Search Results

Search found 31207 results on 1249 pages for 'atg best practice in industries'.

Page 690/1249 | < Previous Page | 686 687 688 689 690 691 692 693 694 695 696 697  | Next Page >

  • Can this django query be improved?

    - by Hobhouse
    Given a model structure like this: class Book(models.Model): user = models.ForeignKey(User) class Readingdate(models.Model): book = models.ForeignKey(Book) date = models.DateField() One book may have several readingdates. How do I list books having at least one readingdate within a specific year? I can do this: from_date = datetime.date(2010,1,1) to_date = datetime.date(2010,12,31) book_ids = Readingdate.objects\ .filter(date__range=(from_date,to_date))\ .values_list('book_id', flat=True) books_read_2010 = Book.objects.filter(id__in=book_ids) Is it possible to do this with one queryset, or is this the best way?

    Read the article

  • Which is clearer form: if(!value) or if(flag == value) ?

    - by CodexArcanum
    I understand this is a subjective question, so I apologize if it needs to be closed, but I feel like it comes up often enough for me to wonder if there is a general preference for one form over the other. Obviously, the best answer is "refactor the code so you don't need to test for falsehood" but sometimes there's no easy way to do so and the "else" branch is simply to continue processing. So when you must have an "if not false" construct, which is the preferred standard: The not operator if(!value) Or the test for false if(value == false)

    Read the article

  • Play audio file on hover

    - by powtac
    What is the best solution to play an audio file on mouse over via JavaScript? And stop it when the mouse leaves the link. jQuery is available. <a href="/test.mp3" class="play">play</a>

    Read the article

  • Run python in a separate process

    - by Bialecki
    I'm looking for a quick bash script or program that will allow me to kick off a python script in a separate process. What's the best way to do this? I know this is incredibly simple, just curious if there's a preferred way to do it.

    Read the article

  • Eclipse project artefacts in Maven repository

    - by Georgios Gousios
    I want to use some of the libraries produced by the Eclipse project through Maven. I 've had a look at the main Maven repo and while it looks like that there are a few projects already imported, their versions are old and some important ones are missing (e.g. cdt). Is there any Eclipse project official Maven repository? If not, what would be the best option to use current versions of libraries such as the JDT compiler in a maven-enabled project?

    Read the article

  • Is it possible to resize text to fit a fixed size div?

    - by int3
    This seems like a pretty natural use case to me, though I haven't been able to find anything on it: Say I have a fixed-width div that is dynamically populated with some number. What's the best way to ensure that numbers with more digits take smaller font sizes such that they fit nicely into that fixed width? Is there some CSS property for this, or do I have to resort to Javascript hackage?

    Read the article

  • Inter process communication C# <--> C++ for game debugging engine.

    - by Andy
    I am working on a debugger project for a game's scripting engine. I'm hoping to write the debugger's GUI in C#. The actual debugging engine, however, is embedded in the game itself and is written in a mixture of C, C++, and assembly patches. What's the best way to handle communication between the debugger GUI and the debugging engine? The two will be running in separate processes. Thanks! Andy

    Read the article

  • Sanitising user input using Python

    - by Steve
    What's the best way to sanitise user input for a Python-based web application? Is there a single function to remove HTML characters and any other necessary characters combinations to ensure that an XSS or SQL injection attack isn't possible?

    Read the article

  • Undo/Redo using Memento: Stack, Queue or just LinkedList?

    - by serhio
    What is the best having when implementing Memento pattern (for Undo/Redo) in witch collection to Keep Mementos? Basically, I need this(c = change, u = undo, r = redo): 0 *c -1 0 *c -2 -1 0 *c -3 -2 -1 0 <u -2 -1 0 1 *c -3 -2 -1 0 Variants: LinkedList - possible in principle, maybe not optimized. Queue - not adapted for this task, IMO. Stack - not adapted for undo AND redo; Double Stack - maybe optimal, but can't control the undo maximum size.

    Read the article

  • Rearrange items in ListBox

    - by superexsl
    Hey, I have a ListBox with a number of ListBoxItem objects. What is the best way to allow users to rearrange the items by dragging and dropping? Do I have to use StackPanels instead? Thanks for any suggestions

    Read the article

  • Redis - which PHP module to use?

    - by Patrick
    If i check redis php supported language (http://code.google.com/p/redis/wiki/SupportedLanguages), there's 4 PHP ones: Redis PHP Bindings,phpredis,Predis,Redisent. Question is, which is the best and good to use? Thanks!

    Read the article

  • Recommendations for Open Source Parallel programming IDE

    - by Andrew Bolster
    What are the best IDE's / IDE plugins / Tools, etc for programming with CUDA / MPI etc? I've been working in these frameworks for a short while but feel like the IDE could be doing more heavy lifting in terms of scaling and job processing interactions. (I usually use Eclipse or Netbeans, and usually in C/C++ with occasional Java, and its a vague question but I can't think of any more specific way to put it)

    Read the article

  • I simple search controller that stores search history, should I use resource routing or non-resource?

    - by vfilby
    I am learning rails and am toying with a simple web-app that integrates with flickr to search photos based on user given criteria and store the query in a search history table. I am seeking the best or 'rails' way of handling this. Should I setup a controller and non-resource routes that handle the search and store the data in a custom table; or should I create a resource for queries with a resource route and an additional path for search?

    Read the article

  • Warning: pointer of type 'void *' used in subtraction

    - by idealistikz
    Although it runs correctly, the following results in the aforementioned compiler warning: return ((item - (my->items))/(my->itemSize)); 'item' is a 'void *'; 'my-items' is a 'void *'; 'my-itemSize' is an 'int' Casting 'item' and 'my-items' as an 'int *' caused the program to run improperly. What is the best way to remove the warning?

    Read the article

  • WCF MSMQ consumer thread count

    - by Andy White
    What's the best way to configure the maximum number of threads that can pull messages from an MSMQ queue, using a netMsmqBinding in WCF? For example, say I have an MSMQ service for which I only want to have 2 (or 10, or whatever number of) worker threads pulling messages off at a time.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How can I retrieve the instance of an attribute's associated object?

    - by Brandon Linton
    I'm writing a PropertiesMustMatch validation attribute that can take a string property name as a parameter. I'd like it to find the corresponding property by name on that object and do a basic equality comparison. What's the best way to access this through reflection? Also, I checked out the Validation application block in the Enterprise Library and decided its PropertyComparisonValidator was way too intense for what we need.

    Read the article

  • Rails 3 full-text search options (gems, plugins, etc)

    - by shiftshane
    I was wondering if there were any suggestions for how to best roll with full text searching in your Rails 3 apps? Thinking Sphinx and acts_as_ferret aren't updated for Rails 3 yet, and even basic activerecord search helpers like Searchlogic also aren't there yet. Any thoughts? Are you using any forked versions of the above gems that have been updated to Rails 3?

    Read the article

  • PHP show image if post result equals

    - by user342391
    I have a form that posts to a page. I want to display an image if the value of the item posted equals "paypal". I need to write something that says; if $_POST['method'] equals "paypal" then show paypal.gif if $_POST['method'] equals "mastercard" then show mastercard.gif I hope I made a bit of sense, new to php trying to learn the best I can

    Read the article

  • wpf Image resources and visual studio 2010 resource editor

    - by Berryl
    Hello My motivation for this question is really just to specify an image to be used in a user control via a dependency property for ImageSource. I'm hitting some pain points involving the management, access, and unit testing for this. Is the resource editor a good tool to use to maintain images for the application? What is the best way to translate the Bitmap from the editor to an ImageSource? How can I grab the resource Filename from the editor? Cheers, Berryl

    Read the article

  • Can anyone help with this Magento error?

    - by Duane
    Fatal error: Call to a member function getArea() on a non-object in {directory}/includes/src/Mage_Core_Model_App_Area.php on line 155 Cropped up when I installed an extension that I wrote on a clean install of Magento. When ported to the dev server it took it down and I cant seem to find where it has originated. Disabling the extension changes nothing. Along with clearing the cache and all the regular Magento hiccups. I've ensured that file permissions are correct to the best of my knowledge.

    Read the article

< Previous Page | 686 687 688 689 690 691 692 693 694 695 696 697  | Next Page >