Search Results

Search found 18803 results on 753 pages for 'link'.

Page 707/753 | < Previous Page | 703 704 705 706 707 708 709 710 711 712 713 714  | Next Page >

  • CSS Hidden DIV Form Submit

    - by Michael
    Using CSS, when a link is clicked it brings up a hidden DIV that contains a form. The user will then enter information and then submit the form. I'd like the hidden DIV to remain visisble, and a 'success message' to be displayed after submission. Then the user will have the option of closing the DIV. I can't get it to work without reloading the page, which causes the DIV to become hidden again. Any ideas? <body> <a href="javascript:showDiv()" style="color: #fff;">Click Me</a> <!--POPUP--> <div id="hideshow" style="visibility:hidden;"> <div id="fade"></div> <div class="popup_block"> <div class="popup"> <a href="javascript:hideDiv()"> <img src="images/icon_close.png" class="cntrl" title="Close" /> </a> <h3>Remove Camper</h3> <form method="post" onsubmit="email.php"> <p><input name="Name" type="text" /></p> <p><input name="Submit" type="submit" value="submit" /></p> </form> <div id="status" style="display:none;">success</div> </div> </div> </div> <!--END POPUP--> <script language=javascript type='text/javascript'> function hideDiv() { if (document.getElementById) { // DOM3 = IE5, NS6 document.getElementById('hideshow').style.visibility = 'hidden'; } else { if (document.layers) { // Netscape 4 document.hideshow.visibility = 'hidden'; } else { // IE 4 document.all.hideshow.style.visibility = 'hidden'; } } } function showDiv() { if (document.getElementById) { // DOM3 = IE5, NS6 document.getElementById('hideshow').style.visibility = 'visible'; } else { if (document.layers) { // Netscape 4 document.hideshow.visibility = 'visible'; } else { // IE 4 document.all.hideshow.style.visibility = 'visible'; } } } </script> </body>

    Read the article

  • Methodology to understanding JQuery plugin & API's developed by third parties

    - by Taoist
    I have a question about third party created JQuery plug ins and API's and the methodology for understanding them. Recently I downloaded the JQuery Masonry/Infinite scroll plug in and I couldn't figure out how to configure it based on the instructions. So I downloaded a fully developed demo, then manually deleted everything that wouldn't break the functionality. The code that was left allowed me to understand the plug in much greater detail than the documentation. I'm now having a similar issue with a plug in called JQuery knob. http://anthonyterrien.com/knob/ If you look at the JQuery Knob readme file it says this is working code: <input type="text" value="75" class="dial"> $(function() { $('.dial') .trigger( 'configure', { "min":10, "max":40, "fgColor":"#FF0000", "skin":"tron", "cursor":true } ); }); But as far as I can tell it isn't at all. The read me also says the Plug in uses Canvas. I am wondering if I am suppose to wrap this code in a canvas context or if this functionality is already part of the plug in. I know this kind of "question" might not fit in here but I'm a bit confused on the assumptions around reading these kinds of documentation and thought I would post the query regardless. Curious to see if this is due to my "newbi" programming experience or if this is something seasoned coders also fight with. Thank you. Edit In response to Tyanna's reply. I modified the code and it still doesn't work. I posted it below. I made sure that I checked the Google Console to insure the basics were taken care of, such as not getting a read-error on the library. <!DOCTYPE html> <meta charset="UTF-8"> <title>knob</title> <link rel="stylesheet" href="http://ajax.googleapis.com/ajax/libs/jqueryui/1.7.2/themes/hot-sneaks/jquery-ui.css" type="text/css" /> <script type="text/javascript" src="https://ajax.googleapis.com/ajax/libs/jquery/1.7.2/jquery.js" charset="utf-8"></script> <script src="https://ajax.googleapis.com/ajax/libs/jqueryui/1.8.21/jquery-ui.min.js"></script> <script src="js/jquery.knob.js"></script> <div id="button1">test </div> <script> $(function() { $("#button1").click(function () { $('.dial').trigger( 'configure', { "min":10, "max":40, "fgColor":"#FF0000", "skin":"tron", "cursor":true } ); }); }); </script>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • List of checkboxes

    - by Andrea Girardi
    Hi all, Happy New Year to all. I'm a newbie in VB.NET and ASP.NET. This is my problem: I retrieve a list of records from DB and, for every row, I need to show 4 checkboxes. I can use a checkboxlist for every rows, but it's not so clear how I can process the results after the submit. I've some object and some operations available for that object. From database I extract a list of object with all operations. For every operation I want to show a check box to enable or disable the operation. The result is something like that: OBJ1 - url - [] [x] [] OBJ2 - url - [] [x] [x] On url I've an href to another page created using the Id retrieved from DB. To create that I used this code: <td class="column-filename"> <strong> <asp:Label runat="server" Text='<%#DataBinder.Eval(Container.DataItem, "GroupName")%>'></asp:Label> </strong> </td> <td align="left"> <span style="vertical-align:middle"> <asp:CheckBoxList runat="server" ID="operations" RepeatDirection="Horizontal" RepeatLayout="Table"> <asp:ListItem Text="View"></asp:ListItem> <asp:ListItem Text="Upload"></asp:ListItem> <asp:ListItem Text="Move"></asp:ListItem> <asp:ListItem Text="Delete"></asp:ListItem> <asp:ListItem Text="Rename"></asp:ListItem> <asp:ListItem Text="Replace"></asp:ListItem> </asp:CheckBoxList> </span> </td> </asp> </asp> my problem is: how can I parse all checkboxes? could you help me or send me a link or any other resources to solve my issue? many thanks! Andrea

    Read the article

  • How to make html image clickable inside a TextView

    - by Gonan
    I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

    Read the article

  • Jquery - Loading a page with .load and selector doesn't execute script?

    - by PirateKitten
    I'm trying to load one page into another using the .load() method. This loaded page contains a script that I want to execute when it has finished loading. I've put together a barebones example to demonstrate: Index.html: <html> <head> <title>Jquery Test</title> <script type="text/javascript" src="script/jquery-1.3.2.min.js"></script> <script type="text/javascript"> $(document).ready(function() { $('#nav a').click(function() { $('#contentHolder').load('content.html #toLoad', '', function() {}); return false; }); }); </script> </head> <body> <div id="nav"> <a href="content.html">Click me!</a> </div> <hr /> <div id="contentHolder"> Content loaded will go here </div> </body> </html> Content.html: <div id="toLoad"> This content is from content.html <div id="contentDiv"> This should fade away. </div> <script type="text/javascript"> $('#contentDiv').fadeOut('slow', function() {} ); </script> </div> When the link is clicked, the content should load and the second paragraph should fade away. However it doesn't execute. If I stick a simple alert("") in the script of content.html it doesn't execute either. However, if I do away with the #toLoad selector in the .load() call, it works fine. I am not sure why this is, as the block is clearly in the scope of the #toLoad div. I don't want to avoid using the selector, as in reality the content.html will be a full HTML page, and I'll only want a select part out of it. Any ideas? If the script from content.html was in the .load() callback, it works fine, however I obviously don't want that logic contained within index.html. I could possibly have the callback use .getScript() to load "content.html.js" afterwards and have the logic in there, that seems to work? I'd prefer to keep the script in content.html, if possible, so that it executes fine when loaded normally too. In fact, I might do this anyway, but I would like to know why the above doesn't work.

    Read the article

  • preload image with jquery

    - by robertdd
    Updated: firs append a empty image and a span with some text hide the loading image, after it's load it's show the image var pathimg = "path/to/image" + "?" + (new Date()).getTime(); $('#somediv').append('<div><span>loading..</span><img id="idofimage" src="" alt="" ></div>') jQuery("#idofimage").hide().attr({"src":pathimg}) .load(function() { jQuery(this).show(); }); old post ok, I spent 2 days trying to preloaded images but no succes! i have this function: jQuery.getlastimage = function(id) { $.getjs(); $.post('operations.php', {'operation':'getli', 'id':id,}, function(lastimg){ $("#upimages" + id).html('<a href="uploads/'+ lastimg +'?'+ (new Date()).getTime() +'"><img class="thumbs" id="' + id + '" alt="' + lastimg + '" src="uploads/' + lastimg +'?'+ (new Date()).getTime() + '" /></a>'); }); }; lastimg is the name of the image while the image loading i want to appear a gif or a text "Loading...". the function will get something like this: <div class="upimage"> <ul class="thumbs" id="upimagesQueue"> **<li id="#upimagesRIFDIB"> <a href="uploads/0001.jpg?1271800088379"> <img src="uploads/0001.jpg?1271800088379" alt="0001.jpg" id="RIFDIB" class="thumbs"> </a> </li>** <li> .... </li> </ul> </div> i tried like this: ... $.post('operations.php', {'operation':'getli', 'id':id,}, function(lastimg){ $("#upimages" + id) .html('<a href="uploads/'+ lastimg +'?'+ (new Date()).getTime() +'"><img class="thumbs" id="' + id + '" alt="' + lastimg + '" src="uploads/' + lastimg +'?'+ (new Date()).getTime() + '" /></a>') .hide() .load(function() { $(this).show(); }); ... but all the <li> will hide and after is loading the image appear, i want the <li> to apear with a gif or a text in it and after the image is loaded the link and the image to apear! How to do this? Anyone have an idea? Thanks!

    Read the article

  • text in textbox shows up as circles instead of regular characters?

    - by BlueMonster
    When i type in either of the textboxes i get little circles appearing instead of text. Why is this happening and how do i stop it? Code is as follows: HTML: <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="MainPage.aspx.cs" Inherits="Foods.MainPage" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <link id="Link1" rel="stylesheet" type="text/css" href="Styles/mainStyle.css"/> </head> <body> <form id="form1" runat="server"> <div class = "userIDTboxDiv"> <div class = "userIDTboxText"> &nbsp;&nbsp;&nbsp; Enter User ID: </div> <asp:TextBox id="userIDBox" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> <div class = "passwordTboxDiv"> <div class = "passwordTboxText"> &nbsp;&nbsp;&nbsp; Enter User Password: </div> <asp:TextBox id="TextBox1" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> </form> </body> CSS: body { text-decoration:none; background: white; } input { margin-left: 0px; margin-top: 7px; } .userIDTboxDiv { padding-top: 20%; padding-left: 45%; width: 15%; height: 30%; } .userIDTboxText { padding-left: 17%; height: auto; width:203px; } .passwordTboxDiv { padding-top: 2%; padding-left: 45%; width: 15%; height: 111px; } .passwordTboxText { padding-left: 10%; height: auto; width:203px; }

    Read the article

  • Issues in Ajax based applications

    - by Sinuhe
    I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

    Read the article

  • C++ DLL creation for C# project - No functions exported

    - by Yeti
    I am working on a project that requires some image processing. The front end of the program is C# (cause the guys thought it is a lot simpler to make the UI in it). However, as the image processing part needs a lot of CPU juice I am making this part in C++. The idea is to link it to the C# project and just call a function from a DLL to make the image processing part and allow to the C# environment to process the data afterwards. Now the only problem is that it seems I am not able to make the DLL. Simply put the compiler refuses to put any function into the DLL that I compile. Because the project requires some development time testing I have created two projects into a C++ solution. One is for the Dll and another console application. The console project holds all the files and I just include the corresponding header into my DLL project file. I thought the compiler should take out the functions that I marked as to be exported and make the DLL from them. Nevertheless this does not happens. Here it is how I defined the function in the header: extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck); extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI, CvScalar &refHSVColorLow, CvScalar &refHSVColorHi ); Followed by the implementation in the cpp file: extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI,&refHSVColorLow, CvScalar &refHSVColorHi ) { \\... return cvPoint((int)( M10/M00) + imgROI.x, (int)( M01/M00 ) + imgROI.y) ;} extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck) { \\ ...}; And my main file for the DLL project looks like: #ifdef _MANAGED #pragma managed(push, off) #endif /// <summary> Include files. </summary> #include "..\ImageProcessingDebug\ImageProcessingTest.h" #include "..\ImageProcessingDebug\ImageProcessing.h" BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { return TRUE; } #ifdef _MANAGED #pragma managed(pop) #endif Needless to say it does not work. A quick look with DLL export viewer 1.36 reveals that no function is inside the library. I don't get it. What I am doing wrong ? As side not I am using the C++ objects (and here it is the C++ DLL part) such as the vector. However, only for internal usage. These will not appear in the headers of either function as you can observe from the previous code snippets. Any ideas? Thx, Bernat

    Read the article

  • Route Angular to New Controller after Login

    - by MizAkita
    I'm kind of stuck on how to route my angular app to a new controller after login. I have a simple app, that uses 'loginservice'... after logging in, it then routes to /home which has a different template from the index.html(login page). I want to use /home as the route that displays the partial views of my flightforms controllers. What is the best way to configure my routes so that after login, /home is the default and the routes are called into that particular templates view. Seems easy but I keep getting the /login page when i click on a link which is suppose to pass the partial view into the default.html template: var app= angular.module('myApp', ['ngRoute']); app.config(['$routeProvider', function($routeProvider) { $routeProvider.when('/login', { templateUrl: 'partials/login.html', controller: 'loginCtrl' }); $routeProvider.when('/home', { templateUrl: 'partials/default.html', controller: 'defaultCtrl' }); }]); flightforms.config(['$routeProvider', function($routeProvider){ //sub pages $routeProvider.when('/home', { templateUrl: 'partials/default.html', controller: 'defaultCtrl' }); $routeProvider.when('/status', { templateUrl: 'partials/subpages/home.html', controller: 'statusCtrl' }); $routeProvider.when('/observer-ao', { templateUrl: 'partials/subpages/aobsrv.html', controller: 'obsvaoCtrl' }); $routeProvider.when('/dispatch', { templateUrl: 'partials/subpages/disp.html', controller: 'dispatchCtrl' }); $routeProvider.when('/fieldmgr', { templateUrl: 'partials/subpages/fieldopmgr.html', controller: 'fieldmgrCtrl' }); $routeProvider.when('/obs-backoffice', { templateUrl: 'partials/subpages/obsbkoff.html', controller: 'obsbkoffCtrl' }); $routeProvider.when('/add-user', { templateUrl: 'partials/subpages/users.html', controller: 'userCtrl' }); $routeProvider.otherwise({ redirectTo: '/status' }); }]); app.run(function($rootScope, $location, loginService) { var routespermission=['/home']; //route that require login $rootScope.$on('$routeChangeStart', function(){ if( routespermission.indexOf($location.path()) !=-1) { var connected=loginService.islogged(); connected.then(function(msg) { if(!msg.data) $location.path('/login'); }); } }); }); and my controllers are simple. Here's a sample of what they look like: var flightformsControllers = angular.module('flightformsController', []); flightforms.controller('fieldmgrCtrl', ['$scope','$http','loginService', function($scope,loginService) { $scope.txt='You are logged in'; $scope.logout=function(){ loginService.logout(); } }]); Any ideas on how to get my partials to display in the /home default.html template would be appreciated.

    Read the article

  • Where can I find sample XHTML5 source codes?

    - by Bytecode Ninja
    Where can I find sample *X*HTML 5 pages? I mainly want to know if it is possible to mix and match XHTML 5 with other XML languages just like XHTML 1 or not. For example is something like this valid in XHTML 5? <!DOCTYPE html PUBLIC "WHAT SHOULD BE HERE?" "WHAT SHOULD BE HERE?"> <html xmlns="WHAT SHOULD BE HERE?" xmlns:ui="http://java.sun.com/jsf/facelets"> <head> <title><ui:insert name="title">Default title</ui:insert></title> <link rel="stylesheet" type="text/css" href="./css/main.css"/> </head> <body> <div id="header"> <ui:insert name="header"> <ui:include src="header.xhtml"/> </ui:insert> </div> <div id="left"> <ui:insert name="navigation" > <ui:include src="navigation.xhtml"/> </ui:insert> </div> <div id="center"> <br /> <span class="titleText"> <ui:insert name="title" /> </span> <hr /> <ui:insert name="content"> <div> <ui:include src="content.xhtml"/> </div> </ui:insert> </div> <div id="right"> <ui:insert name="news"> <ui:include src="news.xhtml"/> </ui:insert> </div> <div id="footer"> <ui:insert name="footer"> <ui:include src="footer.xhtml"/> </ui:insert> </div> </body> </html> Thanks in advance.

    Read the article

  • CodeIgniter Third party class not loading

    - by Jatin Soni
    I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

    Read the article

  • How can I progrommatically change the target framework from 4.0 to 3.5 of a project/solution?

    - by scott
    Edit 3: After more googling it looks like you can't have the TargetFrameworkMoniker property in a .NET 3.5 application. So I guess I should be asking a different question. How do I change the Target framework from 4.0 to 3.5? Unfortunately, I can only find stuff on how to go the other way. or better yet how do i progrommatically set the target framework version of a project to something other than 4.0? Original question: I just switched to vs2010. I have an application that uses .net 3.5. It loads plugins which are generated by a different app. The plugins are using .net 4 and there for cannot be loaded. I'm using EnvDTE.Project to create a project and set the settings. I can't find what setting needs to be set for this. Edit 1: I'm generating code for about 50 solutions. When I made the switch from vs2005 to vs2010 the projects in those solutions are defaulting to .NET Framework 4.0. So I need to set the .NET Framework to 3.5 when I am generating the code for these solutions. Edit 2: After a lot of googling I found this. so then I tried this: loProp = vsGetProperty("TargetFrameworkMoniker"); vsSetValue(loProp, ".NETFramework,Version=v3.5"); the definitions for those two methods are below. as far as I can tell they do the same this as project.Properties.Item("TargetFrameworkMoniker").Value = ".NETFramework,Version=v4.0,Profile=Client"; I start getting an Property Unavailable Exception later in the code. When I remove the new lines everything works except the projects target framework is still 4.0. The code generators target framework is 3.5 so I can't use the FrameworkName class like shown in the second example in that link. here is vsGetProperty protected Property vsGetProperty(string aProperty) { bool lbDone = false; int liCount = 0; Property loProp; while (!lbDone && liCount < pMaxRetries) { try { loProp = pProject.Properties.Item(aProperty); lbDone = true; return loProp; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } return null; } and vsSetValue protected void vsSetValue(Property aProperty, string aValue) { bool lbDone = false; int liCount = 0; while (!lbDone && liCount < pMaxRetries) { try { aProperty.Value = aValue; lbDone = true; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } }

    Read the article

  • Making Visual C++ DLL from C++ class

    - by prosseek
    I have the following C++ code to make dll (Visual Studio 2010). class Shape { public: Shape() { nshapes++; } virtual ~Shape() { nshapes--; }; double x, y; void move(double dx, double dy); virtual double area(void) = 0; virtual double perimeter(void) = 0; static int nshapes; }; class __declspec(dllexport) Circle : public Shape { private: double radius; public: Circle(double r) : radius(r) { }; virtual double area(void); virtual double perimeter(void); }; class __declspec(dllexport) Square : public Shape { private: double width; public: Square(double w) : width(w) { }; virtual double area(void); virtual double perimeter(void); }; I have the __declspec, class __declspec(dllexport) Circle I could build a dll with the following command CL.exe /c example.cxx link.exe /OUT:"example.dll" /DLL example.obj When I tried to use the library, Square* square; square->area() I got the error messages. What's wrong or missing? example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall ... Square::area(void)" (?area@Square@@UAENXZ) ADDED Following wengseng's answer, I modified the header file, and for DLL C++ code, I added #define XYZLIBRARY_EXPORT However, I still got errors. example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Circle::Circle(double)" (__imp_??0Circle@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Square::Square(double)" (__imp_??0Square@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::area(void)" (?area@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::perimeter(void)" (?perimeter@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::area(void)" (?area@Circle@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::perimeter(void)" (?perimeter@Circle@@UAENXZ)

    Read the article

  • Dragging Custom Node in JavaFX

    - by Karussell
    I cannot get it working although I am very close to an acceptable solution. I can drag the Dock if it is only a rectangle. But if I add a node (e.g. an image) to this dock I am not able to get a working solution. Do you have a code snippet, link or other advices for me? Here is my code: public class Dock extends CustomNode { // initialize this with an 64x64 image of your choice // via ImageView { image: Image {..}} public var content: Node[]; public var width = 64; public var height = 64; public var xOffset: Number = 0; public var yOffset: Number = 0; var imgX: Number = 0; var imgY: Number = 0; var distX: Number; var distY: Number; public var rasterX = function (n: Number): Number { var MAX = 4 * 64; if (n < 0) { return 0 } else if (n > MAX) { return MAX } else return n } public var rasterY = rasterX; override protected function create(): Node { Group { // if we place the translate here then the whole dock will flicker //translateX: bind imgX; //translateY: bind imgY; content: [ Rectangle { // ... and here 'content' won't be dragged translateX: bind imgX; translateY: bind imgY; height: bind height width: bind width fill: Color.LIGHTGRAY strokeWidth: 4 stroke: Color.BLACK }, content] onMousePressed: function (e: MouseEvent): Void { xOffset = e.x; yOffset = e.y; // Calculate the distance of the mouse point from the image // top-left corner which will always come out as positive value distX = e.x - imgX; distY = e.y - imgY; } onMouseDragged: function (e: MouseEvent): Void { // Find out the new image postion by subtracting the distance // part from the mouse point. imgX = rasterX(e.x - distX); imgY = rasterY(e.y - distY); } } }

    Read the article

  • Jquery-UI tabs : Double loading of the default tab with

    - by Stephane
    I use jqueryui-tabs to display a tabbed UI. here is how my markup looks in a MasterPage: <div id="channel-tabs" class="ui-tabs"> <ul class="ui-tabs-nav"> <li><%=Html.ActionLink("Blogs", "Index", "Blog", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, new{ title="Blog Results" }) %></li> <li><%=Html.ActionLink("Forums", "Index", "Forums", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> <li><%=Html.ActionLink("Twitter", "Index", "Twitter", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> </ul> <div id="Blog_Results"> <asp:ContentPlaceHolder ID="ResultPlaceHolder" runat="server"> </asp:ContentPlaceHolder> </div> If the content is loaded via ajax, I return a partial view with the content of the tab. If the content is loaded directly, I load a page that include the content in the ContentPlaceHolder. somewhat like this : <asp:Content ID="Content2" ContentPlaceHolderID="BlogPlaceHolder" runat="server"> <%=Html.Partial("Partial",Model) %> </asp:Content> //same goes for the other tabs. With this in place, if I access the url "/Forums" It loads the forum content in the Blog tab first, trigger the ajax load of the Blog tab and replace the content with the blog content. I tried putting a different placeholder for each tab, but that didn't fix everything either, since when loading "/Forums" it will sure load the forum tab, but the Blog tab will show up first. Furthermore, when using separate placeholders, If I load the "/Blogs" url, It will first load the content statically in the Blog contentplaceholder and then trigger an ajax call to load it a second time and replace it. If I just link the tab to the hashtag, then when loading the forum tabs, I won't get the blog content... How would you achieve the expected behaviour? I feel like I might have a deeper probelm in the organization of my views. Is putting the tabs in the masterpage the way to go? Maybe I should just hijax the links manually and not rely on jquery-ui tabs to do the work for me. I cannot load all tabs by default and display them using the hash tags, I need an ajax loading because it is a search process that can be long. So to sum up : /Forum should load the forum tab, and let the other tabs be loaded with an ajax call when clicking on it. /Twitter should load the twitter tab and let the other tabs.... the same goes for /Blogs and any tabs I would add later.

    Read the article

  • Patterns for dynamic CMS components (event driven?)

    - by CitrusTree
    Sorry my title is not great, this is my first real punt at moving 100% to OO as I've been procedural for more years than I can remember. I'm finding it hard to understand if what I'm trying to do is possible. Depending on people's thoughts on the 2 following points, I'll go down that route. The CMS I'm putting together is quote small, however focuses very much on different types of content. I could easily use Drupal which I'm very comfortable with, but I want to give myself a really good reasons to move myself into design patterns / OO-PHP 1) I have created a base 'content' class which I wish to be able to extend to handle different types of content. The base class, for example, handles HTML content, and extensions might handle XML or PDF output instead. On the other hand, at some point I may wish to extend the base class for a given project completely. I.e. if class 'content-v2' extended class 'content' for that site, any calls to that class should actually call 'content-v2' instead. Is that possible? If the code instantiates an object of type 'content' - I actually want it to instantiate one of type 'content-v2'... I can see how to do it using inheritance, but that appears to involve referring to the class explicitly, I can't see how to link the class I want it to use instead dynamically. 2) Secondly, the way I'm building this at the moment is horrible, I'm not happy with it. It feels very linear indeed - i.e. get session details get content build navigation theme page publish. To do this all the objects are called 1-by-1 which is all very static. I'd like it to be more dynamic so that I can add to it at a later date (very closely related to first question). Is there a way that instead of my orchestrator class calling all the other classes 1-by-1, then building the whole thing up at the end, that instead each of the other classes can 'listen' for specific events, then at the applicable point jump in and do their but? That way the orchestrator class would not need to know what other classes were required, and call them 1-by-1. Sorry if I've got this all twisted in my head. I'm trying to build this so it's really flexible.

    Read the article

  • Moving from Windows to Ubuntu.

    - by djzmo
    Hello there, I used to program in Windows with Microsoft Visual C++ and I need to make some of my portable programs (written in portable C++) to be cross-platform, or at least I can release a working version of my program for both Linux and Windows. I am total newcomer in Linux application development (and rarely use the OS itself). So, today, I installed Ubuntu 10.04 LTS (through Wubi) and equipped Code::Blocks with the g++ compiler as my main weapon. Then I compiled my very first Hello World linux program, and I confused about the output program. I can run my program through the "Build and Run" menu option in Code::Blocks, but when I tried to launch the compiled application externally through a File Browser (in /media/MyNTFSPartition/MyProject/bin/Release; yes, I saved it in my NTFS partition), the program didn't show up. Why? I ran out of idea. I need to change my Windows and Microsoft Visual Studio mindset to Linux and Code::Blocks mindset. So I came up with these questions: How can I execute my compiled linux programs externally (outside IDE)? In Windows, I simply run the generated executable (.exe) file How can I distribute my linux application? In Windows, I simply distribute the executable files with the corresponding DLL files (if any) What is the equivalent of LIBs (static library) and DLLs (dynamic library) in linux and how to use them? In Windows/Visual Studio, I simply add the required libraries to the Additional Dependencies in the Project Settings, and my program will automatically link with the required static library(-ies)/DLLs. Is it possible to use the "binary form" of a C++ library (if provided) so that I wouldn't need to recompile the entire library source code? In Windows, yes. Sometimes precompiled *.lib files are provided. If I want to create a wxWidgets application in Linux, which package should I pick for Ubuntu? wxGTK or wxX11? Can I run wxGTK program under X11? In Windows, I use wxMSW, Of course. If question no. 4 is answered possible, are precompiled wxX11/wxGTK library exists out there? Haven't tried deep google search. In Windows, there is a project called "wxPack" (http://wxpack.sourceforge.net/) that saves a lot of my time. Sorry for asking many questions, but I am really confused on these linux development fundamentals. Any kind of help would be appreciated =) Thanks.

    Read the article

  • Configuring a html page from an original demo page

    - by Wold
    I forked into rainyday.js through github, an awesome javascript program made by maroslaw at this link: https://github.com/maroslaw/rainyday.js. Basically I tried taking his demo page and my own photo city.jpg and changed the applicable fields so that I could run it on my own site, but only the picture loads and the script itself doesn't start to run. I'm pretty new to html and javascript so I'm probably omitting something very simple, but here is the script for the demo code: <script src="rainyday.js"></script> <script> function getURLParameter(name) { return decodeURIComponent((new RegExp('[?|&]' + name + '=' + '([^&;]+?)(&|#|;|$)').exec(location.search)||[,''])[1].replace(/\+/g, '%20'))||null; } function demo() { var image = document.getElementById('background'); image.onload = function () { var engine = null; var preset = getURLParameter('preset') || '1'; if (preset === '1') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.rain([ [1, 2, 8000] ]); engine.rain([ [3, 3, 0.88], [5, 5, 0.9], [6, 2, 1] ], 100); } else if (preset === '2') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.VARIABLE_GRAVITY_ANGLE = Math.PI / 8; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 50); } else if (preset === '3') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.trail = engine.TRAIL_SMUDGE; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 100); } }; image.crossOrigin = 'anonymous'; if (getURLParameter('imgur')) { image.src = 'http://i.imgur.com/' + getURLParameter('imgur') + '.jpg'; } else if (getURLParameter('img')) { image.src = getURLParameter('img') + '.jpg'; } var youtube = getURLParameter('youtube'); if (youtube) { var div = document.getElementById('sound'); var player = document.createElement('iframe'); player.frameborder = '0'; player.height = '1'; player.width = '1'; player.src = 'https://youtube.com/embed/' + youtube + '?autoplay=1&controls=0&showinfo=0&autohide=1&loop=1'; div.appendChild(player); } } </script> This is where I am naming my background and specifying the photo from within the directory. <body onload="demo();"> <div id="sound" style="z-index: -1;"></div> <div id="parent"> <img id='background' alt="background" src="city.jpg" /> </div> </body> The actual code for the whole entire rainyday.js script can be found here: https://github.com/maroslaw/rainyday.js/blob/master/rainyday.js Thanks in advance for any help and advice!

    Read the article

  • How to use a LinkButton inside gridview to delete selected username in the code-behind file?

    - by jenifer
    I have a "UserDetail" table in my "JobPost.mdf". I have a "Gridview1" showing the column from "UserDetail" table,which has a primary key "UserName". This "UserName" is originally saved using Membership class function. Now I add a "Delete" linkbutton to the GridView1. This "Delete" is not autogenerate button,I dragged inside the column itemtemplate from ToolBox. The GridView1's columns now become "Delete_LinkButton"+"UserName"(within the UserDetail table)+"City"(within the UserDetail table)+"IsAdmin"(within the UserDetail table) What I need is that by clicking this "delete_linkButton",it will ONLY delete the entire User Entity on the same row (link by the corresponding "UserName") from the "UserDetail" table,as well as delete all information from the AspNetDB.mdf (User,Membership,UserInRole,etc). I would like to fireup a user confirm,but not mandatory. At least I am trying to make it functional in the correct way. for example: Command UserName City IsAdmin delete ken Los Angles TRUE delete jim Toronto FALSE When I click "delete" on the first row, I need all the record about "ken" inside the "UserDetail" table to be removed. Meanwhile, all the record about "ken" in the AspNetDB.mdf will be gone, including UserinRole table. I am new to asp.net, so I don't know how to pass the commandargument of the "Delete_LinkButton" to the code-behind file LinkButton1_Click(object sender, EventArgs e), because I need one extra parameter "UserName". My partial code is listed below: <asp:TemplateField> <ItemTemplate> <asp:LinkButton ID="Delete_LinkButton" runat="server" onclick="LinkButton1_Click1" CommandArgument='<%# Eval("UserName","{0}") %>'>LinkButton</asp:LinkButton> </ItemTemplate> </asp:TemplateField> protected void Delete_LinkButton_Click(object sender, EventArgs e) { ((LinkButton) GridView1.FindControl("Delete_LinkButton")).Attributes.Add("onclick", "'return confirm('Are you sure you want to delete {0} '" + UserName); Membership.DeleteUser(UserName); JobPostDataContext db = new JobPostDataContext(); var query = from u in db.UserDetails where u.UserName == UserName select u; for (var Item in query) { db.UserDetails.DeleteOnSubmit(Item); } db.SubmitChanges(); } Please do help! Thanks in advance.

    Read the article

  • User has many computers, computers have many attributes in different tables, best way to JOIN?

    - by krismeld
    I have a table for users: USERS: ID | NAME | ---------------- 1 | JOHN | 2 | STEVE | a table for computers: COMPUTERS: ID | USER_ID | ------------------ 13 | 1 | 14 | 1 | a table for processors: PROCESSORS: ID | NAME | --------------------------- 27 | PROCESSOR TYPE 1 | 28 | PROCESSOR TYPE 2 | and a table for harddrives: HARDDRIVES: ID | NAME | ---------------------------| 35 | HARDDRIVE TYPE 25 | 36 | HARDDRIVE TYPE 90 | Each computer can have many attributes from the different attributes tables (processors, harddrives etc), so I have intersection tables like this, to link the attributes to the computers: COMPUTER_PROCESSORS: C_ID | P_ID | --------------| 13 | 27 | 13 | 28 | 14 | 27 | COMPUTER_HARDDRIVES: C_ID | H_ID | --------------| 13 | 35 | So user JOHN, with id 1 owns computer 13 and 14. Computer 13 has processor 27 and 28, and computer 13 has harddrive 35. Computer 14 has processor 27 and no harddrive. Given a user's id, I would like to retrieve a list of that user's computers with each computers attributes. I have figured out a query that gives me a somewhat of a result: SELECT computers.id, processors.id AS p_id, processors.name AS p_name, harddrives.id AS h_id, harddrives.name AS h_name, FROM computers JOIN computer_processors ON (computer_processors.c_id = computers.id) JOIN processors ON (processors.id = computer_processors.p_id) JOIN computer_harddrives ON (computer_harddrives.c_id = computers.id) JOIN harddrives ON (harddrives.id = computer_harddrives.h_id) WHERE computers.user_id = 1 Result: ID | P_ID | P_NAME | H_ID | H_NAME | ----------------------------------------------------------- 13 | 27 | PROCESSOR TYPE 1 | 35 | HARDDRIVE TYPE 25 | 13 | 28 | PROCESSOR TYPE 2 | 35 | HARDDRIVE TYPE 25 | But this has several problems... Computer 14 doesnt show up, because it has no harddrive. Can I somehow make an OUTER JOIN to make sure that all computers show up, even if there a some attributes they don't have? Computer 13 shows up twice, with the same harddrive listet for both. When more attributes are added to a computer (like 3 blocks of ram), the number of rows returned for that computer gets pretty big, and it makes it had to sort the result out in application code. Can I somehow make a query, that groups the two returned rows together? Or a query that returns NULL in the h_name column in the second row, so that all values returned are unique? EDIT: What I would like to return is something like this: ID | P_ID | P_NAME | H_ID | H_NAME | ----------------------------------------------------------- 13 | 27 | PROCESSOR TYPE 1 | 35 | HARDDRIVE TYPE 25 | 13 | 28 | PROCESSOR TYPE 2 | 35 | NULL | 14 | 27 | PROCESSOR TYPE 1 | NULL | NULL | Or whatever result that make it easy to turn it into an array like this [13] => [P_NAME] => [0] => PROCESSOR TYPE 1 [1] => PROCESSOR TYPE 2 [H_NAME] => [0] => HARDDRIVE TYPE 25 [14] => [P_NAME] => [0] => PROCESSOR TYPE 1

    Read the article

  • Robust way to save/load objects with dependencies?

    - by mrteacup
    I'm writing an Android game in Java and I need a robust way to save and load application state quickly. The question seems to apply to most OO languages. To understand what I need to save: I'm using a Strategy pattern to control my game entities. The idea is I have a very general Entity class which e.g. stores the location of a bullet/player/enemy and I then attach a Behaviour class that tells the entity how to act: class Entiy { float x; float y; Behavior b; } abstract class Behavior { void update(Entity e); {} // Move about at a constant speed class MoveBehavior extends Behavior { float speed; void update ... } // Chase after another entity class ChaseBehavior extends Behavior { Entity target; void update ... } // Perform two behaviours in sequence class CombineBehavior extends Behavior { Behaviour a, b; void update ... } Essentially, Entity objects are easy to save but Behaviour objects can have a semi-complex graph of dependencies between other Entity objects and other Behaviour objects. I also have cases where a Behaviour object is shared between entities. I'm willing to change my design to make saving/loading state easier, but the above design works really well for structuring the game. Anyway, the options I've considered are: Use Java serialization. This is meant to be really slow in Android (I'll profile it sometime). I'm worried about robustness when changes are made between versions however. Use something like JSON or XML. I'm not sure how I would cope with storing the dependencies between objects however. Would I have to give each object a unique ID and then use these IDs on loading to link the right objects together? I thought I could e.g. change the ChaseBehaviour to store a ID to an entity, instead of a reference, that would be used to look up the Entity before performing the behaviour. I'd rather avoid having to write lots of loading/saving code myself as I find it really easy to make mistakes (e.g. forgetting to save something, reading things out in the wrong order). Can anyone give me any tips on good formats to save to or class designs that make saving state easier?

    Read the article

  • fancybox image sometimes renders outside box

    - by Colleen
    I have the following django template: <script type="text/javascript" src="{{ STATIC_URL }}js/ jquery.fancybox-1.3.4.pack.js"></script> <link rel="stylesheet" href="{{ STATIC_URL }}css/ jquery.fancybox-1.3.4.css" type="text/css" media="screen" /> {% include "submission-form.html" with section="photos" %} <div class="commentables"> {% load thumbnail %} {% for story in objects %} <div class="image {% if forloop.counter|add:"-1"| divisibleby:picsinrow %}left{% else %}{% if forloop.counter| divisibleby:picsinrow %}right{% else %}middle{% endif %}{% endif %}"> {% if story.image %} {% thumbnail story.image size crop="center" as full_im %} <a rel="gallery" href="{% url post slug=story.slug %}"> <img class="preview" {% if story.title %} alt="{{ story.title }}" {% endif %} src="{{ full_im.url }}" full- image="{% if story.image_url %}{{ story.image_url }}{% else %} {{ story.image.url }}{% endif %}"> </a> {% endthumbnail %} {% else %} {% if story.image_url %} {% thumbnail story.image_url size crop="center" as full_im %} <a rel="gallery" href="{% url post slug=story.slug %}"> <img class="preview" {% if story.title %} alt="{{ story.title }}" {% endif %} src="{{ full_im.url }}" full- image="{{ story.image_url }}"> </a> {% endthumbnail %} {% endif %} {% endif %} </div> {% endfor %} {% if rowid != "last" %} <br style="clear: both" /> {% endif %} {% if not no_more_button %} <p style="text-align: right;" class="more-results"><a href="{% url images school_slug tag_slug %}">more...</a></p> {% endif %} </div> <script> $(document).ready(function(){ function changeattr(e){ var f = $(e.clone()); $(f.children()[0]).attr('src', $(f.children() [0]).attr("full-image")); $(f.children()[0]).attr('height', '500px'); return f[0].outerHTML; } $('.image a').each(function(idx, elem) { var e = $(elem); e.fancybox({ title: $(e.children()[0]).attr('alt'), content: changeattr(e) }); }); }); </script> and I'm occasionally getting weird display errors where the box will either not render anything at all (so it will show up as just a thin white bar, basically) or it will render only about 30 px wide, and position itself halfway down the page. In both cases, if I inspect element, I can see the "shadow" of the full picture, at the right size, with the right url. Image source doesnt' seem to make a difference, I'm getting no errors, and this is happening in both chrome and firefox. Does anyone have any ideas?

    Read the article

  • Wierdness debugging Visual Studio C++ 2008

    - by Jeff Dege
    I have a legacy C++ app, that in its most incarnation we've been building with makefiles and VS2003's command-line tool. I'm trying to get it to build using VS2008 and MsBuild. The build is working OK, but I'm getting errors where I'd never seen errors, before, and stepping through in VS2008's debugger only confuses me. The app links a number of static libraries, which fall into two categories: those that are part of the same application suite, and those that are shared between a number of application suites. Originally, I had a .csproj file for each static library, and two .sln files, one for the application suite (including the suite-specific libraries) and one for the non-suite-specific shared libraries. The shared libraries were included in the link, their projects were not included in the application suite .sln. The application instantiates an object from a class that is defined in one of the shared libraries. The class has a member object of a class that wraps a linked list. The constructor of the linked list class sets its "head" pointer to null. When I run the app, and try to add an element to the linked list, I get an error - the head pointer contains the value 0xCCCCCCCC. So I step through with the debugger. And see weirdness. When the current line in the debugger is in a source file belonging to the static library, the head pointer contains 0x00000000. When I step into the constructor, I can see the pointer being set to that value, and when I'm stepped into any other method of the class, I can see that the head pointer still contains 0x00000000. But when I step out into methods that are defined in the application suite .sln, it contains 0xCCCCCCCC. It's not like it's being overwritten. It changes back and forth depending upon which source file I am currently debugging. So I included the shared library's project in the application suite .sln, and now I see the head pointer containing 0xCCCCCCCC all the time. It looks like the constructor of the linked list class is not being called. So now, I'm entirely confused. Anyone have any ideas?

    Read the article

< Previous Page | 703 704 705 706 707 708 709 710 711 712 713 714  | Next Page >