Search Results

Search found 2033 results on 82 pages for 'absolute'.

Page 71/82 | < Previous Page | 67 68 69 70 71 72 73 74 75 76 77 78  | Next Page >

  • Keep div:hover open when changing nested select box

    - by JMC Creative
    This is an IE-only problem. .toolTip becomes visible when it's parent element is :hovered over. Inside of .toolTip is a select box. When the user opens the select box to make a selection, the parent element is being "un-hovered", if you will. To put it another way, when I try to select something from the dropdown, the whole thing hides itself again. I'm sure it has something to do with the way IE interprets the stylesheet, but I don't know what or where. Here is some relevant code (edited for clarity): #toolBar .toolTip { position: absolute; display:none; background: #fff; line-height: 1em; font-size: .8em; min-width: 300px; bottom: 47px; left: -5px; padding: 0 ; } #toolBar div:hover .toolTip { display:block; } and <div id="toolBar"> <div class="socialIcon"> <a href=""><img src="/im/social/nytimes.png" alt="NY Times Bestsellers" /></a> <span class="toolTip"> <h1>NY Times Bestsellers Lists</h1> <div id="nyTimesBestsellers"> <?php include('/ny-times-bestseller-feed.php') ?> </div> <p><img src="/im/social/nytimes.png" alt="NY Times Bestseller Lists" /> Change List <select id="nyTimesChangeCurrentList" name="nyTimesChangeCurrentList"> <option value="hardcover-fiction">Hardcover Fiction</option> <option value="hardcover-nonfiction">Hardcover Nonfiction</option> <option value="hardcover-advice">Hardcover Advice</option> </select> </p> </span> </div> </div>

    Read the article

  • Windows Phone period task, function not executing

    - by Special K.
    I'm trying to execute a code (to parse an XML to be more precisely, and after that I'll toast message the user with some new info's), but the class function AccDetailsDownloaded is not executed (is simply skipped), also the memory usage is ~2mb out of 6, here is my code: if (task is PeriodicTask) { getData(); } else { getData(); } // If debugging is enabled, launch the agent again in one minute. #if DEBUG_AGENT ScheduledActionService.LaunchForTest(task.Name, TimeSpan.FromSeconds(60)); #endif // Call NotifyComplete to let the system know the agent is done working. NotifyComplete(); } public void getData() { var settings = IsolatedStorageSettings.ApplicationSettings; string url = "http://example.com/example.xml"; if (!System.Net.NetworkInformation.NetworkInterface.GetIsNetworkAvailable()) { MessageBox.Show("No network connection available!"); return; } // start loading XML-data WebClient downloader = new WebClient(); Uri uri = new Uri(url, UriKind.Absolute); downloader.DownloadStringCompleted += new DownloadStringCompletedEventHandler(AccDetailsDownloaded); downloader.DownloadStringAsync(uri); string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } void AccDetailsDownloaded(object sender, DownloadStringCompletedEventArgs e) { if (e.Result == null || e.Error != null) { MessageBox.Show("There was an error downloading the XML-file!"); } else { string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } } Thank you.

    Read the article

  • Jquery hover with animation

    - by Brian
    anyone know how to stop a .hover happening again before the mouseout animation has finished? I have the following code which has 4 anchors. Once hovered over the anchor the related anchor slides in using animation. My problem is you hover out and in quickly, before the square has been set back to 0px it increases the slide distance. <body class="home"> <div id="container"> <a class="page-link homet" id="anim-1"></a> <a class="page-link about" id="anim-2"></a> <a class="page-link portfolio" id="anim-3"></a> <a class="page-link contacts" id="anim-4"></a> <div id="header"> <div id="logo"> </div> <ul id="navigation"> <li><a id="1"></a></li> <li><a id="2"></a></li> <li><a id="3"></a></li> <li><a id="4"></a></li> </ul> </div> <div id="main"> <div id="left-content"> </div> <div id="main-content"> </div> </div> </div> </body> </html> Jquery var cc = { displayAnim : function () { actionLink = $("#container #header #navigation li a"); movePosition = "0"; $("#container a.page-link").css({ position:"absolute", right: 0}); $(actionLink).hoverIntent( function() { circleToReveal = $(this).attr('id'); switch (circleToReveal) { case "1" : movePostion = "386" break; case "2" : moveposition = "514" break; case "3" : movePosition = "643" break; case "4" : movePosition = "400" break; default : movePosition = "772" }; /* console.log(movePosition); */ $("#container #anim-" +circleToReveal+ "").stop().animate({"right": "+="+ movePosition +"px"}, "slow"); }, function() { $("#container #anim-" +circleToReveal+ "").stop().animate({"right": "-="+ movePosition +"px"}, "slow"); } ); } }; $(window).load (function () { $("body").addClass('js'); $("a.pagelink").hide(); cc.displayAnim(); });

    Read the article

  • Hierarchy inheritance

    - by reito
    I had faced the problem. In my C++ hierarchy tree I have two branches for entities of difference nature, but same behavior - same interface. I created such hierarchy trees (first in image below). And now I want to work with Item or Base classes independetly of their nature (first or second). Then I create one abstract branch for this use. My mind build (second in image below). But it not working. Working scheme seems (third in image below). It's bad logic, I think... Do anybody have some ideas about such hierarchy inheritance? How make it more logical? More simple for understanding? Image Sorry for my english - russian internet didn't help:) Update: You ask me to be more explicit, and I will be. In my project (plugins for Adobe Framemaker) I need to work with dialogs and GUI controls. In some places I working with WinAPI controls, and some other places with FDK (internal Framemaker) controls, but I want to work throw same interface. I can't use one base class and inherite others from it, because all needed controls - is a hierarchy tree (not one class). So I have one hierarchy tree for WinAPI controls, one for FDK and one abstract tree to use anyone control. For example, there is an Edit control (WinEdit and FdkEdit realization), a Button control (WinButton and FdkButton realization) and base entity - Control (WinControl and FdkControl realization). For now I can link my classes in realization trees (Win and Fdk) with inheritence between each of them (WinControl is base class for WinButton and WinEdit; FdkControl is base class for FdkButton and FdkEdit). And I can link to abstract classes (Control is base class for WinControl and FdkControl; Edit is base class for WinEdit and FdkEdit; Button is base class for WinButton and FdkButton). But I can't link my abstract tree - compiler swears. In fact I have two hierarchy trees, that I want to inherite from another one. Update: I have done this quest! :) I used the virtual inheritence and get such scheme (http://img12.imageshack.us/img12/7782/99614779.png). Abstract tree has only absolute abstract methods. All inheritence in abstract tree are virtual. Link from realization tree to abstract are virtual. On image shown only one realization tree for simplicity. Thanks for help!

    Read the article

  • opacity in ie using absolutely positioned divs not working

    - by camomileCase
    I've been banging my head against the wall for a few hours how trying to sort this out. I'm trying to position one div on top of another for the purpose of fading one in on top of the other. The divs will have an image and some other html in them. I cannot get opacity to work in ie8. I've simplified my html as much as possible: <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <html> <head> <style> * { margin: 0; padding: 0; } .carousel-container { position: relative; } .carousel-overlay { position: absolute; } #carousel-container-a { opacity: 1; -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=100)"; filter: progid:DXImageTransform.Microsoft.Alpha(Opacity=100); } #carousel-container-b { opacity: 0; -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=0)"; filter: progid:DXImageTransform.Microsoft.Alpha(Opacity=0); } h1 { font-size: 100px; } </style> </head> <body> <div id="carousel-container-a" class="carousel-container"> <div class="carousel-overlay" style="left: 10px; top: 10px;"> <h1 style="color: black;">Showcase</h1> </div> <!-- other elements removed for simplicity --> </div> <div id="carousel-container-b" class="carousel-container"> <div class="carousel-overlay" style="left: 20px; top: 20px;"> <h1 style="color: red;">Welcome</h1> </div> <!-- other elements removed for simplicity --> </div> </body> </html> Why doesn't the opacity work? How can I make it work?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Jscrollpane causese text to disappear on internet explorer

    - by Crippletoe
    Hello all, in my current site, i am using the new Jscrollpane in order to generate a scrollbar for a menu (not my descision but the designer's descision so i dont wanna get into how 90's that all looks like..). my menu is based on a <UL> the <li> elements inside it have the attribute "text-align: right;". my problem that on IE alone the menu text doesnt show when i apply the ScrollPane to the menu. when i delete the ScrollPane function from my code- the menu re-appears. i checked the page with "microsoft Expression" DOM inspector in order to examine how IE sees my code and i can see the <li> elements there, only the text inside them is missing. when i disable the "text-align: right;" for the <li> in my CSS, the text shows again. i suspect this has something to do with the jScrollPane's containing which is relatively aligned but i cannot be sure.. can anyone suggest some fix for this problem? a link to a page where you can see the problem is here: http://kaplanoland.com/index.php?option=com_content&view=article&id=2&Itemid=12 the problematic menu is on the right side of the page. on every browser but IE you can see the text. only on IE not. my CSS code for that menu (not including the jScrollPane CSS) is here: div#menu2{ position: absolute; top: 123px; right: 36px; width: 330px; height: 150px; } div#menu2_scroll{ /*the actual scroller*/ height: 150px; } div#menu2 div#menu2_contain{ } div#menu2 li{ text-align: right; } div#menu2 li span{ line-height: 18px; } div#menu2 a:link, div#menu2 a:visited{ color: #808285 ; font-family: Arial, Helvetica, sans-serif ; font-size: 12px ; } div#menu2 a:hover, div#menu2 li#current a{ color: #000000 ; font-family: Arial, Helvetica, sans-serif ; font-size: 12px ; } div#menu2 span.separator{ display: block; padding-top: 12px; padding-bottom: 40px; font-family: Arial, Helvetica, sans-serif; font-size: 12px; font-weight: bold; color: #000000; } div#menu2 span.separator span { padding-top: 12px; border-top-width: 1px; border-top-style: solid; border-top-color: #808285; } thank you all so much.

    Read the article

  • web design PSD to html -> more direct ways?

    - by Assembler
    At work I see one colleague designing a site in Photoshop/Fireworks, I see another taking this data, slicing it up and using Dreamweaver to rebuild the same from scratch. It seems like too much mucking around! I know that Photoshop can output a tables based HTML, and Fireworks will create divs with absolute positioning; neither appear to be very helpful. Admittedly, I haven't tried much of (DW/FW) (CS4/CS3) since becoming a programmer, so I don't know if new versions are addressing this work flow issue, but are we still double handling things? Can we attach some sort of layout metadata (this is a rollover button, this will be a SWF, this will be text, this logo will hide "xyz" <h1> text etc) to slices to aid in layout generation? are there some secret tools which assist in this conversion process? Or are we still restricted to doing things by hand? The frustration continues when said hand built page needs to be reworked again to fit Smarty Templates/Wordpress/generic CMS. I acknowledge that designers need to be free of systems to be able to do whatever, but most conventional sites have: a header with navigation a sidebar with more links the main content part maybe another sidebar a footer Given the similarity of a lot of components, shouldn't there be a more systematic approach to going from sliced designs to functional HTML? Or am I over-simplifying things? -edit- Mmmmm.... I suppose I will accept an answer, but they weren't really what I was looking for. It just seems like designing the DOM is a bit of holy grail ("It's only a model!"), and maybe with all the "groovy" things you can do with HTML and Javascript, it would be mighty hard work, but with a set of constraints (that 960 stuff looks interesting), some well designed reset style sheets and a bit of... fairy dust? we should be able to improve the work flow. Photoshop's tables by themselves are pretty much useless, I agree, but surely we can take this data, and then select a group of cells and say "right, this is a text div, overflow:auto" or "these cells are an image block, style it with the same height/width as the selected area". Admittedly here at work there are other elephants in the room that need to make their formal introductions to management, but some parts of the designpage workflow seem... uneducated at best.

    Read the article

  • Define Javascript slider hit/rollover area

    - by Rob
    Hey, Im having an issue defining the hit area for a javascript sliding element. See example: http://www.warface.co.uk/clients/warface.co.uk/ Please slide over the grey box on the right side to reveal the button, although this works I would only like for the slider to only be triggered by rolling over the red block. CSS .slidingtwitter { /* -- This is the hit area -- */ background: #ccc; width:255px; height:55px; overflow: hidden; top:50%; right: 0px; /* -- This is the sliding start point -- */ position: fixed; font-family: Gotham, Sans-Serif; z-index: 50; } .slidingtwitter.right { right:0px; } .slidingtwitter .caption { /* -- This is the sliding area -- */ background: #fff; position: absolute; width:260px; height:55px; right: -205px; /* -- This is the sliding start point -- */ } .slidingtwitter a { color: #484848; font-size: 20px; text-transform: uppercase; } .slidingtwitter a:hover { color: black; } .slidingtwitter .smaller { font-size: 12px; font-family: Gotham Medium; } .twitterblock { background: #f35555 url("styles/images/button_twitter.png") no-repeat 14px 15px ; width:35px; height:35px; padding:10px; float:left; display:block; } .slidingtwitter .followme { background: url("styles/images/button_arrowheadthin.jpg")no-repeat right 0; height:35px; display:block; float:left; line-height:14px; width:140px; margin:10px 0px 0px 14px; padding-top:6px; padding-right: 40px; } JS $('.slidingtwitter').hover(function(){ $(".slide", this).stop().animate({right:'0px'},{queue:false,duration:400}); //Position on rollover },function() { $(".slide", this).stop().animate({right:'-205px'},{queue:false,duration:400}); //Position on rollout }); Any suggestions would be much appreciated.

    Read the article

  • Feedback on Optimizing C# NET Code Block

    - by Brett Powell
    I just spent quite a few hours reading up on TCP servers and my desired protocol I was trying to implement, and finally got everything working great. I noticed the code looks like absolute bollocks (is the the correct usage? Im not a brit) and would like some feedback on optimizing it, mostly for reuse and readability. The packet formats are always int, int, int, string, string. try { BinaryReader reader = new BinaryReader(clientStream); int packetsize = reader.ReadInt32(); int requestid = reader.ReadInt32(); int serverdata = reader.ReadInt32(); Console.WriteLine("Packet Size: {0} RequestID: {1} ServerData: {2}", packetsize, requestid, serverdata); List<byte> str = new List<byte>(); byte nextByte = reader.ReadByte(); while (nextByte != 0) { str.Add(nextByte); nextByte = reader.ReadByte(); } // Password Sent to be Authenticated string string1 = Encoding.UTF8.GetString(str.ToArray()); str.Clear(); nextByte = reader.ReadByte(); while (nextByte != 0) { str.Add(nextByte); nextByte = reader.ReadByte(); } // NULL string string string2 = Encoding.UTF8.GetString(str.ToArray()); Console.WriteLine("String1: {0} String2: {1}", string1, string2); // Reply to Authentication Request MemoryStream stream = new MemoryStream(); BinaryWriter writer = new BinaryWriter(stream); writer.Write((int)(1)); // Packet Size writer.Write((int)(requestid)); // Mirror RequestID if Authenticated, -1 if Failed byte[] buffer = stream.ToArray(); clientStream.Write(buffer, 0, buffer.Length); clientStream.Flush(); } I am going to be dealing with other packet types as well that are formatted the same (int/int/int/str/str), but different values. I could probably create a packet class, but this is a bit outside my scope of knowledge for how to apply it to this scenario. If it makes any difference, this is the Protocol I am implementing. http://developer.valvesoftware.com/wiki/Source_RCON_Protocol

    Read the article

  • javascript div movement not working

    - by William
    For some reason I can't move this div at all. Can anyone help me out with why this won't work? <!DOCTYPE html> <html lang="en"> <head> <title>Move Div Test</title> <meta charset="utf-8" /> <link href="/bms/style.css" rel="stylesheet" /> <style> body { text-align: center; background-color: #ffffff;} #box { position: absolute; left: 610px; top: 80px; height: 50px; width: 50px; background-color: #ff0000;} </style> <script type="text/javascript"> document.onkeydown=function(event){keyDown(event)}; document.onkeyup=function(event){keyUp(event)}; var box = document.getElementById('box'); var speed = 5; var keys = new Array(256); var i = 0; for (i = 0;i <= 256; i++){ keys[i] = false; } function keyDown(event){ if(!event){ //for IE event = window.event; } keys[event.keyCode] = true; } function keyUp(event){ if(!event){ //for IE event = window.event; } keys[event.keyCode] = false; } function update(){ if(keys[37]) box.style.left = parseInt(box.style.left) - speed + "px"; if(keys[39]) box.style.left = parseInt(box.style.left) + speed + "px"; if(keys[38]) box.style.top = parseInt(box.style.top) - speed + "px"; if(keys[40]) box.style.top = parseInt(box.style.top) + speed + "px"; } setInterval('update();', 1000/60); </script> </head> <body> <div id="box">blah</div> </body> </html>

    Read the article

  • Setting background-image with javascript

    - by Mattoe3k
    In chrome, safari, and opera setting the background image to an absolute reference such as: "/images/image.png" changes it to "http://sitepath/images/image.png". It does not do this in firefox. Is there any way to avoid this behavior, or is it written into the browser's javascript engine? Using jquery to set the background-image also does this problem. The problem is that I am posting the HTML to a php script that needs the urls in this specific format. I know that setting the image path relative fixes this, but I can't do that. The only other alternative would be to use a regexp. to convert the urls. Thanks. Test this in firefox, and chrome / webkit browser: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Untitled Document</title> </head> <body> <div style="height:400px;width:400px;background-image:url(/images/images/logo.gif);"> </div> <br /> <br /> <div id="test" style="height:400px;width:400px;"> </div> <script type="text/javascript" src="/javascripts/jquery.js"></script> <script type="text/javascript"> $(document).ready(function(){ $("#test").css('background-image',"url(/images/images/logo.gif)"); alert(document.getElementById('test').style.backgroundImage); }); </script> </body> </html>

    Read the article

  • CSS Ease-in-out to full screen

    - by Aditya Singh
    I have a black background div of a size which contains an image. <div id="Banner"> <img onclick="expand();" src="hola.jpg"> </div> #Banner { position:relative; height:50px; width:50px; margin:0 auto; background-color:#000000; -webkit-transition: all 0.5s ease-in-out 0.5s; -moz-transition: all 0.5s ease-in-out 0.5s; -o-transition: all 0.5s ease-in-out 0.5s; transition: all 0.5s ease-in-out 0.5s; } <script type="text/javascript"> function expand(){ document.getElementById('Banner').style['height'] = '250'; document.getElementById('Banner').style['width'] = '250'; } </script> So when the user clicks on the image, the div transitions to 250, 250. My problem is that, i want it to to transition to full screen. The following javascript function does expand to fullscreen but the transition effect doesn't come. I need to do it from a javascript code without jquery. function expand(){ document.getElementById('Banner').style['position'] = 'absolute'; document.getElementById('Banner').style['height'] = '100%'; document.getElementById('Banner').style['width'] = '100%'; document.getElementById('Banner').style['top'] = '0'; document.getElementById('Banner').style['left'] = '0'; } Please advice. Update : Solution Roger below has provided with an alternative solution. This takes care if the document has already been scrolled and is another place. Will expand the div to full browser screen. sz=getSize(); //function returns screen width and height in pixels currentWidth=200; currentHeight=200; scalex=sz.W/currentWidth; scaley=sz.H/currentHeight; transx=0-((expandingDiv.offsetLeft+(currentWidth/2))-(sz.W/2))+document.body.scrollLeft; transy=0-((expandingDiv.offsetTop+(cuttentHeight/2))-(sz.H/2))+document.body.scrollTop; transx = transx.toString(); transy = transy.toString(); document.getElementById("Banner").style['-webkit-transform'] = 'translate('+transx+'px,'+transy+'px) scale('+scalex+','+scaley+')';

    Read the article

  • What alternatives do I have for source control and does GIT does that?

    - by RubberDuck
    I work as a freelancer programmer for some clients and also create apps for myself. When I work for myself, obviously I work alone. I generally don't work in a linear way. My big problems today are: I have a lot of apps that use the same classes I have developed; In the past, I put all these common classes on a directory outside all projects and included them on my apps using absolute paths, but this method sucks because by accident (if you forget) you may change a path or the disk and all projects are broken. Then I decided to copy those classes to my projects every time. Because the majority of these classes do not change frequently, I am relatively ok, but when they change, I am in hell; When I change one of these classes I have to propagate the changes to all other apps using copies of them. I have also tried to create frameworks but thanks to Apple, I cannot create frameworks for iOS and have to create libraries and bundles and create a nightmare of paths from one to the other and to the project to make that sh!t works. So, I am done with frameworks/libraries on Xcode until Xcode is a decent IDE. So, I see I need something better to manage my source code. What I need is this (I never used GIT on Xcode. I have read Apple docs but I still have these points): does git locally on Xcode allows me to deal with assets or just code? Can I have the equivalent of a "framework" (code + assets) managed by git locally? Can an entire xcodeproj be managed as a unity? I mean, Suppose I have a xcodeproj created and want GIT to manage it. How do I enable git on a project that was created without it and start designating files for management. (I have enabled git on Xcode's preferences, but all source control menu is grayed out). Is git the best option? Do I have another? Remember that my main condition is that the files should stay on the local computer. Please save me (I am a bit dramatic today). Thanks.

    Read the article

  • Why jQuery selector can't work but getElementById works in this scenario?

    - by Stallman
    Here is the HTML: <html> <head> <script type="text/javascript" src="jquery-1.7.2.min.js"></script> <script type="text/javascript" charset="utf-8" src="jquery-1.7.2.js"></script> <script type="text/javascript" src="access.js"></script> </head> <body> <button id="trigger"></button> <img id= "testElement" style= "position: absolute; border-color: white; top:340px; left:615px;" width="34px" height= "34px" /> </body> </html> And the access.js file is: $(document).ready( function(){ $('#trigger').click(function(){ $('#testElement').src="success.png"; //THIS WON'T WORK. document.getElementById('testElement').src= "success.png"; //BUT THIS WORKS. }); }); I know that if I use $, the return object is a jQuery object. It's not the same as getElementById. But why the jQuery selector can't work here? I need the jQuery object to make more operations like "append/style"... Thanks. UPDATE Too much correct answers appear at almost the same time... Please give more explanations to let me decide who I should give the credit, thanks!!! Sorry for my poor understanding of your correct answer... I just want more detail. Are all the attribute nodes(src/width/height...) not the property of jQuery object? So does the jQuery selector only select DOM Element Node like ? Thank you! 3. List item

    Read the article

  • localStorage not working in IE9 and Firefox

    - by maha
    I am working with localStorage. My code is perfectly working in Chrome, but not in IE9 and Firefox. Here is the code: document.addEventListener("DOMContentLoaded", restoreContents, false); document.getElementsByTagName("body")[0].onclick=function(){saveContents('myList','contentMain', event, this);}; function amIclicked(e, eleObject) { alert("amIClicked"); e = e || event; var target = e.target || e.srcElement; alert("target = " + target.id); if(target.id=='pageBody' || target.id=='Save') return true; else return false; } function saveContents(e, d, eveObj, eleObject) { //alert("saveContents"); if (amIclicked(eveObj, eleObject)) { var cacheValue = document.getElementById(e).innerHTML; var cacheKey = "key_" + selectedKey; var storage = window.localStorage; //alert ("cacheKey = " + cacheKey + " ,cacheValue = " + cacheValue); if(typeof(Storage)!=="undifined"){ localStorage.setItem("cacheKey","cacheValue"); } //alert ("Saved!!"); var dd = document.getElementById(d); //document.getElementById("contentMain").style.display == "none"; dd.style.display = "none"; } } function restoreContents(e,k) { //alert("test"); if(k.length < 1) { return; } var mySavedList = localStorage["key_" + k]; if (mySavedList != undefined) { document.getElementById(e).innerHTML = mySavedList; } } <a onclick="ShowContent('contentMain','myList','Sample_1'); return true;" href="#" >Sample 1</a><br/><br/> <a onclick="ShowContent('contentMain','myList','Sample_2'); return true;" href="#" >Sample 2</a><br/><br/> <div style="display:none;display:none;position:absolute;border-style: solid;background-color: white;padding: 5px;"id="contentMain"> <ol id="myList" contenteditable="true"> <li>Enter Content here</li> </ol> <!--<input id="editToggleButton" type="button" value="Edit"/>--> </div> When I debugging in Iexplore Iam getting the error as SCRIPT5007: Unable to get value of the property 'length': object is null or undefined sample_1.html, line 157 character 3 Thanks

    Read the article

  • How do I center this CSS?

    - by sarthaksss
    Here is the CSS - #slider ul, #slider li, #slider2 ul, #slider2 li{ margin:0; padding:0; list-style:none; } #slider2{margin-top:1em;} #slider li, #slider2 li{ /* define width and height of list item (slide) entire slider area will adjust according to the parameters provided here */ width:500px; height:250px; overflow:hidden; } #prevBtn, #nextBtn, #slider1next, #slider1prev{ display:block; width:30px; height:77px; position:absolute; left:-30px; top:71px; z-index:1000; } #nextBtn, #slider1next{ left:696px; } #prevBtn a, #nextBtn a, #slider1next a, #slider1prev a{ display:block; position:relative; width:30px; height:77px; background:url(../images/btn_prev.gif) no-repeat 0 0; } #nextBtn a, #slider1next a{ background:url(../images/btn_next.gif) no-repeat 0 0; } /* numeric controls */ #slider img{ width:500px; height:300px; } ol#controls{ margin:1em 0; padding:0; height:28px; } ol#controls li{ margin:0 10px 0 0; padding:0; float:left; list-style:none; height:28px; line-height:28px; } ol#controls li a{ float:left; height:28px; line-height:28px; border:1px solid #ccc; background:#b32d45; color:white; padding:0 10px; text-decoration:none; } ol#controls li.current a{ background:#5DC9E1; color:#fff; } ol#controls li a:focus, #prevBtn a:focus, #nextBtn a:focus{outline:none;} I want to center the #slider HTML <div id="slider"> <ul> <li>IMAGE</li> <li>IMAGE2</li> </ul> </div>

    Read the article

  • Get content in iframe to use as much space as it needs

    - by Mark
    I'm trying to write a simple JavaScript based modal dialog. The JavaScript function takes the content, puts it in a new iframe and adds the iframe to the page. Works great so far, the only problem is that the content of the dialog (e.g. a table) gets wrapped, although plenty of space is available on the page. I'd like the content of the dialog, a table in my case, to use as much space as it needs, without wrapping any lines. I tried lots of combinations of setting width/style.width on the iframe and the table. Nothing did the trick. Here the code to show the iframe dialog: function SimpleDialog() { this.domElement = document.createElement('iframe'); this.domElement.setAttribute('style', 'border: 1px solid red; z-index: 201; position: absolute; top: 0px; left: 0px;'); this.showWithContent = function(content) { document.getElementsByTagName('body')[0].appendChild(this.domElement); this.domElement.contentDocument.body.appendChild(content); var contentBody = this.domElement.contentDocument.body; contentBody.style.padding = '0px'; contentBody.style.margin = '0px'; // Set the iframe size to the size of content. // However, content got wrapped already. this.domElement.style.height = content.offsetHeight + 'px'; this.domElement.style.width = content.offsetWidth + 'px'; this._centerOnScreen(); }; this._centerOnScreen = function() { this.domElement.style.left = window.pageXOffset + (window.innerWidth / 2) - (this.domElement.offsetWidth / 2) + 'px'; this.domElement.style.top = window.pageYOffset + (window.innerHeight / 2) - (this.domElement.offsetHeight / 2) + 'px'; }; } Here the test code: var table = document.createElement('table'); table.setAttribute('style', 'border: 1px solid black; width: 100%;'); table.innerHTML = "<tr><td style='font-size:40px;'>Hello world in big letters</td></tr><tr><td>second row</td></tr>"; var dialog = new SimpleDialog(); dialog.showWithContent(table); The table shows up nicely centered on the page, but the words in the first cell are wrapped to two lines. How do I get the table to use as much space as it needs (without using white-space: nowrap ;) Thanks in advance for any suggestions! -Mark

    Read the article

  • CSS- removing horizontal space in list menu using display inline property

    - by Kayote
    Hi All, Im new to CSS and have a set target of learning & publishing my website in CSS by the end of the month. My question: Im trying to build a CSS horizontal menu with hover drop downs, however, when I use the 'display: inline' property with li (list) items, I get horizontal spaces between the li (list) items in the bar. How do I remove this space? Here is the html: <div id="tabas_menu"> <ul> <li id="tabBut0" class="tabBut">Overview</li> <li id="tabBut1" class="tabBut">Collar</li> <li id="tabBut2" class="tabBut">Sleeves</li> <li id="tabBut3" class="tabBut">Body</li> </ul> </div> And here is the CSS: #tabas_menu { position: absolute; background: rgb(123,345,567); top: 110px; left: 200px; } ul#tabas_menu { padding: 0; margin: 0; } .tabBut { display: inline; white-space: list-style: none; background: -webkit-gradient(linear, 0% 0%, 0% 100%, from(rgba(255,142,190,1)),to(rgba(188,22,93,1))); background: -moz-linear-gradient(top, rgba(255,142,190,1), rgba(188,22,93,1)); font-family: helvetica, calibri, sans-serif; font-size: 16px; font-weight: bold; line-height: 20px; text-shadow: 1px 1px 1px rgba(99,99,99,0.5); -moz-border-radius: 0.3em; -moz-box-shadow: 0px 0px 2px rgba(0,0,0,0.5); -webkit-border-radius: 0.3em; -webkit-box-shadow: 0px 0px 2px rgba(0,0,0,0.5); padding: 6px 18px; border: 1px solid rgba(0,0,0,0.4); margin: 0; } I can get the space removed using the 'float: left/right' property but its bugging me as to why I cannot achieve the same effect by just using the display property.

    Read the article

  • What's causing this background-image to display "incorrectly" in Opera and Firefox?

    - by Sukasa
    I know this is something I'm probably doing wrong, so please don't incinerate me for the thread title. I'm trying to put together a small personal website using HTML 5/CSS3. I've checked with the w3c validator and the site and CSS file fully conform according to the validator (However the validator has a warning attached that it might not be perfect). I'm not sure how to explain it without a picture, so here's a comparison of Chrome/Opera/Firefox: So, you can sorta see how in Chrome the background image is in one non-repeating piece, whereas in Opera/Firefox the image has, oddly, been broken up and placed slightly differently. I'm confident this is due to an error on my part, but I've had no luck at all figuring out why the image is being mangled in Opera and Firefox. Here's the CSS that's relevant to this issue: /* Content Pane */ .content { position: absolute; left: 220px; width: 800px; top: 80px; min-height: 550px; background-color: rgba(8,12,42,0.85); } /* Headers */ .content hgroup { background: url("Header_Flat.png") no-repeat left top; min-height: 38px; padding-left: 28px; text-shadow: 0 0 8px #FFA9FF; color: Black; text-decoration: none; } .content hgroup h1 { display: block; } .content hgroup h3 { display: inline; position: relative; top: -12px; left: 20px; text-shadow: 0 0 6px #AFF9FF; } .content hgroup h4 { display: inline; position: relative; top: -12px; left: 20px; font-size: xx-small; text-shadow: 0 0 6px #AFF9FF; } And the HTML: <hgroup> <h1>New Site!</h1> <h3>Now with Bloom!</h3> <h4> - Posted Tuesday, May 11th 2010</h4> </hgroup> Can anyone see what I'm doing wrong?

    Read the article

  • Div not filling width of floated container (css expert needed

    - by Rayden
    I know there are many variations of this question posted, but none I've found quite provide an answer that works for this case. I basically have two left floated divs. Inside those two divs are div headers and tabled content. I want the Div headers (Hour/Minute) to stretch to the width of the tabled content, but they only do this in FF and Chrome, not IE7. IE7 is my works official browser so the one I need it to work with the most. Here is the CSS: #ui-timepicker-div { padding:0.2em; } #ui-timepicker-hours { float:left; } #ui-timepicker-minutes { margin:0 0 0 0.2em; float:left; } .ui-timepicker .ui-timepicker-header { padding:0.2em 0; } .ui-timepicker .ui-timepicker-title { line-height:1.8em; text-align:center; } .ui-timepicker table { margin:0.15em 0 0 0; font-size:.9em; border-collapse:collapse; } .ui-timepicker td { padding:1px; width:2.2em; } .ui-timepicker th, .ui-timepicker td { border:0; } .ui-timepicker td a { display:block; padding:0.2em 0.3em 0.2em 0.5em; text-align:right; text-decoration:none; } Here is the HTML (did not include tabled content): <div style="position: absolute; top: 252.667px; left: 648px; z-index: 1; display: none;" class="ui-timepicker ui-widget ui-widget-content ui-helper-clearfix ui-corner-all" id="ui-timepicker-div"> <div id="ui-timepicker-hours"> <div class="ui-timepicker-header ui-widget-header ui-helper-clearfix ui-corner-all"> <div class="ui-timepicker-title">Hour</div> </div> <table class="ui-timepicker"> </table> </div> <div id="ui-timepicker-minutes"> <div class="ui-timepicker-header ui-widget-header ui-helper-clearfix ui-corner-all"> <div class="ui-timepicker-title">Minutes</div> </div> <table class="ui-timepicker"> </table> </div> </div>

    Read the article

  • How do I create a class in Javascript?

    - by William
    This is what I got so far, and it's not working at all :( <!DOCTYPE html> <html lang="en"> <head> <title>Class Test</title> <meta charset="utf-8" /> <style> body { text-align: center; background-color: #ffffff;} #box { position: absolute; left: 610px; top: 80px; height: 50px; width: 50px; background-color: #ff0000; color: #000000;} </style> <script type="text/javascript"> document.onkeydown=function(event){keyDown(event)}; document.onkeyup=function(event){keyUp(event)}; var box = 0; function Player () { var speed = 5; var x = 50; var y = 50; } function update() { box.style.left = this.x + "px"; box.style.top = this.y + "px"; box.innerHTML = "<h6 style=\"margin: 0px 0px 0px 0px; padding: 0px 0px 0px 0px;\">X: "+ this.x + "<br /> Y: " + this.y + "</h6>"; } var player = new Player(); var keys = new Array(256); var i = 0; for (i = 0;i <= 256; i++){ keys[i] = false; } function keyDown(event){ keys[event.keyCode] = true; } function keyUp(event){ keys[event.keyCode] = false; } function update(){ if(keys[37]) player.x -= player.speed; if(keys[39]) player.x += player.speed; player.update(); } setInterval(update, 1000/60); </script> </head> <body> <div id="box" ></div> <script type="text/javascript"> box = document.getElementById('box'); box.innerHTML = "<h6 style=\"margin: 0px 0px 0px 0px; padding: 0px 0px 0px 0px;\">X: "+ player.x + "<br /> Y: " + player.y + "</h6>"; </script> </body> </html>

    Read the article

  • video player for HTML 5 page not loading

    - by philippe
    I'm using VideoJS to as my video player for a project I've been working on. Basically I have a div, and I wanted to have the video player within that div, however when I load the page nothing happens, and the video is never played. In fact, the video is never loaded nor shown in the page. I basically copied the example from VideoJS' page. Any thoughts? <div class="video-js-box"> <!-- Using the Video for Everybody Embed Code http://camendesign.com/code/video_for_everybody --> <div style="position: absolute; top: 50px; left: 600px; display:none"> <video id="example_video_1" class="video-js vjs-default-skin" controls preload="auto" width="640" height="264" poster="http://video-js.zencoder.com/oceans-clip.png" data-setup='{"example_option":true}'> <source src="http://video-js.zencoder.com/oceans-clip.mp4" type='video/mp4'></source> <source src="http://video-js.zencoder.com/oceans-clip.webm" type='video/webm'>></source> <source src="http://video-js.zencoder.com/oceans-clip.ogv" type='video/ogg'></source> </video> <!-- Download links provided for devices that can't play video in the browser. --> <p class="vjs-no-video"><strong>Download Video:</strong> <a href="http://video-js.zencoder.com/oceans-clip.mp4">MP4</a>, <a href="http://video-js.zencoder.com/oceans-clip.webm">WebM</a>, <a href="http://video-js.zencoder.com/oceans-clip.ogv">Ogg</a><br> <!-- Support VideoJS by keeping this link. --> <a href="http://videojs.com">HTML5 Video Player</a> by VideoJS </p> </div> <div style="clear:both;"></div> </div><!--main-->

    Read the article

  • jQuery doesn't work in <head>?!

    - by Hanz
    This code is supposed to make a slideshow out of stacked list-elements (I commented out the CSS so I can see what's going on) by fading out the topmost elements until only the first one is visible, then fade in the topmost element and the rest and start anew. If I put the script below my content inside the <body> and throw out the $(function() { it works perfectly fine, but in the <head> nothing happens. I wrote this yesterday and today I still can't see the mistake, so I'm posting it here. <!DOCTYPE html> <html> <head> <title></title> <style type="text/css"> ul { position: relative; } ul li { /*position: absolute; left: 0; top: 0;*/ } </style> <script src="jquery-1.5.1.min.js" type="text/javascript"></script> <script type="text/javascript"> $(function() { var i = 0; var count = $('ul li').size(); function fade() { if (i < count-1) { $('ul li:nth-child('+(count-i)+')').fadeOut(300); i++; } else { $('ul li:nth-child('+count+')').fadeIn(300, function(){$('ul li').show();}); i = 0; } } $('button').click(function() { setInterval('fade()', 1000); }); }); </script> </head> <body> <button>Slideshow GO!</button> <ul id="slider"> <li><img src="1.jpg" /></li> <li><img src="2.jpg" /></li> <li><img src="3.jpg" /></li> <li><img src="4.jpg" /></li> </ul> </body> </html> Thanks

    Read the article

  • CSS / HTML - Image will not show up

    - by weka
    Ugh, ok. I've been up all night working this thing and now an image won't show. It's so darn annoying. Trying to get this .png image to show up on a simple PHP webpage. I just wanna go to sleep X_X CSS: <style> .achievement { position:relative; width:500px; background:#B5B5B5; float:left; padding:10px; margin-bottom:10px; } .icon { float:left; width:32px; height:32px; background: url("images/trophy.php") no-repeat center; padding:05px; border:4px solid #4D4D4D; } .ptsgained { position:absolute; top:0; right:0; background:#79E310; color:#fff; font-family:Tahoma; font-weight:bold; font-size:12px; padding:5px; } .achievement h1 { color:#454545; font-size:12pt; font-family:Georgia; font-weight:none; margin:0;padding:0; } .achievement p { margin:0;padding:0; font-size:12px; font-family:Tahoma; color:#1C1C1C; } .text { margin-left:10px; float:left; } </style> HTML: <div class="achievement"> <span class="ptsgained">+10</span> <div class="icon"></div> <div class="text"><h1>All Around Submitter</h1> <p>Submit and have approved content in all 6 areas.</p> </div> </div> What am I doing wrong, guys? :\

    Read the article

< Previous Page | 67 68 69 70 71 72 73 74 75 76 77 78  | Next Page >