Search Results

Search found 19863 results on 795 pages for 'python subprocess module'.

Page 71/795 | < Previous Page | 67 68 69 70 71 72 73 74 75 76 77 78  | Next Page >

  • how to go back to first if statement if no choices are valid - python

    - by wondergoat77
    how can i have python move to the top of an if statement if nothing is satisfied correctly i have a basic if/else statement like this: print "pick a number, 1 or 2" a = int(raw_input("> ") if a == 1: print "this" if a == 2: print "that" else: print "you have made an invalid choice, try again." what i want is to prompt the user to make another choice for 'a' this if statement without them having to restart the entire program, but am very new to python and am having trouble finding the answer online anywhere.

    Read the article

  • How to parse json data in Python?

    - by backcross
    Please help me to parse this json in python. { "IT" : [ { "firstName" : "ajay", "lastName" : "stha", "age" : 24 }, { "firstName" : "Michiel", "lastName" : "Og", "age" : 35 } ], "sales" : [ { "firstName" : "Guru", "lastName" : "red", "age" : 27 }, { "firstName" : "Jim", "lastName" : "Galley", "age" : 34 } ] } How to parse this json in Python?Please help me

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how to send some data to the Thread module on python and google-map-engine

    - by zjm1126
    from google.appengine.ext import db class Log(db.Model): content = db.StringProperty(multiline=True) class MyThread(threading.Thread): def run(self,request): #logs_query = Log.all().order('-date') #logs = logs_query.fetch(3) log=Log() log.content=request.POST.get('content',None) log.put() def Log(request): thr = MyThread() thr.start(request) return HttpResponse('') error is : Exception in thread Thread-1: Traceback (most recent call last): File "D:\Python25\lib\threading.py", line 486, in __bootstrap_inner self.run() File "D:\zjm_code\helloworld\views.py", line 33, in run log.content=request.POST.get('content',None) NameError: global name 'request' is not defined

    Read the article

  • Python and displaying HTML

    - by Tyler Seymour
    I've gotten pretty comfortable with Python and now I'm looking to make a rudimentary web application. I was somewhat scared of Django and the other Python frameworks so I went caveman on it and decided to generate the HTML myself using another Python script. Maybe this is how you do it anyways - but I'm just figuring this stuff out. I'm really looking for a tip-off on, well, what to do next. My Python script PRINTS the HTML (is this even correct? I need it to be on a webpage!), but now what? Thanks for your continued support during my learning process. One day I will post answers! -Tyler Here's my code: from SearchPhone import SearchPhone phones = ["Iphone 3", "Iphone 4", "Iphone 5","Galaxy s3", "Galaxy s2", "LG Lucid", "LG Esteem", "HTC One S", "Droid 4", "Droid RAZR MAXX", "HTC EVO", "Galaxy Nexus", "LG Optimus 2", "LG Ignite", "Galaxy Note", "HTC Amaze", "HTC Rezound", "HTC Vivid", "HTC Rhyme", "Motorola Photon", "Motorola Milestone", "myTouch slide", "HTC Status", "Droid 3", "HTC Evo 3d", "HTC Wildfire", "LG Optimus 3d", "HTC ThunderBolt", "Incredible 2", "Kyocera Echo", "Galaxy S 4g", "HTC Inspire", "LG Optimus 2x", "Samsung Gem", "HTC Evo Shift", "Nexus S", "LG Axis", "Droid 2", "G2", "Droid x", "Droid Incredible" ] print """<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>table of phones</title> </head> <body> </body> </html> """ #table print '<table width="100%" border="1">' for x in phones: y = SearchPhone(x) print "\t<tr>" print "\t\t<td>" + str(y[0]) + "</td>" print "\t\t<td>" + str(y[1]) + "</td>" print "\t\t<td>" + str(y[2]) + "</td>" print "\t\t<td>" + str(y[3]) + "</td>" print "\t\t<td>" + str(y[4]) + "</td>" print "\t</tr>" print "</table>

    Read the article

  • Java's equivalent to bisect in python

    - by systemsfault
    Hello all, Is there a java equivalent to python's bisect library? With python's bisect you can do array bisection with directions. For instance bisect.bisect_left does: Locate the proper insertion point for item in list to maintain sorted order. The parameters lo and hi may be used to specify a subset of the list which should be considered; by default the entire list is used.

    Read the article

  • listing network shares with python

    - by Gearoid Murphy
    Hello, if I explicitly attempt to list the contents of a shared directory on a remote host using python on a windows machine, the operation succeeds, for example, the following snippet works fine: os.listdir("\\\\remotehost\\share") However, if I attempt to list the network drives/directories available on the remote host, python fails, an example of which is shown in the following code snippet: os.listdir("\\\\remotehost") Is anyone aware of why this doesn't work?, any help/workaround is appreciated.

    Read the article

  • Paste Excel clip to body of an email through Python

    - by Twinkle
    I am using win32com.client in Python to send an email. However I want the body of the email to be a table (HTML- formatted table), I can do it in an Excel first and then copy and paste (but how?), or directly edit the corresponding Pandas data frame. newMail.body = my_table which is a Pandas data frame didn't work. So I'm wondering if there is smarter ways for example, to combine Excel with Outlook apps within Python? Cheers,

    Read the article

  • Executing Multiple Lines in Python

    - by metashockwave
    When Python is first installed, the default setting executes users' code input line-by-line. But sometimes I need to write programs that executes multiple lines at once. Is there a setting in Python where I can change the code execution to one block at once? Thanks if (n/2) * 2 == n:; print 'Even'; else: print 'Odd' SyntaxError: invalid syntax When I tried to run the above code, I got an invalid syntax error on ELSE

    Read the article

  • POSTing a form using Python and Curl

    - by morpheous
    I am relatively new (as in a few days) to Python - I am looking for an example that would show me how to post a form to a website (say www.example.com). I already know how to use Curl. Infact, I have written C+++ code that does exactly the same thing (i.e. POST a form using Curl), but I would like some starting point (a few lines from which I can build on), which will show me how to do this using Python.

    Read the article

  • Does python have a session variable concept???

    - by gizgok
    I have a datetime.date variable in python.I need to pass it to a function do operations according to the date given and then increment the date for the next set of operations.The problem is I have to do the operations in diff pages and hence I need the date as a variable which can go from page to page. Can we do this in python.......

    Read the article

  • Php and python regexp difference?

    - by Ajel
    I need to parse a string 'Open URN: 100000 LA: ' and get 100000 from it. on python regexp (?<=Open URN: )[0-9]+(?= LA:) works fine but in php it gives following error: preg_match(): Unknown modifier '[' I need it working php, so please help me to solve this problem and tell about difference in python and php regexps.

    Read the article

  • Python: saving and loading a class definition

    - by Peterstone
    Hi! I am interested in saving and load objects using the pickle module as you can read in a question I asked before: Python: Errors saving and loading objects with pickle module Someone commment: 1, In an other way: the error is raise because pickle wanted to load an instance of the class Fruits and search for the class definition where it was defined, but it didn't find it so it raise the error Now I want to save and load a class definition in order to solve the problem I describe in the question mentioned before. Thank you so much!

    Read the article

  • Python required variable style

    - by Adam Nelson
    What is the best style for a Python method that requires the keyword argument 'required_arg': def test_method(required_arg, *args, **kwargs: def test_method(*args, **kwargs): required_arg = kwargs.pop('required_arg') if kwargs: raise ValueError('Unexpected keyword arguments: %s' % kwargs) Or something else? I want to use this for all my methods in the future so I'm kind of looking for the best practices way to deal with required keyword arguments in Python methods.

    Read the article

  • Python's cPickle deserialization from PHP?

    - by Ciantic
    Hi! I have to deserialize a dictionary in PHP that was serialized using cPickle in Python. In this specific case I probably could just regexp the wanted information, but is there a better way? Any extensions for PHP that would allow me to deserialize more natively the whole dictionary? Apparently it is serialized in Python like this: import cPickle as pickle data = { 'user_id' : 5 } pickled = pickle.dumps(data) print pickled Contents of such serialization cannot be pasted easily to here, because it contains binary data.

    Read the article

  • Filtering python string through external program

    - by Peter
    What's the cleanest way of filtering a Python string through an external program? In particular, how do you write the following function? def filter_through(s, ext_cmd): # Filters string s through ext_cmd, and returns the result. # Example usage: # filter a multiline string through tac to reverse the order. filter_through("one\ntwo\nthree\n", "tac") # => returns "three\ntwo\none\n" Note: the example is only that - I realize there are much better ways of reversing lines in python.

    Read the article

  • What happens when I instantiate class in Python?

    - by Konstantin
    Could you clarify some ideas behind Python classes and class instances? Consider this: class A(): name = 'A' a = A() a.name = 'B' # point 1 (instance of class A is used here) print a.name print A.name prints: B A if instead in point 1 I use class name, output is different: A.name = 'B' # point 1 (updated, class A itself is used here) prints: B B Even if classes in Python were some kind of prototype for class instances, I'd expect already created instances to remain intact, i.e. output like this: A B Can you explain what is actually going on?

    Read the article

  • jquery-like HTML parsing in Python?

    - by Roy Tang
    Is there any Python library that allows me to parse an HTML document similar to what jQuery does? i.e. I'd like to be able to use CSS selector syntax to grab an arbitrary set of nodes from the document, read their content/attributes, etc. The only Python HTML parsing lib I've used before was BeautifulSoup, and even though it's fine I keep thinking it would be faster to do my parsing if I had jQuery syntax available. :D

    Read the article

  • SQL-wrappers (activerecord) to recommened for python?

    - by Horace Ho
    is there an activerecord (any similar SQL-wrapper) for python? which is good for: used in a server-side python script light-weight supports MySQL what I need to do: insert (filename, file size, file md5, the file itself) into (string, int, string, BLOB) columns if the same file (checksum + filename) does not exist in db thx

    Read the article

< Previous Page | 67 68 69 70 71 72 73 74 75 76 77 78  | Next Page >