Search Results

Search found 999 results on 40 pages for 'substring'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 7/40 | < Previous Page | 3 4 5 6 7 8 9 10 11 12 13 14  | Next Page >

  • SQL Server varchar to datetime

    - by Dezigo
    I have a field varchar(14) = 20090226115644 I need convert it to - 2009-02-26 11:56:44 (datetime format) My idea. use cast and convert.. but I always have errors. Conversion failed when converting datetime from character string. I made this, but don`t like it.. SELECT SUBSTRING(move,1,4) + '-' + SUBSTRING(move,5,2) + '-' + SUBSTRING(move,7,2) + ' ' + SUBSTRING(move,9,2) + ':' + SUBSTRING(move,11,2) + ':'+SUBSTRING(move,13,2) as new -- FROM [Test].[dbo].[container_events] where move IS not null Result :2009-02-26 11:56:44

    Read the article

  • how to pass an id number string to this class

    - by Phil
    I'm very much a vb person, but have had to use this id number class in c#. I got it from http://www.codingsanity.com/idnumber.htm : using System; using System.Text.RegularExpressions; namespace Utilities.SouthAfrica { /// <summary> /// Represents a South African Identity Number. /// valid number = 7707215230080 /// invalid test number = 1234567891234 /// /// </summary> [Serializable()] public class IdentityNumber { #region Enumerations /// <summary> /// Indicates a gender. /// </summary> public enum PersonGender { Female = 0, Male = 5 } public enum PersonCitizenship { SouthAfrican = 0, Foreign = 1 } #endregion #region Declarations static Regex _expression; Match _match; const string _IDExpression = @"(?<Year>[0-9][0-9])(?<Month>([0][1-9])|([1][0-2]))(?<Day>([0-2][0-9])|([3][0-1]))(?<Gender>[0-9])(?<Series>[0-9]{3})(?<Citizenship>[0-9])(?<Uniform>[0-9])(?<Control>[0-9])"; #endregion #region Constuctors /// <summary> /// Sets up the shared objects for ID validation. /// </summary> static IdentityNumber() { _expression = new Regex(_IDExpression, RegexOptions.Compiled | RegexOptions.Singleline); } /// <summary> /// Creates the ID number from a string. /// </summary> /// <param name="IDNumber">The string ID number.</param> public IdentityNumber(string IDNumber) { _match = _expression.Match(IDNumber.Trim()); } #endregion #region Properties /// <summary> /// Indicates the date of birth encoded in the ID Number. /// </summary> /// <exception cref="System.ArgumentException">Thrown if the ID Number is not usable.</exception> public DateTime DateOfBirth { get { if(IsUsable == false) { throw new ArgumentException("ID Number is unusable!", "IDNumber"); } int year = int.Parse(_match.Groups["Year"].Value); // NOTE: Do not optimize by moving these to static, otherwise the calculation may be incorrect // over year changes, especially century changes. int currentCentury = int.Parse(DateTime.Now.Year.ToString().Substring(0, 2) + "00"); int lastCentury = currentCentury - 100; int currentYear = int.Parse(DateTime.Now.Year.ToString().Substring(2, 2)); // If the year is after or at the current YY, then add last century to it, otherwise add // this century. // TODO: YY -> YYYY logic needs thinking about if(year > currentYear) { year += lastCentury; } else { year += currentCentury; } return new DateTime(year, int.Parse(_match.Groups["Month"].Value), int.Parse(_match.Groups["Day"].Value)); } } /// <summary> /// Indicates the gender for the ID number. /// </summary> /// <exception cref="System.ArgumentException">Thrown if the ID Number is not usable.</exception> public PersonGender Gender { get { if(IsUsable == false) { throw new ArgumentException("ID Number is unusable!", "IDNumber"); } int gender = int.Parse(_match.Groups["Gender"].Value); if(gender < (int) PersonGender.Male) { return PersonGender.Female; } else { return PersonGender.Male; } } } /// <summary> /// Indicates the citizenship for the ID number. /// </summary> /// <exception cref="System.ArgumentException">Thrown if the ID Number is not usable.</exception> public PersonCitizenship Citizenship { get { if(IsUsable == false) { throw new ArgumentException("ID Number is unusable!", "IDNumber"); } return (PersonCitizenship) Enum.Parse(typeof(PersonCitizenship), _match.Groups["Citizenship"].Value); } } /// <summary> /// Indicates if the IDNumber is usable or not. /// </summary> public bool IsUsable { get { return _match.Success; } } /// <summary> /// Indicates if the IDNumber is valid or not. /// </summary> public bool IsValid { get { if(IsUsable == true) { // Calculate total A by adding the figures in the odd positions i.e. the first, third, fifth, // seventh, ninth and eleventh digits. int a = int.Parse(_match.Value.Substring(0, 1)) + int.Parse(_match.Value.Substring(2, 1)) + int.Parse(_match.Value.Substring(4, 1)) + int.Parse(_match.Value.Substring(6, 1)) + int.Parse(_match.Value.Substring(8, 1)) + int.Parse(_match.Value.Substring(10, 1)); // Calculate total B by taking the even figures of the number as a whole number, and then // multiplying that number by 2, and then add the individual figures together. int b = int.Parse(_match.Value.Substring(1, 1) + _match.Value.Substring(3, 1) + _match.Value.Substring(5, 1) + _match.Value.Substring(7, 1) + _match.Value.Substring(9, 1) + _match.Value.Substring(11, 1)); b *= 2; string bString = b.ToString(); b = 0; for(int index = 0; index < bString.Length; index++) { b += int.Parse(bString.Substring(index, 1)); } // Calculate total C by adding total A to total B. int c = a + b; // The control-figure can now be determined by subtracting the ones in figure C from 10. string cString = c.ToString() ; cString = cString.Substring(cString.Length - 1, 1) ; int control = 0; // Where the total C is a multiple of 10, the control figure will be 0. if(cString != "0") { control = 10 - int.Parse(cString.Substring(cString.Length - 1, 1)); } if(_match.Groups["Control"].Value == control.ToString()) { return true; } } return false; } } #endregion } } Here is the code from my default.aspx.cs page: using System; using System.Collections.Generic; using System.Linq; using System.Web; using System.Web.UI; using System.Web.UI.WebControls; using Utilities.Southafrica; <- this is the one i added to public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { var someNumber = new IdentityNumber("123456"); <- gives error } } Can someone please tell the syntax for how I pass an id number to the class? Thanks

    Read the article

  • how to pass an id number string to this class (asp.net, c#)

    - by Phil
    I'm very much a vb person, but have had to use this id number class in c#. I got it from http://www.codingsanity.com/idnumber.htm : using System; using System.Text.RegularExpressions; namespace Utilities.SouthAfrica { /// <summary> /// Represents a South African Identity Number. /// valid number = 7707215230080 /// invalid test number = 1234567891234 /// /// </summary> [Serializable()] public class IdentityNumber { #region Enumerations /// <summary> /// Indicates a gender. /// </summary> public enum PersonGender { Female = 0, Male = 5 } public enum PersonCitizenship { SouthAfrican = 0, Foreign = 1 } #endregion #region Declarations static Regex _expression; Match _match; const string _IDExpression = @"(?<Year>[0-9][0-9])(?<Month>([0][1-9])|([1][0-2]))(?<Day>([0-2][0-9])|([3][0-1]))(?<Gender>[0-9])(?<Series>[0-9]{3})(?<Citizenship>[0-9])(?<Uniform>[0-9])(?<Control>[0-9])"; #endregion #region Constuctors /// <summary> /// Sets up the shared objects for ID validation. /// </summary> static IdentityNumber() { _expression = new Regex(_IDExpression, RegexOptions.Compiled | RegexOptions.Singleline); } /// <summary> /// Creates the ID number from a string. /// </summary> /// <param name="IDNumber">The string ID number.</param> public IdentityNumber(string IDNumber) { _match = _expression.Match(IDNumber.Trim()); } #endregion #region Properties /// <summary> /// Indicates the date of birth encoded in the ID Number. /// </summary> /// <exception cref="System.ArgumentException">Thrown if the ID Number is not usable.</exception> public DateTime DateOfBirth { get { if(IsUsable == false) { throw new ArgumentException("ID Number is unusable!", "IDNumber"); } int year = int.Parse(_match.Groups["Year"].Value); // NOTE: Do not optimize by moving these to static, otherwise the calculation may be incorrect // over year changes, especially century changes. int currentCentury = int.Parse(DateTime.Now.Year.ToString().Substring(0, 2) + "00"); int lastCentury = currentCentury - 100; int currentYear = int.Parse(DateTime.Now.Year.ToString().Substring(2, 2)); // If the year is after or at the current YY, then add last century to it, otherwise add // this century. // TODO: YY -> YYYY logic needs thinking about if(year > currentYear) { year += lastCentury; } else { year += currentCentury; } return new DateTime(year, int.Parse(_match.Groups["Month"].Value), int.Parse(_match.Groups["Day"].Value)); } } /// <summary> /// Indicates the gender for the ID number. /// </summary> /// <exception cref="System.ArgumentException">Thrown if the ID Number is not usable.</exception> public PersonGender Gender { get { if(IsUsable == false) { throw new ArgumentException("ID Number is unusable!", "IDNumber"); } int gender = int.Parse(_match.Groups["Gender"].Value); if(gender < (int) PersonGender.Male) { return PersonGender.Female; } else { return PersonGender.Male; } } } /// <summary> /// Indicates the citizenship for the ID number. /// </summary> /// <exception cref="System.ArgumentException">Thrown if the ID Number is not usable.</exception> public PersonCitizenship Citizenship { get { if(IsUsable == false) { throw new ArgumentException("ID Number is unusable!", "IDNumber"); } return (PersonCitizenship) Enum.Parse(typeof(PersonCitizenship), _match.Groups["Citizenship"].Value); } } /// <summary> /// Indicates if the IDNumber is usable or not. /// </summary> public bool IsUsable { get { return _match.Success; } } /// <summary> /// Indicates if the IDNumber is valid or not. /// </summary> public bool IsValid { get { if(IsUsable == true) { // Calculate total A by adding the figures in the odd positions i.e. the first, third, fifth, // seventh, ninth and eleventh digits. int a = int.Parse(_match.Value.Substring(0, 1)) + int.Parse(_match.Value.Substring(2, 1)) + int.Parse(_match.Value.Substring(4, 1)) + int.Parse(_match.Value.Substring(6, 1)) + int.Parse(_match.Value.Substring(8, 1)) + int.Parse(_match.Value.Substring(10, 1)); // Calculate total B by taking the even figures of the number as a whole number, and then // multiplying that number by 2, and then add the individual figures together. int b = int.Parse(_match.Value.Substring(1, 1) + _match.Value.Substring(3, 1) + _match.Value.Substring(5, 1) + _match.Value.Substring(7, 1) + _match.Value.Substring(9, 1) + _match.Value.Substring(11, 1)); b *= 2; string bString = b.ToString(); b = 0; for(int index = 0; index < bString.Length; index++) { b += int.Parse(bString.Substring(index, 1)); } // Calculate total C by adding total A to total B. int c = a + b; // The control-figure can now be determined by subtracting the ones in figure C from 10. string cString = c.ToString() ; cString = cString.Substring(cString.Length - 1, 1) ; int control = 0; // Where the total C is a multiple of 10, the control figure will be 0. if(cString != "0") { control = 10 - int.Parse(cString.Substring(cString.Length - 1, 1)); } if(_match.Groups["Control"].Value == control.ToString()) { return true; } } return false; } } #endregion } } Can someone please tell the syntax for how I pass an id number to the class? Thanks

    Read the article

  • String.substring(index) has stoped my thread in debug mode.

    - by Arkaha
    Hello! I work with j2me polish 2.0.7, in eclipse 3.4.2, with wtk2.5.2_01. I create control which draws text: normal, bold, and italic. The code below is parsing raw text, and search for * and _ symbols, if found than add to draw vector the text and the drawer, and it's just stops after getting second time to the line 58: String test = new String(raw_text_buff.substring(iter)); it stops in raw_text_buff.substring(iter), ONLY in debug mode.. raw text is: bla bla bla *1000* bla bla Full code: private String raw_text = "bla bla bla *1000* bla bla"; Vector draw_items = null; private void prepareText() { char open_char = 0; int open_pos = 0; Object []param = null; StringBuffer sb = new StringBuffer(); String raw_text_buff = new String(raw_text); int iter = 0; boolean was_reset = false; while(true) { char c = raw_text_buff.charAt(iter); if(iter == raw_text_buff.length() || c == '*' || c == '_') { if(sb.length() > 0) { BmFont viewer = null; String str = sb.toString(); if(open_char == '*' && null != bm_strong) { viewer = bm_strong.getViewer(str); }else if(open_char == '_' && null != bm_italic) { viewer = bm_italic.getViewer(str); }else if(null != bm_normal) { viewer = bm_normal.getViewer(str); }else { } param = new Object[2]; param[0] = str; param[1] = viewer; if(null == draw_items) draw_items = new Vector(); draw_items.addElement(param); sb = new StringBuffer(); if(open_char == 0 && (c == '*' || c=='_')) open_char = c; else open_char = 0; String test = new String(raw_text_buff.substring(iter)); // stucks here. raw_text_buff = test; iter = 0; was_reset = true; }else { open_char = c; } if(iter == raw_text_buff.length()) break; }else { sb.append(c); } ++iter; } } What I'm doing wrong?

    Read the article

  • How do we achieve "substring-match" under O(n) time?

    - by Pacerier
    I have an assignment that requires reading a huge file of random inputs, for example: Adana Izmir Adnan Menderes Apt Addis Ababa Aden ADIYAMAN ALDAN Amman Marka Intl Airport Adak Island Adelaide Airport ANURADHAPURA Kodiak Apt DALLAS/ADDISON Ardabil ANDREWS AFB etc.. If I specify a search term, the program is supposed to find the lines whereby a substring occurs. For example, if the search term is "uradha", the program is supposed to show ANURADHAPURA. If the search term is "airport", the program is supposed to show Amman Marka Intl Airport, Adelaide Airport A quote from the assignment specs: "You are to program this application taking efficiency into account as though large amounts of data and processing is involved.." I could easily achieve this functionality using a loop but the performance would be O(n). I was thinking of using a trie but it seems to only work if the substring starts from index 0. I was wondering what solutions are there which gives a performance better than O(n)?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • For which substring of the string1 matches occurred with the string2.

    - by Harikrishna
    I want to know that in particular string1 for which substring of the string1 the string2 matches.Like String str1="Order Number Order Time Trade Number"; String str2="Order Tm"; string regex = Regex.Escape(str2.Replace(@"\ ", @"\s*"); bool isColumnNameMatched = Regex.IsMatch(str1, regex, RegexOptions.IgnoreCase); I am using regex because "Order Tm" will also matches "Order Time".It gives bool value that matches occurred or not. But if it str2 is in str1 then I want to know at which position in the str1 the str2 matches. Like str2="Order Tm" then something like that returns the string which is matched with str2 in the str1.Here str2="Order Tm" then it should return like in the str1,Order Time is the substring where matches is occurred.

    Read the article

  • Which substring of the string1 matches with the string2.

    - by Harikrishna
    There are two strings. String str1="Order Number Order Time Trade Number"; String str2="Order Tm"; Then I want to know that str2 matches with which substring in the str1. string regex = Regex.Escape(str2.Replace(@"\ ", @"\s*"); bool isColumnNameMatched = Regex.IsMatch(str1, regex, RegexOptions.IgnoreCase); I am using regex because "Order Tm" will also matches "Order Time".It gives bool value that matches occurred or not. Like str2="Order Tm" then it should return like in the str1,Order Time is the substring where matches is occurred.

    Read the article

  • Java string too long?

    - by wrongusername
    I have the following code in Java (which worked just fine in C++ for some reason) which produces an error: int a; System.out.println("String length: " + input.length()); for(a = 0; ((a + 1) * 97) < input.length(); a++) { System.out.print("Substring at " + a + ": "); System.out.println(input.substring(a * 97, 97)); //other code here... } Output: String length: 340 Substring at 0: HelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHe Substring at 1: Exception in thread "AWT-EventQueue-0" java.lang.StringIndexOutOfBoundsException: String index out of range: -97 //long list of "at ..." stuff Substring at 2: Using a string of length 200, however, the following output is produced: String length: 200 Substring at 0: HelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHelloHe Substring at 1: That is it; no exceptions raised, just... nothing. What is happening here?

    Read the article

  • What is the best practice for reading a large number of custom settings from a text file?

    - by jawilmont
    So I have been looking through some code I wrote a few years ago for an economic simulation program. Each simulation has a large number of settings that can be saved to a file and later loaded back into the program to re-run the same/similar simulation. Some of the settings are optional or depend on what is being simulated. The code to read back the parameters is basically one very large switch statement (with a few nested switch statements). I was wondering if there is a better way to handle this situation. One line of the settings file might look like this: #RA:1,MT:DiscriminatoryPriceKDoubleAuction,OF:Demo Output.csv,QM:100,NT:5000,KP:0.5 //continues... And some of the code that would read that line: switch( Character.toUpperCase( s.charAt(0) ) ) { case 'R': randSeed = Integer.valueOf( s.substring(3).trim() ); break; case 'M': marketType = s.substring(3).trim(); System.err.println("MarketType: " + marketType); break; case 'O': outputFileName = s.substring(3).trim() ; break; case 'Q': quantityOfMarkets = Integer.valueOf( s.substring(3).trim() ); break; case 'N': maxTradesPerRound = Integer.valueOf( s.substring(3).trim() ); break; case 'K': kParameter = Float.valueOf( s.substring(3).trim() ); break; // continues... }

    Read the article

  • HSSFS Part 2.1 - Parsing @@VERSION

    - by Most Valuable Yak (Rob Volk)
    For Part 2 of the Handy SQL Server Function Series I decided to tackle parsing useful information from the @@VERSION function, because I am an idiot.  It turns out I was confused about CHARINDEX() vs. PATINDEX() and it pretty much invalidated my original solution.  All is not lost though, this mistake turned out to be informative for me, and hopefully for you. Referring back to the "Version" view in the prelude I started with the following query to extract the version number: SELECT DISTINCT SQLVersion, SUBSTRING(VersionString,PATINDEX('%-%',VersionString)+2, 12) VerNum FROM VERSION I used PATINDEX() to find the first hyphen "-" character in the string, since the version number appears 2 positions after it, and got these results: SQLVersion VerNum ----------- ------------ 2000 8.00.2055 (I 2005 9.00.3080.00 2005 9.00.4053.00 2008 10.50.1600.1 As you can see it was good enough for most of the values, but not for the SQL 2000 @@VERSION.  You'll notice it has only 3 version sections/octets where the others have 4, and the SUBSTRING() grabbed the non-numeric characters after.  To properly parse the version number will require a non-fixed value for the 3rd parameter of SUBSTRING(), which is the number of characters to extract. The best value is the position of the first space to occur after the version number (VN), the trick is to figure out how to find it.  Here's where my confusion about PATINDEX() came about.  The CHARINDEX() function has a handy optional 3rd parameter: CHARINDEX (expression1 ,expression2 [ ,start_location ] ) While PATINDEX(): PATINDEX ('%pattern%',expression ) Does not.  I had expected to use PATINDEX() to start searching for a space AFTER the position of the VN, but it doesn't work that way.  Since there are plenty of spaces before the VN, I thought I'd try PATINDEX() on another character that doesn't appear before, and tried "(": SELECT SQLVersion, SUBSTRING(VersionString,PATINDEX('%-%',VersionString)+2, PATINDEX('%(%',VersionString)) FROM VERSION Unfortunately this messes up the length calculation and yields: SQLVersion VerNum ----------- --------------------------- 2000 8.00.2055 (Intel X86) Dec 16 2008 19:4 2005 9.00.3080.00 (Intel X86) Sep 6 2009 01: 2005 9.00.4053.00 (Intel X86) May 26 2009 14: 2008 10.50.1600.1 (Intel X86) Apr 2008 10.50.1600.1 (X64) Apr 2 20 Yuck.  The problem is that PATINDEX() returns position, and SUBSTRING() needs length, so I have to subtract the VN starting position: SELECT SQLVersion, SUBSTRING(VersionString,PATINDEX('%-%',VersionString)+2, PATINDEX('%(%',VersionString)-PATINDEX('%-%',VersionString)) VerNum FROM VERSION And the results are: SQLVersion VerNum ----------- -------------------------------------------------------- 2000 8.00.2055 (I 2005 9.00.4053.00 (I Msg 537, Level 16, State 2, Line 1 Invalid length parameter passed to the LEFT or SUBSTRING function. Ummmm, whoops.  Turns out SQL Server 2008 R2 includes "(RTM)" before the VN, and that causes the length to turn negative. So now that that blew up, I started to think about matching digit and dot (.) patterns.  Sadly, a quick look at the first set of results will quickly scuttle that idea, since different versions have different digit patterns and lengths. At this point (which took far longer than I wanted) I decided to cut my losses and redo the query using CHARINDEX(), which I'll cover in Part 2.2.  So to do a little post-mortem on this technique: PATINDEX() doesn't have the flexibility to match the digit pattern of the version number; PATINDEX() doesn't have a "start" parameter like CHARINDEX(), that allows us to skip over parts of the string; The SUBSTRING() expression is getting pretty complicated for this relatively simple task! This doesn't mean that PATINDEX() isn't useful, it's just not a good fit for this particular problem.  I'll include a version in the next post that extracts the version number properly. UPDATE: Sorry if you saw the unformatted version of this earlier, I'm on a quest to find blog software that ACTUALLY WORKS.

    Read the article

  • SQL SERVER – Parsing SSIS Catalog Messages – Notes from the Field #030

    - by Pinal Dave
    [Note from Pinal]: This is a new episode of Notes from the Field series. SQL Server Integration Service (SSIS) is one of the most key essential part of the entire Business Intelligence (BI) story. It is a platform for data integration and workflow applications. The tool may also be used to automate maintenance of SQL Server databases and updates to multidimensional cube data. In this episode of the Notes from the Field series I requested SSIS Expert Andy Leonard to discuss one of the most interesting concepts of SSIS Catalog Messages. There are plenty of interesting and useful information captured in the SSIS catalog and we will learn together how to explore the same. The SSIS Catalog captures a lot of cool information by default. Here’s a query I use to parse messages from the catalog.operation_messages table in the SSISDB database, where the logged messages are stored. This query is set up to parse a default message transmitted by the Lookup Transformation. It’s one of my favorite messages in the SSIS log because it gives me excellent information when I’m tuning SSIS data flows. The message reads similar to: Data Flow Task:Information: The Lookup processed 4485 rows in the cache. The processing time was 0.015 seconds. The cache used 1376895 bytes of memory. The query: USE SSISDB GO DECLARE @MessageSourceType INT = 60 DECLARE @StartOfIDString VARCHAR(100) = 'The Lookup processed ' DECLARE @ProcessingTimeString VARCHAR(100) = 'The processing time was ' DECLARE @CacheUsedString VARCHAR(100) = 'The cache used ' DECLARE @StartOfIDSearchString VARCHAR(100) = '%' + @StartOfIDString + '%' DECLARE @ProcessingTimeSearchString VARCHAR(100) = '%' + @ProcessingTimeString + '%' DECLARE @CacheUsedSearchString VARCHAR(100) = '%' + @CacheUsedString + '%' SELECT operation_id , SUBSTRING(MESSAGE, (PATINDEX(@StartOfIDSearchString,MESSAGE) + LEN(@StartOfIDString) + 1), ((CHARINDEX(' ', MESSAGE, PATINDEX(@StartOfIDSearchString,MESSAGE) + LEN(@StartOfIDString) + 1)) - (PATINDEX(@StartOfIDSearchString, MESSAGE) + LEN(@StartOfIDString) + 1))) AS LookupRowsCount , SUBSTRING(MESSAGE, (PATINDEX(@ProcessingTimeSearchString,MESSAGE) + LEN(@ProcessingTimeString) + 1), ((CHARINDEX(' ', MESSAGE, PATINDEX(@ProcessingTimeSearchString,MESSAGE) + LEN(@ProcessingTimeString) + 1)) - (PATINDEX(@ProcessingTimeSearchString, MESSAGE) + LEN(@ProcessingTimeString) + 1))) AS LookupProcessingTime , CASE WHEN (CONVERT(numeric(3,3),SUBSTRING(MESSAGE, (PATINDEX(@ProcessingTimeSearchString,MESSAGE) + LEN(@ProcessingTimeString) + 1), ((CHARINDEX(' ', MESSAGE, PATINDEX(@ProcessingTimeSearchString,MESSAGE) + LEN(@ProcessingTimeString) + 1)) - (PATINDEX(@ProcessingTimeSearchString, MESSAGE) + LEN(@ProcessingTimeString) + 1))))) = 0 THEN 0 ELSE CONVERT(bigint,SUBSTRING(MESSAGE, (PATINDEX(@StartOfIDSearchString,MESSAGE) + LEN(@StartOfIDString) + 1), ((CHARINDEX(' ', MESSAGE, PATINDEX(@StartOfIDSearchString,MESSAGE) + LEN(@StartOfIDString) + 1)) - (PATINDEX(@StartOfIDSearchString, MESSAGE) + LEN(@StartOfIDString) + 1)))) / CONVERT(numeric(3,3),SUBSTRING(MESSAGE, (PATINDEX(@ProcessingTimeSearchString,MESSAGE) + LEN(@ProcessingTimeString) + 1), ((CHARINDEX(' ', MESSAGE, PATINDEX(@ProcessingTimeSearchString,MESSAGE) + LEN(@ProcessingTimeString) + 1)) - (PATINDEX(@ProcessingTimeSearchString, MESSAGE) + LEN(@ProcessingTimeString) + 1)))) END AS LookupRowsPerSecond , SUBSTRING(MESSAGE, (PATINDEX(@CacheUsedSearchString,MESSAGE) + LEN(@CacheUsedString) + 1), ((CHARINDEX(' ', MESSAGE, PATINDEX(@CacheUsedSearchString,MESSAGE) + LEN(@CacheUsedString) + 1)) - (PATINDEX(@CacheUsedSearchString, MESSAGE) + LEN(@CacheUsedString) + 1))) AS LookupBytesUsed ,CASE WHEN (CONVERT(bigint,SUBSTRING(MESSAGE, (PATINDEX(@StartOfIDSearchString,MESSAGE) + LEN(@StartOfIDString) + 1), ((CHARINDEX(' ', MESSAGE, PATINDEX(@StartOfIDSearchString,MESSAGE) + LEN(@StartOfIDString) + 1)) - (PATINDEX(@StartOfIDSearchString, MESSAGE) + LEN(@StartOfIDString) + 1)))))= 0 THEN 0 ELSE CONVERT(bigint,SUBSTRING(MESSAGE, (PATINDEX(@CacheUsedSearchString,MESSAGE) + LEN(@CacheUsedString) + 1), ((CHARINDEX(' ', MESSAGE, PATINDEX(@CacheUsedSearchString,MESSAGE) + LEN(@CacheUsedString) + 1)) - (PATINDEX(@CacheUsedSearchString, MESSAGE) + LEN(@CacheUsedString) + 1)))) / CONVERT(bigint,SUBSTRING(MESSAGE, (PATINDEX(@StartOfIDSearchString,MESSAGE) + LEN(@StartOfIDString) + 1), ((CHARINDEX(' ', MESSAGE, PATINDEX(@StartOfIDSearchString,MESSAGE) + LEN(@StartOfIDString) + 1)) - (PATINDEX(@StartOfIDSearchString, MESSAGE) + LEN(@StartOfIDString) + 1)))) END AS LookupBytesPerRow FROM [catalog].[operation_messages] WHERE message_source_type = @MessageSourceType AND MESSAGE LIKE @StartOfIDSearchString GO Note that you have to set some parameter values: @MessageSourceType [int] – represents the message source type value from the following results: Value     Description 10           Entry APIs, such as T-SQL and CLR Stored procedures 20           External process used to run package (ISServerExec.exe) 30           Package-level objects 40           Control Flow tasks 50           Control Flow containers 60           Data Flow task 70           Custom execution message Note: Taken from Reza Rad’s (excellent!) helper.MessageSourceType table found here. @StartOfIDString [VarChar(100)] – use this to uniquely identify the message field value you wish to parse. In this case, the string ‘The Lookup processed ‘ identifies all the Lookup Transformation messages I desire to parse. @ProcessingTimeString [VarChar(100)] – this parameter is message-specific. I use this parameter to specifically search the message field value for the beginning of the Lookup Processing Time value. For this execution, I use the string ‘The processing time was ‘. @CacheUsedString [VarChar(100)] – this parameter is also message-specific. I use this parameter to specifically search the message field value for the beginning of the Lookup Cache  Used value. It returns the memory used, in bytes. For this execution, I use the string ‘The cache used ‘. The other parameters are built from variations of the parameters listed above. The query parses the values into text. The string values are converted to numeric values for ratio calculations; LookupRowsPerSecond and LookupBytesPerRow. Since ratios involve division, CASE statements check for denominators that equal 0. Here are the results in an SSMS grid: This is not the only way to retrieve this information. And much of the code lends itself to conversion to functions. If there is interest, I will share the functions in an upcoming post. If you want to get started with SSIS with the help of experts, read more over at Fix Your SQL Server. Reference: Pinal Dave (http://blog.sqlauthority.com)Filed under: Notes from the Field, PostADay, SQL, SQL Authority, SQL Backup and Restore, SQL Query, SQL Server, SQL Tips and Tricks, T SQL Tagged: SSIS

    Read the article

  • Web Sockets: Browser won't receive the message, complains about it not starting with 0x00 (byte)

    - by giggsey
    Here is my code: import java.net.*; import java.io.*; import java.util.*; import org.jibble.pircbot.*; public class WebSocket { public static int port = 12345; public static ArrayList<WebSocketClient> clients = new ArrayList<WebSocketClient>(); public static ArrayList<Boolean> handshakes = new ArrayList<Boolean>(); public static ArrayList<String> nicknames = new ArrayList<String>(); public static ArrayList<String> channels = new ArrayList<String>(); public static int indexNum; public static void main(String args[]) { try { ServerSocket ss = new ServerSocket(WebSocket.port); WebSocket.console("Created socket on port " + WebSocket.port); while (true) { Socket s = ss.accept(); WebSocket.console("New Client connecting..."); WebSocket.handshakes.add(WebSocket.indexNum,false); WebSocket.nicknames.add(WebSocket.indexNum,""); WebSocket.channels.add(WebSocket.indexNum,""); WebSocketClient p = new WebSocketClient(s,WebSocket.indexNum); Thread t = new Thread( p); WebSocket.clients.add(WebSocket.indexNum,p); indexNum++; t.start(); } } catch (Exception e) { WebSocket.console("ERROR - " + e.toString()); } } public static void console(String msg) { Date date = new Date(); System.out.println("[" + date.toString() + "] " + msg); } } class WebSocketClient implements Runnable { private Socket s; private int iAm; private String socket_res = ""; private String socket_host = ""; private String socket_origin = ""; protected String nick = ""; protected String ircChan = ""; WebSocketClient(Socket socket, int mynum) { s = socket; iAm = mynum; } public void run() { String client = s.getInetAddress().toString(); WebSocket.console("Connection from " + client); IRCclient irc = new IRCclient(iAm); Thread t = new Thread( irc ); try { Scanner in = new Scanner(s.getInputStream()); PrintWriter out = new PrintWriter(s.getOutputStream(),true); while (true) { if (! in.hasNextLine()) continue; String input = in.nextLine().trim(); if (input.isEmpty()) continue; // Lets work out what's wrong with our input if (input.length() > 3 && input.charAt(0) == 65533) { input = input.substring(2); } WebSocket.console("< " + input); // Lets work out if they authenticate... if (WebSocket.handshakes.get(iAm) == false) { checkForHandShake(input); continue; } // Lets check for NICK: if (input.length() > 6 && input.substring(0,6).equals("NICK: ")) { nick = input.substring(6); Random generator = new Random(); int rand = generator.nextInt(); WebSocket.console("I am known as " + nick); WebSocket.nicknames.set(iAm, "bo-" + nick + rand); } if (input.length() > 9 && input.substring(0,9).equals("CHANNEL: ")) { ircChan = "bo-" + input.substring(9); WebSocket.console("We will be joining " + ircChan); WebSocket.channels.set(iAm, ircChan); } if (! ircChan.isEmpty() && ! nick.isEmpty() && irc.started == false) { irc.chan = ircChan; irc.nick = WebSocket.nicknames.get(iAm); t.start(); continue; } else { irc.msg(input); } } } catch (Exception e) { WebSocket.console(e.toString()); e.printStackTrace(); } t.stop(); WebSocket.channels.remove(iAm); WebSocket.clients.remove(iAm); WebSocket.handshakes.remove(iAm); WebSocket.nicknames.remove(iAm); WebSocket.console("Closing connection from " + client); } private void checkForHandShake(String input) { // Check for HTML5 Socket getHeaders(input); if (! socket_res.isEmpty() && ! socket_host.isEmpty() && ! socket_origin.isEmpty()) { send("HTTP/1.1 101 Web Socket Protocol Handshake\r\n" + "Upgrade: WebSocket\r\n" + "Connection: Upgrade\r\n" + "WebSocket-Origin: " + socket_origin + "\r\n" + "WebSocket-Location: ws://" + socket_host + "/\r\n\r\n",false); WebSocket.handshakes.set(iAm,true); } return; } private void getHeaders(String input) { if (input.length() >= 8 && input.substring(0,8).equals("Origin: ")) { socket_origin = input.substring(8); return; } if (input.length() >= 6 && input.substring(0,6).equals("Host: ")) { socket_host = input.substring(6); return; } if (input.length() >= 7 && input.substring(0,7).equals("Cookie:")) { socket_res = "."; } /*input = input.substring(4); socket_res = input.substring(0,input.indexOf(" HTTP")); input = input.substring(input.indexOf("Host:") + 6); socket_host = input.substring(0,input.indexOf("\r\n")); input = input.substring(input.indexOf("Origin:") + 8); socket_origin = input.substring(0,input.indexOf("\r\n"));*/ return; } protected void send(String msg, boolean newline) { byte c0 = 0x00; byte c255 = (byte) 0xff; try { PrintWriter out = new PrintWriter(s.getOutputStream(),true); WebSocket.console("> " + msg); if (newline == true) msg = msg + "\n"; out.print(msg + c255); out.flush(); } catch (Exception e) { WebSocket.console(e.toString()); } } protected void send(String msg) { try { WebSocket.console(">> " + msg); byte[] message = msg.getBytes(); byte[] newmsg = new byte[message.length + 2]; newmsg[0] = (byte)0x00; for (int i = 1; i <= message.length; i++) { newmsg[i] = message[i - 1]; } newmsg[message.length + 1] = (byte)0xff; // This prints correctly..., apparently... System.out.println(Arrays.toString(newmsg)); OutputStream socketOutputStream = s.getOutputStream(); socketOutputStream.write(newmsg); } catch (Exception e) { WebSocket.console(e.toString()); } } protected void send(String msg, boolean one, boolean two) { try { WebSocket.console(">> " + msg); byte[] message = msg.getBytes(); byte[] newmsg = new byte[message.length+1]; for (int i = 0; i < message.length; i++) { newmsg[i] = message[i]; } newmsg[message.length] = (byte)0xff; // This prints correctly..., apparently... System.out.println(Arrays.toString(newmsg)); OutputStream socketOutputStream = s.getOutputStream(); socketOutputStream.write(newmsg); } catch (Exception e) { e.printStackTrace(); } } } class IRCclient implements Runnable { protected String nick; protected String chan; protected int iAm; boolean started = false; IRCUser irc; IRCclient(int me) { iAm = me; irc = new IRCUser(iAm); } public void run() { WebSocket.console("Connecting to IRC..."); started = true; irc.setNick(nick); irc.setVerbose(false); irc.connectToIRC(chan); } void msg(String input) { irc.sendMessage("#" + chan, input); } } class IRCUser extends PircBot { int iAm; IRCUser(int me) { iAm = me; } public void setNick(String nick) { this.setName(nick); } public void connectToIRC(String chan) { try { this.connect("irc.appliedirc.com"); this.joinChannel("#" + chan); } catch (Exception e) { WebSocket.console(e.toString()); } } public void onMessage(String channel, String sender,String login, String hostname, String message) { // Lets send this message to me WebSocket.clients.get(iAm).send(message); } } Whenever I try to send the message to the browser (via Web Sockets), it complains that it doesn't start with 0x00 (which is a byte). Any ideas? Edit 19/02 - Added the entire code. I know it's real messy and not neat, but I want to get it functioning first. Spend last two days trying to fix.

    Read the article

  • To find the substring in a given text.. C programm..

    - by RBA
    char *substring(char *text, int position, int length) { int i, j=0; char *temp ; for(i=position-1; i<position+length-1; i++) { temp[j++] = text[i]; } temp[j] = '\0'; return temp; } Hi What is the error in the following code.. I am trying to run this on Fedora Machine.. And its giving me a run-time error "Segmentation Fault". What is this error all about.. and why is it giving this error.. Thanks..

    Read the article

  • HttpParsing for hypertext

    - by Nani
    I am in process of getting all hierarchical links from a given link and validating them; This is the code I wrote. But I am not feeling it as efficient. Reasons are: 1.For the non unique links which open same page, code is getting sub-links again and again 2.Is the code getting all links? 3.Is it making valid URLs from the sub-links it derived? 4.May be some other reasons about which I have no idea. Please suggest me how to make this piece of code efficient . Thank you. class Program { public static ArrayList sublink = new ArrayList(); public static ArrayList subtitle = new ArrayList(); public static int ini = 0, len_o, len_n, counter = 0; static void Main(string[] args) { // Address of URL string URL = "http://www.techonthenet.com/"; sublink.Add(URL); l: len_o = sublink.Count; len_o); Console.WriteLine("-------------Level:" + counter++); for (int i = ini; i < len_o; i++) test(sublink[i].ToString()); len_n = sublink.Count; if (len_o < len_n) { ini = len_o; goto l; } Console.ReadKey(); } //method to get the sub-links public static void test(string URL) { try { // Get HTML data WebClient client = new WebClient(); Stream data = client.OpenRead(URL); StreamReader reader = new StreamReader(data); string str = "", htmldata = "", temp; int n1, n2; str = reader.ReadLine(); while (str != null) { htmldata += str; str = reader.ReadLine(); } data.Close(); for (int i = 0; i < htmldata.Length - 5; i++) { if (htmldata.Substring(i, 5) == "href=") { n1 = htmldata.Substring(i + 6, htmldata.Length - (i + 6)).IndexOf("\""); temp = htmldata.Substring(i + 6, n1); if (temp.Length > 4 && temp.Substring(0, 4) != "http") { if(temp.Substring(0,1)!="/") temp=URL.Substring(0,URL.IndexOf(".com/")+5)+temp; else temp = URL.Substring(0, URL.IndexOf(".com/") + 5) + temp.Remove(0,1); } if (temp.Length < 4) temp = URL.Substring(0, URL.IndexOf(".com/") + 5) + temp; sublink.Add(temp); n2 = htmldata.Substring(i + n1 + 1, htmldata.Length - (i + n1 + 1)).IndexOf("<"); subtitle.Add(htmldata.Substring(i + 6 + n1 + 2, n2 - 7)); i += temp.Length + htmldata.Substring(i + 6 + n1 + 2, n2 - 7).Length; } } for (int i = len_n; i < sublink.Count; i++) Console.WriteLine(i + "--> " + sublink[i]); } catch (WebException exp) { Console.WriteLine("URL Could not be Resolved" + URL); Console.WriteLine(exp.Message, "Exception"); } } }

    Read the article

  • How can I sort a document according to a substring in each line on Win7?

    - by Joey Hammer
    How can I sort a text according to hashtag on Windows-7? I have a long text (.txt format) which looks something like this: Blah blah #Test 123123 #Really Blah bluh #Really klfdmngl #Test I would like to conveniently, quickly and automatically be able to sort the text so that it looks like this: Blah blah #Test klfdmngl #Test 123123 #Really Blah bluh #Really I have to do this on a daily basis so I would like to be able to do it in as few steps as possible.

    Read the article

  • Blackberry ListField Text Wrapping - only two lines.

    - by Diego Tori
    Within my ListField, I want to be able to take any given long String, and just be able to wrap the first line within the width of the screen, and just take the remaining string and display it below and ellipsis the rest. Right now, this is what I'm using to detect wrapping within my draw paint call: int totalWidth = 0; int charWidth = 0; int lastIndex = 0; int spaceIndex = 0; int lineIndex = 0; String firstLine = ""; String secondLine = ""; boolean isSecondLine = false; for (int i = 0; i < longString.length(); i++){ charWidth = Font.getDefault().getAdvance(String.valueOf(longString.charAt(i))); //System.out.println("char width: " + charWidth); if(longString.charAt(i) == ' ') spaceIndex = i; if((charWidth + totalWidth) > (this.getWidth()-32)){ //g.drawText(longString.substring(lastIndex, spaceIndex), xpos, y +_padding, DrawStyle.LEFT, w - xpos); lineIndex++; System.out.println("current lines to draw: " + lineIndex); /*if (lineIndex = 2){ int idx = i; System.out.println("first line " + longString.substring(lastIndex, spaceIndex)); System.out.println("second line " + longString.substring(spaceIndex+1, longString.length())); }*/ //firstLine = longString.substring(lastIndex, spaceIndex); firstLine = longString.substring(0, spaceIndex); //System.out.println("first new line: " +firstLine); //isSecondLine=true; //xpos = 0; //y += Font.getDefault().getHeight(); i = spaceIndex + 1; lastIndex = i; System.out.println("Rest of string: " + longString.substring(lastIndex, longString.length())); charWidth = 0; totalWidth = 0; } totalWidth += charWidth; System.out.println("total width: " + totalWidth); //g.drawText(longString.substring(lastIndex, i+1), xpos, y + (_padding*3)+4, DrawStyle.ELLIPSIS, w - xpos); //secondLine = longString.substring(lastIndex, i+1); secondLine = longString.substring(lastIndex, longString.length()); //isSecondLine = true; } Now this does a great job of actually wrapping any given string (assuming the y values were properly offsetted and it only drew the text after the string width exceeded the screen width, as well as the remaining string afterwards), however, every time I try to get the first two lines, it always ends up returning the last two lines of the string if it goes beyond two lines. Is there a better way to do this sort of thing, since I am fresh out of ideas?

    Read the article

  • Phone number mask in a DataView WebPart (DVWP)

    - by PeterBrunone
    This came up today on the [sharepointdiscussions] list.  A user needed to display a read-only field in a phone number format; it's pretty simple, but it may be just what you need.Assuming your list item contains a field called "Phone Number" (with a space), the following XPath will give you a number in the classic US telephone format: <xsl:value-of select="concat('(',substring(@Phone_x0020_Number,1,3),')',substring(@Phone_x0020_Number,4,3),'-',substring(@Phone_x0020_Number,7,4))" /> If you need to mask an input, try this jQuery solution.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 3 4 5 6 7 8 9 10 11 12 13 14  | Next Page >