion uses stack Hosting server: PCRE version 4.5 01-December-2003 Compiled with UTF-8 support Newline character is LF Internal link size = 2 POSIX malloc threshold = 10 Default match limit = 10000000 Match recursion uses stack Also note that the version on the hosting server (the same version PHP is compiled against) is pretty old. What confuses me though, is that pcretest fails on both servers from the command line with re> ~[^\\pL\d]+~u ** Unknown option 'u' although this regexp works fine when run from PHP on my server. So, I guess my questions are does the regular expression fail on the hosting server because of the lack of Unicode properties? Or is there something else that I'm missing? Thanks all, Gaz.

    Read the article

  • codingBat separateThousands using regex (and unit testing how-to)

    - by polygenelubricants
    This question is a combination of regex practice and unit testing practice. Regex part I authored this problem separateThousands for personal practice: Given a number as a string, introduce commas to separate thousands. The number may contain an optional minus sign, and an optional decimal part. There will not be any superfluous leading zeroes. Here's my solution: String separateThousands(String s) { return s.replaceAll( String.format("(?:%s)|(?:%s)", "(?<=\\G\\d{3})(?=\\d)", "(?<=^-?\\d{1,3})(?=(?:\\d{3})+(?!\\d))" ), "," ); } The way it works is that it classifies two types of commas, the first, and the rest. In the above regex, the rest subpattern actually appears before the first. A match will always be zero-length, which will be replaceAll with ",". The rest basically looks behind to see if there was a match followed by 3 digits, and looks ahead to see if there's a digit. It's some sort of a chain reaction mechanism triggered by the previous match. The first basically looks behind for ^ anchor, followed by an optional minus sign, and between 1 to 3 digits. The rest of the string from that point must match triplets of digits, followed by a nondigit (which could either be $ or \.). My question for this part is: Can this regex be simplified? Can it be optimized further? Ordering rest before first is deliberate, since first is only needed once No capturing group Unit testing part As I've mentioned, I'm the author of this problem, so I'm also the one responsible for coming up with testcases for them. Here they are: INPUT, OUTPUT "1000", "1,000" "-12345", "-12,345" "-1234567890.1234567890", "-1,234,567,890.1234567890" "123.456", "123.456" ".666666", ".666666" "0", "0" "123456789", "123,456,789" "1234.5678", "1,234.5678" "-55555.55555", "-55,555.55555" "0.123456789", "0.123456789" "123456.789", "123,456.789" I haven't had much experience with industrial-strength unit testing, so I'm wondering if others can comment whether this is a good coverage, whether I've missed anything important, etc (I can always add more tests if there's a scenario I've missed).

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Hyperlink regex including http(s):// not working in C#

    - by Rory Fitzpatrick
    I think this is sufficiently different from similar questions to warrant a new one. I have the following regex to match the beginning hyperlink tags in HTML, including the http(s):// part in order to avoid mailto: links <a[^>]*?href=[""'](?<href>\\b(https?)://[^\[\]""]+?)[""'][^>]*?> When I run this through Nregex (with escaping removed) it matches correctly for the following test cases: <a href="http://www.bbc.co.uk"> <a href="http://bbc.co.uk"> <a href="https://www.bbc.co.uk"> <a href="mailto:[email protected]"> However when I run this in my C# code it fails. Here is the matching code: public static IEnumerable<string> GetUrls(this string input, string matchPattern) { var matches = Regex.Matches(input, matchPattern, RegexOptions.Compiled | RegexOptions.IgnoreCase); foreach (Match match in matches) { yield return match.Groups["href"].Value; } } And my tests: @"<a href=""https://www.bbc.co.uk"">bbc</a>".GetUrls(StringExtensions.HtmlUrlRegexPattern).Count().ShouldEqual(1); @"<a href=""mailto:[email protected]"">bbc</a>".GetUrls(StringExtensions.HtmlUrlRegexPattern).Count().ShouldEqual(0); The problem seems to be in the \\b(https?):// part which I added, removing this passes the normal URL test but fails the mailto: test. Anyone shed any light?

    Read the article

  • How do I extract a postcode from one column in SSIS using regular expression

    - by Aphillippe
    I'm trying to use a custom regex clean transformation (information found here ) to extract a post code from a mixed address column (Address3) and move it to a new column (Post Code) Example of incoming data: Address3: "London W12 9LZ" Incoming data could be any combination of place names with a post code at the start, middle or end (or not at all). Desired outcome: Address3: "London" Post Code: "W12 9LZ" Essentially, in plain english, "move (not copy) any post code found from address3 into Post Code". My regex skills aren't brilliant but I've managed to get as far as extracting the post code and getting it into its own column using the following regex, matching from Address3 and replacing into Post Code: Match Expression: (?<stringOUT>([A-PR-UWYZa-pr-uwyz]([0-9]{1,2}|([A-HK-Ya-hk-y][0-9]|[A-HK-Ya-hk-y][0-9] ([0-9]|[ABEHMNPRV-Yabehmnprv-y]))|[0-9][A-HJKS-UWa-hjks-uw])\ {0,1}[0-9][ABD-HJLNP-UW-Zabd-hjlnp-uw-z]{2}|([Gg][Ii][Rr]\ 0[Aa][Aa])|([Ss][Aa][Nn]\ {0,1}[Tt][Aa]1)|([Bb][Ff][Pp][Oo]\ {0,1}([Cc]\/[Oo]\ )?[0-9]{1,4})|(([Aa][Ss][Cc][Nn]|[Bb][Bb][Nn][Dd]|[BFSbfs][Ii][Qq][Qq]|[Pp][Cc][Rr][Nn]|[Ss][Tt][Hh][Ll]|[Tt][Dd][Cc][Uu]|[Tt][Kk][Cc][Aa])\ {0,1}1[Zz][Zz]))) Replace Expression: ${stringOUT} So this leaves me with: Address3: "London W12 9LZ" Post Code: "W12 9LZ" My next thought is to keep the above match/replace, then add another to match anything that doesn't match the above regex. I think it might be a negative lookahead but I can't seem to make it work. I'm using SSIS 2008 R2 and I think the regex clean transformation uses .net regex implementation. Thanks.

    Read the article

  • Algorithm to see if keywords exist inside a string

    - by rksprst
    Let's say I have a set of keywords in an array {"olympics", "sports tennis best", "tennis", "tennis rules"} I then have a large list (up to 50 at a time) of strings (or actually tweets), so they are a max of 140 characters. I want to look at each string and see what keywords are present there. In the case where a keyword is composed of multiple words like "sports tennis best", the words don't have to be together in the string, but all of them have to show up. I've having trouble figuring out an algorithm that does this efficiently. Do you guys have suggestions on a way to do this? Thanks! Edit: To explain a bit better each keyword has an id associated with it, so {1:"olympics", 2:"sports tennis best", 3:"tennis", 4:"tennis rules"} I want to go through the list of strings/tweets and see which group of keywords match. The output should be, this tweet belongs with keyword #4. (multiple matches may be made, so anything that matches keyword 2, would also match 3 -since they both contain tennis). When there are multiple words in the keyword, e.g. "sports tennis best" they don't have to appear together but have to all appear. e.g. this will correctly match: "i just played tennis, i love sports, its the best"... since this string contains "sports tennis best" it will match and be associated with the keywordID (which is 2 for this example).

    Read the article

  • A doubt on DOM parser used with Python

    - by fixxxer
    I'm using the following python code to search for a node in an XML file and changing the value of an attribute of one of it's children.Changes are happening correctly when the node is displayed using toxml().But, when it is written to a file, the attributes rearrange themselves(as seen in the Source and the Final XML below). Could anyone explain how and why this happen? Python code: #!/usr/bin/env python import xml from xml.dom.minidom import parse dom=parse("max.xml") #print "Please enter the store name:" for sku in dom.getElementsByTagName("node"): if sku.getAttribute("name") == "store": sku.childNodes[1].childNodes[5].setAttribute("value","Delhi,India") print sku.toxml() xml.dom.ext.PrettyPrint(dom, open("new.xml", "w")) a part of the Source XML: <node name='store' node_id='515' module='mpx.lib.node.simple_value.SimpleValue' config_builder='' inherant='false' description='Configurable Value'> <match> <property name='1' value='point'/> <property name='2' value='0'/> <property name='val' value='Store# 09204 Staten Island, NY'/> <property name='3' value='str'/> </match> </node> Final XML : <node config_builder="" description="Configurable Value" inherant="false" module="mpx.lib.node.simple_value.SimpleValue" name="store" node_id="515"> <match> <property name="1" value="point"/> <property name="2" value="0"/> <property name="val" value="Delhi,India"/> <property name="3" value="str"/> </match> </node>

    Read the article

  • Scroll to anchor

    - by ZyX
    I have the following userjs which is intended to remove anchor part of the URL but still jump to it: // ==UserScript== // @name PurgeAnchor // @include * // ==/UserScript== (function() { var reg=/^(.*)\#(.*)$/; var match=reg.exec(location); function ObjectPosition(obj) { var curtop = 0; if(obj.offsetParent) while(1) { curtop += obj.offsetTop; if(!obj.offsetParent) break; obj = obj.offsetParent; } else if(obj.y) curtop += obj.y; return curtop; } if(match) { document.location.replace(match[1]); sessionStorage.setItem("anchor", match[2]); } window.addEventListener("load", (function() { var anchor=sessionStorage.getItem("anchor"); if(anchor!==null) { var obj=document.getElementById(anchor); if(obj===null) { obj=document.getElementsByName(anchor)[0]; } var pos=0; if(obj!==null) { pos=ObjectPosition(obj); window.scrollTo(0, pos); } sessionStorage.removeItem("anchor"); } }), false); })() The problem is that if I have an empty <a> tag with the name set, it fails to jump. obj.scrollIntoView() also fails. Opera-10.52_pre6306, Gentoo.

    Read the article

  • How to parse out base file name using Script-Fu

    - by ongle
    Using Gimp 2.6.6 for MAC OS X (under X11) as downloaded from gimp.org. I'm trying to automate a boring manual process with Script-Fu. I needed to parse the image file name to save off various layers as new files using a suffix on the original file name. My original attempts went like this but failed because (string-search ...) doesn't seem to be available under 2.6 (a change to the scripting engine?). (set! basefilename (substring filename 0 (string-search "." filename))) Then I tried to use this information to parse out the base file name using regex but (re-match-nth ...) is not recognized either. (if (re-match "^(.*)[.]([^.]+)$" filename buffer) (set! basefilename (re-match-nth orig-name buffer 1)) ) And while pulling the value out of the vector ran without error, the resulting value is not considered a string when it is passed into (string-append ...). (if (re-match "^(.*)[.]([^.]+)$" filename buffer) (set! basefilename (vector-ref buffer 1)) ) So I guess my question is, how would I parse out the base file name?

    Read the article

  • python-iptables: Cryptic error when allowing incoming TCP traffic on port 1234

    - by Lucas Kauffman
    I wanted to write an iptables script in Python. Rather than calling iptables itself I wanted to use the python-iptables package. However I'm having a hard time getting some basic rules setup. I wanted to use the filter chain to accept incoming TCP traffic on port 1234. So I wrote this: import iptc chain = iptc.Chain(iptc.TABLE_FILTER,"INPUT") rule = iptc.Rule() target = iptc.Target(rule,"ACCEPT") match = iptc.Match(rule,'tcp') match.dport='1234' rule.add_match(match) rule.target = target chain.insert_rule(rule) However when I run this I get this thrown back at me: Traceback (most recent call last): File "testing.py", line 9, in <module> chain.insert_rule(rule) File "/usr/local/lib/python2.6/dist-packages/iptc/__init__.py", line 1133, in insert_rule self.table.insert_entry(self.name, rbuf, position) File "/usr/local/lib/python2.6/dist-packages/iptc/__init__.py", line 1166, in new obj.refresh() File "/usr/local/lib/python2.6/dist-packages/iptc/__init__.py", line 1230, in refresh self._free() File "/usr/local/lib/python2.6/dist-packages/iptc/__init__.py", line 1224, in _free self.commit() File "/usr/local/lib/python2.6/dist-packages/iptc/__init__.py", line 1219, in commit raise IPTCError("can't commit: %s" % (self.strerror())) iptc.IPTCError: can't commit: Invalid argument Exception AttributeError: "'NoneType' object has no attribute 'get_errno'" in <bound method Table.__del__ of <iptc.Table object at 0x7fcad56cc550>> ignored Does anyone have experience with python-iptables that could enlighten on what I did wrong?

    Read the article

  • A question about DOM parser used with Python

    - by fixxxer
    I'm using the following python code to search for a node in an XML file and changing the value of an attribute of one of it's children.Changes are happening correctly when the node is displayed using toxml().But, when it is written to a file, the attributes rearrange themselves(as seen in the Source and the Final XML below). Could anyone explain how and why this happen? Python code: #!/usr/bin/env python import xml from xml.dom.minidom import parse dom=parse("max.xml") #print "Please enter the store name:" for sku in dom.getElementsByTagName("node"): if sku.getAttribute("name") == "store": sku.childNodes[1].childNodes[5].setAttribute("value","Delhi,India") print sku.toxml() xml.dom.ext.PrettyPrint(dom, open("new.xml", "w")) a part of the Source XML: <node name='store' node_id='515' module='mpx.lib.node.simple_value.SimpleValue' config_builder='' inherant='false' description='Configurable Value'> <match> <property name='1' value='point'/> <property name='2' value='0'/> <property name='val' value='Store# 09204 Staten Island, NY'/> <property name='3' value='str'/> </match> </node> Final XML : <node config_builder="" description="Configurable Value" inherant="false" module="mpx.lib.node.simple_value.SimpleValue" name="store" node_id="515"> <match> <property name="1" value="point"/> <property name="2" value="0"/> <property name="val" value="Delhi,India"/> <property name="3" value="str"/> </match> </node>

    Read the article

  • Why this Either-monad code does not type check?

    - by pf_miles
    instance Monad (Either a) where return = Left fail = Right Left x >>= f = f x Right x >>= _ = Right x this code frag in 'baby.hs' caused the horrible compilation error: Prelude> :l baby [1 of 1] Compiling Main ( baby.hs, interpreted ) baby.hs:2:18: Couldn't match expected type `a1' against inferred type `a' `a1' is a rigid type variable bound by the type signature for `return' at <no location info> `a' is a rigid type variable bound by the instance declaration at baby.hs:1:23 In the expression: Left In the definition of `return': return = Left In the instance declaration for `Monad (Either a)' baby.hs:3:16: Couldn't match expected type `[Char]' against inferred type `a1' `a1' is a rigid type variable bound by the type signature for `fail' at <no location info> Expected type: String Inferred type: a1 In the expression: Right In the definition of `fail': fail = Right baby.hs:4:26: Couldn't match expected type `a1' against inferred type `a' `a1' is a rigid type variable bound by the type signature for `>>=' at <no location info> `a' is a rigid type variable bound by the instance declaration at baby.hs:1:23 In the first argument of `f', namely `x' In the expression: f x In the definition of `>>=': Left x >>= f = f x baby.hs:5:31: Couldn't match expected type `b' against inferred type `a' `b' is a rigid type variable bound by the type signature for `>>=' at <no location info> `a' is a rigid type variable bound by the instance declaration at baby.hs:1:23 In the first argument of `Right', namely `x' In the expression: Right x In the definition of `>>=': Right x >>= _ = Right x Failed, modules loaded: none. why this happen? and how could I make this code compile ? thanks for any help~

    Read the article

  • why does this boost::spirit::qi rule not work?

    - by Tobias Langner
    I have a grammar that defines the following rules: constantValue = qi::token(ID_FLOAT) | qi::token(ID_INTEGER); postfixExpression = primaryExpression | (postfixExpression >> qi::token(ID_OPENBRACKET) >> qi::token(ID_INTEGER) >> qi::token(ID_CLOSEBRACKET)) | (postfixExpression >> qi::token(ID_DOT) >> qi::token(ID_IDENTIFIER)); primaryExpression = qi::token(ID_IDENTIFIER) | constantValue | (qi::token(ID_OPENPAREN) >> primaryExpression >> qi::token(ID_CLOSEPAREN)); ges = postfixExpression >> qi::eoi; and I want it to match the following strings: test[1] testident.ident and it should not match test[1.2] testident.5 but it fails to match the first 2 strings. The lexer constructor is as follows: custom_lexer() : identifier("[a-zA-Z_][a-zA-Z0-9_]*") , white_space("[ \\t\\n]+") , integer_value("[1-9][0-9]*") , hex_value("0[xX][0-9a-fA-F]+") , float_value("[0-9]*\\.[0-9]+([eE][+-]?[0-9]+)?") , float_value2("[0-9]+\\.([eE][+-]?[0-9]+)?") , punctuator("&>|\\*\\*|\\*|\\+|-|~|!|\\/|%|<<|>>|<|>|<=|>=|==|!=|\\^|&|\\||\\^\\^|&&|\\|\\||\\?|:|,")// [ ] ( ) . &> ** * + - ~ ! / % << >> < > <= >= == != ^ & | ^^ && || ? : , { using boost::spirit::lex::_start; using boost::spirit::lex::_end; this->self.add (identifier, ID_IDENTIFIER) /*(white_space, ID_WHITESPACE)*/ (integer_value, ID_INTEGER) (hex_value, ID_INTEGER) (float_value, ID_FLOAT) (float_value2, ID_FLOAT) ("\\(", ID_OPENPAREN) ("\\)", ID_CLOSEPAREN) ("\\[", ID_OPENBRACKET) ("\\]", ID_CLOSEBRACKET) ("\\.", ID_DOT) (punctuator, ID_PUNCTUATOR) ; this->self("WS") = white_space; } Why don't I get a match for the mentioned strings? Thank you Tobias

    Read the article

  • Is there a way to customize how the value for a custom Model Field is displayed in a template?

    - by Jordan Reiter
    I am storing dates as an integer field in the format YYYYMMDD, where month or day is optional. I have the following function for formatting the number: def flexibledateformat(value): import datetime, re try: value = str(int(value)) except: return None match = re.match(r'(\d{4})(\d\d)(\d\d)$',str(value)) if match: year_val, month_val, day_val = [int(v) for v in match.groups()] if day_val: return datetime.datetime.strftime(datetime.date(year_val,month_val,day_val),'%b %e, %Y') elif month_val: return datetime.datetime.strftime(datetime.date(year_val,month_val,1),'%B %Y') else: return str(year_val) Which results in the following outputs: >>> flexibledateformat(20100415) 'Apr 15, 2010' >>> flexibledateformat(20100400) 'April 2010' >>> flexibledateformat(20100000) '2010' So I'm wondering if there's a function I can add under the model field class that would automatically call flexibledateformat. So if there's a record r = DataRecord(name='foo',date=20100400) when processed in the form the value would be 20100400 but when output in a template using {{ r.date }} it shows up as "April 2010". Further clarification I do normally use datetime for storing date/time values. In this specific case, I need to record non-specific dates: "x happened in 2009", "y happened sometime in June 1996". The easiest way to do this while still preserving most of the functionality of a date field, including sorting and filtering, is by using an integer in the format of yyyymmdd. That is why I am using an IntegerField instead of a DateTimeField. This is what I would like to happen: I store what I call a "Flexible Date" in a FlexibleDateField as an integer with the format yyyymmdd. I render a form that includes a FlexibleDateField, and the value remains an integer so that functions necessary for validating it and rendering it in widgets work correctly. I call it in a template, as in {{ object.flexibledate }} and it is formatted according to the flexibledateformat rules: 20100416 - April 16, 2010; 20100400 - April 2010; 20100000 - 2010. This also applies when I'm not calling it directly, such as when it's used as a header in admin (http://example.org/admin/app_name/model_name/). I'm not aware if these specific things are possible.

    Read the article

  • Best way to convert a Unicode URL to ASCII (UTF-8 percent-escaped) in Python?

    - by benhoyt
    I'm wondering what's the best way -- or if there's a simple way with the standard library -- to convert a URL with Unicode chars in the domain name and path to the equivalent ASCII URL, encoded with domain as IDNA and the path %-encoded, as per RFC 3986. I get from the user a URL in UTF-8. So if they've typed in http://?.ws/? I get 'http://\xe2\x9e\xa1.ws/\xe2\x99\xa5' in Python. And what I want out is the ASCII version: 'http://xn--hgi.ws/%E2%99%A5'. What I do at the moment is split the URL up into parts via a regex, and then manually IDNA-encode the domain, and separately encode the path and query string with different urllib.quote() calls. # url is UTF-8 here, eg: url = u'http://?.ws/?'.encode('utf-8') match = re.match(r'([a-z]{3,5})://(.+\.[a-z0-9]{1,6})' r'(:\d{1,5})?(/.*?)(\?.*)?$', url, flags=re.I) if not match: raise BadURLException(url) protocol, domain, port, path, query = match.groups() try: domain = unicode(domain, 'utf-8') except UnicodeDecodeError: return '' # bad UTF-8 chars in domain domain = domain.encode('idna') if port is None: port = '' path = urllib.quote(path) if query is None: query = '' else: query = urllib.quote(query, safe='=&?/') url = protocol + '://' + domain + port + path + query # url is ASCII here, eg: url = 'http://xn--hgi.ws/%E3%89%8C' Is this correct? Any better suggestions? Is there a simple standard-library function to do this?

    Read the article

  • Perl : get substring which matches refex error

    - by Michael Mao
    Hi all: I am very new to Perl, so please bear with my simple question: Here is the sample output: Most successful agents in the Emarket climate are (in order of success): 1. agent10896761 ($-8008) 2. flightsandroomsonly ($-10102) 3. agent10479475hv ($-10663) Most successful agents in the Emarket climate are (in order of success): 1. agent10896761 ($-7142) 2. agent10479475hv ($-8982) 3. flightsandroomsonly ($-9124) I am interested only in agent names as well as their corresponding balances, so I am hoping to get the following output: agent10896761 -8008 flightsandroomsonly -10102 agent10479475hv -10663 agent10896761 -7142 agent10479475hv -8982 flightsandroomsonly -9124 For later processes. This is the code I've got so far: #!/usr/bin/perl -w open(MYINPUTFILE, $ARGV[0]); while(<MYINPUTFILE>) { my($line) = $_; chomp($line); # regex match test if($line =~ m/agent10479475/) { if($line =~ m/($-[0-9]+)/) { print "$1\n"; } } if($line =~ m/flightsandroomsonly/) { print "$line\n"; } } The second regex match has nothing wrong, 'cause that is printing out the whole line. However, for the first regex match, I've got some other output such like: $ ./compareResults.pl 3.txt 2. flightsandroomsonly ($-10102) 0479475 0479475 3. flightsandroomsonly ($-9124) 1. flightsandroomsonly ($-8053) 0479475 1. flightsandroomsonly ($-6126) 0479475 If I "escape" the braces like this if($line =~ m/\($-[0-9]+\)/) { print "$1\n"; } Then there is never a match for the first regex... So I stuck with a problem of making that particular regex work. Any hints for this? Many thanks in advance.

    Read the article

  • Detect how many times the users have click the button...

    - by Jerry
    Hello guys. Just want to know if there is a way to detect how many times a user has clicked a button by using Jquery. My main application has a button that can add input fields depend on the users. He/She can adds as many input fields as they need. When they submit the form, The add page will add the data to my database. My current idea is to create a hidden input field and set the value to zero. Every time a user clicks the button, jquery would update the attribute of the hidden input field value. Then the "add page" can detect the loop time. See the example below. I just want to know if there are better practices to do this. Thanks for the helps. main page <form method='post' action='add.php'> //omit <input type="hidden" id="add" name="add" value="0"/> <input type="button" id="addMatch" value="Add a match"/> //omit </form> jquery $(document).ready(function(){ var a =0; $("#addMatch").live('click', function(){ $('#table').append("<input name='match"+a+"Name' />") //the input field will append //as many as the user wants. a++; $('#add').attr('value', 'a'); //pass the a value to hidden input field return false; }); Add Page $a=$_POST['a']; // for($k=0;$k<$a;$k++){ //get all matchName input field $matchName=$_POST['match'.$k.'Name']; //insert the match $updateQuery=mysql_query("INSERT INTO game (team) values('$matchName')",$connection); if(!$updateQuery){ DIE('mysql Error:'+mysql_error()); }

    Read the article

  • How to detect how many time the users have click the button...

    - by Jerry
    Hello guys. Just want to know if there is a way to detect how many times a user has clicked a button by using Jquery. My main application has a button that can add input fields depend on the users. He/She can adds as many input fields as they need. When they submit the form, The add page will add the data to my database. My current idea is to create a hidden input field and set the value to zero. Every time a user clicks the button, jquery would update the attribute of the hidden input field value. Then the "add page" can detect the loop time. See the example below. I just want to know if there are better practices to do this. Thanks for the helps. main page <form method='post' action='add.php'> //omit <input type="hidden" id="add" name="add" value="0"/> <input type="button" id="addMatch" value="Add a match"/> //omit </form> jquery $(document).ready(function(){ var a =0; $("#addMatch").live('click', function(){ $('#table').append("<input name='match"+a+"Name' />") //the input field will append //as many as the user wants. a++; $('#add').attr('name', 'a'); //pass the a value to hidden input field return false; }); Add Page $a=$_POST['a']; // for($k=0;$k<$a;$k++){ //get all matchName input field $matchName=$_POST['match'.$k.'Name']; //insert the match $updateQuery=mysql_query("INSERT INTO game (team) values('$matchName')",$connection); if(!$updateQuery){ DIE('mysql Error:'+mysql_error()); }

    Read the article

  • Java Scanner newline parsing with regex (Bug?)

    - by SEK
    I'm developing a syntax analyzer by hand in Java, and I'd like to use regex's to parse the various token types. The problem is that I'd also like to be able to accurately report the current line number, if the input doesn't conform to the syntax. Long story short, I've run into a problem when I try to actually match a newline with the Scanner class. To be specific, when I try to match a newline with a pattern using the Scanner class, it fails. Almost always. But when I perform the same matching using a Matcher and the same source string, it retrieves the newline exactly as you'd expect it too. Is there a reason for this, that I can't seem to discover, or is this a bug, as I suspect? FYI: I was unable to find a bug in the Sun database that describes this issue, so if it is a bug, it hasn't been reported. Example Code: Pattern newLinePattern = Pattern.compile("(\\r\\n?|\\n)", Pattern.MULTILINE); String sourceString = "\r\n\n\r\r\n\n"; Scanner scan = new Scanner(sourceString); scan.useDelimiter(""); int count = 0; while (scan.hasNext(newLinePattern)) { scan.next(newLinePattern); count++; } System.out.println("found "+count+" newlines"); // finds 7 newlines Matcher match = newLinePattern.matcher(sourceString); count = 0; while (match.find()) { count++; } System.out.println("found "+count+" newlines"); // finds 5 newlines

    Read the article

  • return only the last select results from stored procedure

    - by Madalina Dragomir
    The requirement says: stored procedure meant to search data, based on 5 identifiers. If there is an exact match return ONLY the exact match, if not but there is an exact match on the not null parameters return ONLY these results, otherwise return any match on any 4 not null parameters... and so on My (simplified) code looks like: create procedure xxxSearch @a nvarchar(80), @b nvarchar(80)... as begin select whatever from MyTable t where ((@a is null and t.a is null) or (@a = t.a)) and ((@b is null and t.b is null) or (@b = t.b))... if @@ROWCOUNT = 0 begin select whatever from MyTable t where ((@a is null) or (@a = t.a)) and ((@b is null) or (@b = t.b))... if @@ROWCOUNT = 0 begin ... end end end As a result there can be more sets of results selected, the first ones empty and I only need the last one. I know that it is easy to get the only the last result set on the application side, but all our stored procedure calls go through a framework that expects the significant results in the first table and I'm not eager to change it and test all the existing SPs. Is there a way to return only the last select results from a stored procedure? Is there a better way to do this task ?

    Read the article

  • Fast serarch of 2 dimensional array

    - by Tim
    I need a method of quickly searching a large 2 dimensional array. I extract the array from Excel, so 1 dimension represents the rows and the second the columns. I wish to obtain a list of the rows where the columns match certain criteria. I need to know the row number (or index of the array). For example, if I extract a range from excel. I may need to find all rows where column A =”dog” and column B = 7 and column J “a”. I only know which columns and which value to find at run time, so I can’t hard code the column index. I could use a simple loop, but is this efficient ? I need to run it several thousand times, searching for different criteria each time. For r As Integer = 0 To UBound(myArray, 0) - 1 match = True For c = 0 To UBound(myArray, 1) - 1 If not doesValueMeetCriteria(myarray(r,c) then match = False Exit For End If Next If match Then addRowToMatchedRows(r) Next The doesValueMeetCriteria function is a simple function that checks the value of the array element against the query requirement. e.g. Column A = dog etc. Is it more effiecent to create a datatable from the array and use the .select method ? Can I use Linq in some way ? Perhaps some form of dictionary or hashtable ? Or is the simple loop the most effiecent ? Your suggestions are most welcome.

    Read the article

  • Full Text Search like Google

    - by Eduardo
    I would like to implement full-text-search in my off-line (android) application to search the user generated list of notes. I would like it to behave just like Google (since most people are already used to querying to Google) My initial requirements are: Fast: like Google or as fast as possible, having 100000 documents with 200 hundred words each. Searching for two words should only return documents that contain both words (not just one word) (unless the OR operator is used) Case insensitive (aka: normalization): If I have the word 'Hello' and I search for 'hello' it should match. Diacritical mark insensitive: If I have the word 'así' a search for 'asi' should match. In Spanish, many people, incorrectly, either do not put diacritical marks or fail in correctly putting them. Stop word elimination: To not have a huge index meaningless words like 'and', 'the' or 'for' should not be indexed at all. Dictionary substitution (aka: stem words): Similar words should be indexed as one. For example, instances of 'hungrily' and 'hungry' should be replaced with 'hunger'. Phrase search: If I have the text 'Hello world!' a search of '"world hello"' should not match it but a search of '"hello world"' should match. Search all fields (in multifield documents) if no field specified (not just a default field) Auto-completion in search results while typing to give popular searches. (just like Google Suggest) How may I configure a full-text-search engine to behave as much as possible as Google? (I am mostly interested in Open Source, Java and in particular Lucene)

    Read the article

  • c++-to-python swig caused memory leak! Related to Py_BuildValue and SWIG_NewPointerObj

    - by usfree74
    Hey gurus, I have the following Swig code that caused memory leak. PyObject* FindBestMatch(const Bar& fp) { Foo* ptr(new Foo()); float match; // call a function to fill the foo pointer return Py_BuildValue( "(fO)", match, SWIG_NewPointerObj(ptr, SWIGTYPE_p_Foo, 0 /* own */)); } I figured that ptr is not freed properly. So I did the following: PyObject* FindBestMatch(const Bar& fp) { Foo* ptr(new Foo()); float match; // call a function to fill the foo pointer *PyObject *o = SWIG_NewPointerObj(ptr, SWIGTYPE_p_Foo, 1 /* own */);* <------- 1 means pass the ownership to python PyObject *result = Py_BuildValue("(fO)", match, o); Py_XDECREF(o); return result; } But I am not very sure whether this will cause memory corruption. Here, Py_XDECREF(o) will decrease the ref count, which can free memory used by object "o". But o is part of the return value "result". Freeing "o" can cause data corrupt, I guess? I tried my change. It works fine and the caller (python code) does see the expected data. But this could be because nobody else overwrites to that memory area. So what's the right way to deal with memory management of the above code? I search the swig docs, but don't see very concrete description. Please help! Thanks, xin

    Read the article

< Previous Page | 65 66 67 68 69 70 71 72 73 74 75 76  | Next Page >