Search Results

Search found 10808 results on 433 pages for 'apache regexp'.

Page 73/433 | < Previous Page | 69 70 71 72 73 74 75 76 77 78 79 80  | Next Page >

  • RegEXP Javascript URL matching

    - by Blondie
    I have this so far: chrome.tabs.getSelected(null, function(tab) { var title = tab.title; var btn = '<a href="' + tab.url + '" onclick="save(\'' + title + '\');"> ' + title + '</a>'; if(RegExp('/http:\/\/www.mydomain.com\/version.php/i') == true) { document.getElementById('link').innerHTML = '<p>' + btn + '</p>'; } }); Basically it should match the domain within this: http://www.mydomain.com/version.php?* Anything that matches that even when it includes something like version.php?ver=1, etc When I used the code above of mine, it doesn't display anything, but when I remove the if statement, it's fine but it shows on other pages which it shouldn't only on the matched URL.

    Read the article

  • How to upgrade Apache 2 from 2.2 to 2.4

    - by Nina
    I was in the process of doing a test upgrade from Apache 2.2 to 2.4.3. I'm using Ubuntu 10.04. I would have upgraded to 12.04 for this to see if the upgrade would go a lot smoother. Unfortunately, I was told it wasn't an option...so I'm stuck using 10.04. The process I did this was: Before attempting this, I have managed to upgrade APR from 1.3 to 1.4 as well since apache told me it was a requirement beforehand: http://apr.apache.org/download.cgi First remove all traces of the current apache: sudo apt-get --purge remove apache2 sudo apt-get remove apache2-common apache2-utils apache2.2-bin apache2-common sudo apt-get autoremove whereis apache2 sudo rm -Rf /etc/apache2 /usr/lib/apache2 /usr/include/apache2 Afterwards, I did the following: sudo apt-get install build-essential sudo apt-get build-dep apache2 Then install apache 2.4 with the following: wget http://apache.mirrors.tds.net//httpd/httpd-2.4.3.tar.gz tar -xzvf httpd-2.4.3.tar.gz && cd httpd-2.4.3 sudo ./configure --prefix=/usr/local/apache2 --with-apr=/usr/local/apr --enable-mods-shared=all --enable-deflate --enable-proxy --enable-proxy-balancer --enable-proxy-http --with-mpm=prefork sudo make sudo make install After the make install, I ended up getting a series of errors that prevented it from installing correctly: exports.c:2513: error: redefinition of 'ap_hack_apr_uid_current' exports.c:1838: note: previous definition of 'ap_hack_apr_uid_current' was here exports.c:2514: error: redefinition of 'ap_hack_apr_uid_name_get' exports.c:1839: note: previous definition of 'ap_hack_apr_uid_name_get' was here exports.c:2515: error: redefinition of 'ap_hack_apr_uid_get' exports.c:1840: note: previous definition of 'ap_hack_apr_uid_get' was here exports.c:2516: error: redefinition of 'ap_hack_apr_uid_homepath_get' Looking for exports.c only leads me back to the httpd-2.4.3 folder. So I'm not sure what these errors mean... Thanks in advance for any help you have to offer!

    Read the article

  • Apache to read from /home/user/public_html on CentOS 5.7

    - by C.S.Putra
    this is my first experience using CentOS 5.7 / Linux as my web server OS and I have just finished installing Apache. Then I created a new account using WHM. The account is now created and the domain name can be accessed. I have put the web files under /home/user/public_html/ but when I access the domain assigned for that user which I assigned when creating new account in WHM, it doesn't read the files. In /usr/local/apache/conf/httpd.conf : <VirtualHost 175.103.48.66:80> ServerName domain.com ServerAlias www.domain.com DocumentRoot /home/user/public_html ServerAdmin [email protected] User veevou # Needed for Cpanel::ApacheConf <IfModule mod_suphp.c> suPHP_UserGroup group1 group1 </IfModule> <IfModule !mod_disable_suexec.c> SuexecUserGroup group1 group1 </IfModule> CustomLog /usr/local/apache/domlogs/domain.com-bytes_log "%{%s}t %I .\n%{%s}t %O ." CustomLog /usr/local/apache/domlogs/domain.com combined ScriptAlias /cgi-bin/ /home/user/public_html/cgi-bin/ </VirtualHost> Instead of reading from /home/user/public_html/ apache will read the /var/ww/html/ folder. How to set the apache so that when user access www.domain.com, they will access the files under /home/user/public_html/ ? Please advice. Thanks

    Read the article

  • Configuring apache and php to handle many connections

    - by Marc
    My preliminary setup is like this. Two QuadCore 8GB servers running debian 6, with php and apache, One QuadCore 16GB server running debian 6, with mysql My plan is to have one 8Gb server to act as a proxy server, using vertx java to handle connections. I will let vertx use HttpClient to send web requests to the second 8GB server. This would have apache installed and use php to deliver any information that it gets from the mysql server on the third, 16GB server. The main reason I want this setup is to have things separated, so the "proxy" will be the only way to access the system, as the other two server will only be reachable from the local network. I can have the vertx proxy handle 5000+ concurrent connections, but, I don't know how to configure apache to handle all the requests coming from the proxy. Php will connect over mysqli with persistent connection pool of 500-800 connections, the mysql server seems not to have any issues on this part. In previous projects, the apache part was always causing issues, no matter how I set it up. I might not fully understand how to setup apache, since normally apache should handle many concurrent connections, but it does seem to now.

    Read the article

  • Error in Apache: /var/run/apache2 not found

    - by Julen
    This is more self-answered question but since it drove me crazy I would like to share with the community and maybe someone can tell me why it happened or what it caused. The thing is I wanted to install in my Ubuntu 10.4 machine a CGI app, one built in the samples that come with the gSOAP toolkit. My intention was to access those from ASP .NET machine. Regular Ubuntu does not come with Apache so I install it from Sypnatic. Pretty easy. I followed this How to Install Apache2 webserver with PHP,CGI and Perl Support in Ubuntu Server. Instead of apache.conf I tweaked httpd.conf since a college here used that file instead of the first to put his Apache running. Besides I was able to access his CGI from my ASP .NET but mysteriously I could not from mine, I was getting always "The request failed with HTTP status 503: Service Temporarily Unavailable". Checking Apache error.log I found these messages: No such file or directory: unable to connect to cgi daemon after multiple tries: /home/julen/htdocs/cgi-bin/calcserver And looking more carefully whenever I restarted Apache I got this other message No such file or directory: Couldn't bind unix domain socket /var/run/apache2/cgisock. cgid daemon failed to initialize I am pretty new with Ubuntu and I could not think that Apache and Synaptic made a mistake in the installation process of the server, but it is true that the /var/run/apache2 was missing whereas in my college's computer was not. I tried to find and "elegant" solution but I found a post from 2006 that had an slight reference to it. Finally I decided to create the folder myself (as root) and then everything worked fine. Hope this helps others if they encounter a similar problem. Still I have the doubt why the folders was not created in the first place. Best, Julen.

    Read the article

  • case-insensitive regexp match on non-english text in perl cgi script

    - by jonny
    ok. I have list of catalog paths and need to filter out some of them. Match pattern comes in non-Unicode encoding. Tried following: require 5.004; use POSIX qw(locale_h); my $old_locale = setlocale(LC_ALL); setlocale(LC_ALL, "ru_RU.cp1251"); @{$data -> {doc_folder_rights}} = grep { $_->{doc_folder} =~/$_REQUEST{q}/i; # catalog path pattern in $_REQUEST{q} } @{$data -> {doc_folder_rights}}; setlocale(LC_ALL, $old_locale); What I need is case-insensitive regexp pattern matching when pattern contains russsian letters.

    Read the article

  • Debugging apache seg fault with gdb

    - by Joyce Babu
    Apache on a production server of mine is seg faulting intermittently. I have enabled core dump option in apache configuration and have several dumped core files. Unfortunately, since it is a production server, apache or the loaded modules are not compiled with debug symbols. From what I understand, gdb cannot do much without debug symbols. Can I at least find out which module is causing the seg fault, without debug symbols? If so, how? Following is the output from a gdb backtrace (gdb) bt full #0 0xb7f1f832 in _dl_sysinfo_int80 () from /lib/ld-linux.so.2 No symbol table info available. #1 0xb7be82bc in pthread_cond_wait@@GLIBC_2.3.2 () from /lib/libpthread.so.0 No symbol table info available. #2 0xb771652a in ?? () from /usr/local/apache/modules/mod_pagespeed.so No symbol table info available. #3 0xb75df576 in ?? () from /usr/local/apache/modules/mod_pagespeed.so No symbol table info available. #4 0xb7715c20 in ?? () from /usr/local/apache/modules/mod_pagespeed.so No symbol table info available. #5 0xb7be4a49 in start_thread () from /lib/libpthread.so.0 No symbol table info available. #6 0xb7b2a63e in clone () from /lib/libc.so.6 No symbol table info available. Does this mean that /lib/ld-linux.so.2 is causing the seg fault?

    Read the article

  • Invert regexp in vim

    - by Chris J
    There's a few "how do I invert a regexp" questions here on stackoverflow, but I can't find one for vim (if it does exist, by goggle-fu is lacking today). In essence I want to match all non-printable characters and delete them. I could write a short script, or drop to a shell and use tr or something similar to delete, but a vim solution would be dandy :-) Vim has the atom \p to match printable characters, however trying to do this :s/[^\p]//g to match the inverse failed and just left me with every 'p' in the file. I've seen the (?!xxx) sequence in other questions, and vim seems to not recognise this sequence. I've not found seen an atom for non-printable chars. In the interim, I'm going to drop to external tools, but if anyone's got any trick up their sleeve to do this, it'd be welcome :-) Ta!

    Read the article

  • preg_match , regexp , php , ignore white spaces and new lines

    - by Michael
    I'm trying to extract richard123 using php preg_replace but there are a lot of white spaces and new lines and I think because of that my regexp doesn't work . The html can be seen here : http://pastebin.com/embed_iframe.php?i=vuD3z9ij My current preg_match is : $find = "/< tr bgcolor=\"F0F0F0\" valign=\"middle\">< td align=\"left\">< font size=\"-1\">(.*)<\/font><\/td>/"; preg_match_all($find, $res, $matches2); print_r($matches2); I also tried <\/td/s"; <\/td/m"; <\/td/x"; but doesn't work either .

    Read the article

  • /regexp?/ on HTML, but not in form

    - by takeshin
    I need to do some regex replacement on HTML input, but I need to exclude some parts from filtering by other regexp. (e.g. remove all <a> tags with specific href="example.com…, except the ones that are inside the <form> tag) Is there any smart regex technique for this? Or do I have to find all forms using $regex1, then split the input to the smaller chunks, excluding the matched text blocks, and then run the $regex2 on all the chunks?

    Read the article

  • How to setup port forwarding from my Webserver (apache) to my Database server (mysql)

    - by karman888
    Hello again guys, and thank you for your help so far. Here is my problem: I have two remote dedicated servers, one webserver that runs apache, and one db server that runs mysql. The apache server is visible on the internet of course, but the second server is only visible to the apache server because they are connected with LAN. I need to connect to the remote mysql server through internet from my home-pc , but only apache server is visible to my home-pc. How can i setup port-forwarding from my apache server to the mysql server so i will be able to "see" the mysql server from my home-pc? This question is a follow-up from my first question Connect to remote mysql server from my application. Problem is that Mysql server is on LAN in which you answered me and helped me a lot by telling me to do "port-forwarding". I looked over the internet, and i cant find a good how-to to do port-forwarding. I'm an experienced programmer, but have little experience on hardware and networks. I can understand though what must be done, so i just need a litle help to sort things out :) I hope you can help me guys, Thank you in advance p.s. machine that Apache is running is on CentOS, mysql server also CentOS. p.s2 webserver runs WebHostManager i dont know if that makes any difference or it can be made easily through this, i just mention it :)

    Read the article

  • Confusion in RegExp Reluctant quantifier? Java

    - by Dusk
    Hi, Could anyone please tell me the reason of getting an output as: ab for the following RegExp code using Relcutant quantifier? Pattern p = Pattern.compile("abc*?"); Matcher m = p.matcher("abcfoo"); while(m.find()) System.out.println(m.group()); // ab and getting empty indices for the following code? Pattern p = Pattern.compile(".*?"); Matcher m = p.matcher("abcfoo"); while(m.find()) System.out.println(m.group());

    Read the article

  • Low-traffic WordPress website on Apache keeps crashing server

    - by OC2PS
    I have recently moved my low-moderate traffic (1000 UAUs, 5000 pageviews on a busy day) website from shared hosting to a Centos 6 64-bit VPS with Apache and cPanel running on 4 quad-core processor (likely oversold) and 3GB memory (Xen). We've had problems from the beginning. The server keeps crashing. It seems PHP keeps expanding till it consumes all the memory and crashes the server. Some folks have suggested that I should abandon Apache/cPanel/PHP/mySQL and go with nginX/Varnish/PHP-FPM/SQLite. But that's just not possible for me as I am not very tech savvy and need a simple GUI like cPanel to be able to manage the mundane management tasks (can't afford to hire system administrator or get fully managed hosting). I have come across several posts discussing optimization of Apache for WordPress. But all of these lead to articles that are pretty dated such as this ~4 year old one from Jan 2009 - http://thethemefoundry.com/blog/optimize-apache-wordpress/ The article is pretty detailed and seems helpful, but I stumble even on the first step. My httpd.conf only has 2 loadmodule commands LoadModule fastinclude_module modules/mod_fastinclude.so LoadModule bwlimited_module modules/mod_bwlimited.so So I go total bust right there. Further, my httpd.conf says Direct modifications to the Apache configuration file may be lost upon subsequent regeneration of the configuration file. To have modifications retained, all modifications must be checked into the configuration system by running: /usr/local/cpanel/bin/apache_conf_distiller I am having trouble finding where to change the modules in WHM. Please can someone help me with updated guidelines on how to optimize Apache for WordPress? Many thanks! P.S. The WordPress installation also has WP Super Cache installed. P.P.S. I also have phpBB, OpenCart, and Menalto Gallery installed.

    Read the article

  • Fixed ruby/mysql connection with new libmysql.dll, and broke Apache in the process

    - by jmtoporek
    Ok so bit of background - all my development has been on a local Windows 7 machine. I had Apache with PHP/MySQL running with no issues. Been using ruby (1.9.3 and latest rails release 3.2.9) with built in webrick server, but had a devil of a time connecting to mysql. Did some research, updated my libmysql.dll file in c:/ruby/bin and it worked! Very happy... except now Apache stopped working. In my attempt to resolve the issue I found an older copy of libmysql.dll, renamed the new file, copied the old file back to c:ruby/bin and apache works, ruby does not. So I can take this ass backwards approach but obviously this seems pretty stupid. I was surprised that Apache was using the dll file in ruby/bin folder. I presume this is related to path variables perhaps? I guess I was hoping someone could direct me as to how I can use one dll file for apache and another for ruby. Or if you have some other smarter approach - I've smart enough to follow directions to install apache from scratch and enable php on windows as well as ubuntu, but I'm not much of a sys admin, just a semi competent web developer.

    Read the article

  • how to log digester with apache commons?

    - by Bruce
    Hi all I'm having trouble getting digester to log anything. I'd be hugely grateful for any light anyone can shed. In my code I'm doing this: Digester digester = new Digester(); .. some digester set up stuff // What on earth should go in here???? digester.setLogger(LogFactory.getLog("org.apache.commons.logging.Log")); I have a commons-logging.properties file in my classpath as follows: org.apache.commons.logging.Log=org.apache.commons.logging.impl.SimpleLog org.apache.commons.logging.simplelog.log.org.apache.commons.digester.Digester=debug org.apache.commons.logging.simplelog.log.org.apache.commons.digester.Digester.sax=info I just get no debug info at all.. Thanks for your help!

    Read the article

  • Apache /server-status/ gives a 404 not found

    - by user57069
    I am trying to solve a problem where Apache stats aren't displaying correctly in Munin. I've ran through quite a bit of checks and tests regarding Munin setup, but I think my issue is related to Apache, but my skill set there is lacking. first, system info: monitored server CentOS 5.3 kernel 2.6.18-128.1.1.el5 Apache/2.2.3 "server-status" directive in httpd.conf (i've cross-compared this with another system that i did a successful parallel install of Munin on, correctly showing Apache stats, and the directive below is the same for both) ExtendedStatus On <Location /server-status> SetHandler server-status Order deny,allow Deny from all Allow from 127.0.0.1 </Location> ran lynx http://localhost/server-status got HTTP/1.1 404 taking a look at Apache access_log: 127.0.0.1 - - [13/Oct/2010:07:00:47 -0700] "GET /server-status HTTP/1.0" 404 11237 "-" "Lynx/2.8.5rel.1 libwww-FM/2.14 SSL-MM/1.4.1 OpenSSL/0.9.8e-fips-rhel5" mod_status is also loaded: % grep "mod_status" /etc/httpd/conf/httpd.conf LoadModule status_module modules/mod_status.so iptables is turned off also i did notice that the ownership status on httpd.conf on this system is root.root.. whereas the system that is displaying correctly is apache.www -- not certain that this matters?? its got to be permission issue, but i'm not certain where the permissions are messed up. any thoughts on why the test of server-status is giving me a 404?

    Read the article

  • Regexp in iOS to find comments

    - by SteveDolphin23
    I am trying to find and process 'java-style' comments within a string in objective-C. I have a few regex snippets which almost work but I am stuck on one hurdle: different options seem to make the different styles work. For example, I am using this to match: NSArray* matches = [[NSRegularExpression regularExpressionWithPattern:expression options:NSRegularExpressionAnchorsMatchLines error:nil] matchesInString:string options:0 range:searchRange]; The options here allow me successfully find and process single line comments (//) but not multiline (/* */), if I change the option to NSRegularExpressionDotMatchesLineSeparators then I can make multiline work fine but I can't find the 'end' of a single line comment. I suppose really I need dot-matches-line-separators but I need a better way of finding the end of a single line comment? The regexp I have so far are: @"/\\*.*?\\*/" @"//.*$" it's clear to see if dot matches a line separator then the second one (single line) never 'finishes' but how do I fix this? I found some suggestions for single line that were more like: @"(\/\/[^"\n\r]*(?:"[^"\n\r]*"[^"\n\r]*)*[\r\n])" But that doesn't' seem to work at all! Thanks in advance for any pointers.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Does Apache ever give incorrect "out of threads" errors?

    - by Eli Courtwright
    Lately our Apache web server has been giving us this error multiple times per day: [Tue Apr 06 01:07:10 2010] [error] Server ran out of threads to serve requests. Consider raising the ThreadsPerChild setting We raised our ThreadsPerChild setting from 50 to 100, but we still get the error. Our access logs indicate that these errors never even happen at periods of high load. For example, here's an excerpt from our access log (ip addresses and some urls are edited for privacy). As you can see, the above error happened at 1:07 and only a small handful of requests occurred in the several minutes leading up to the error: 99.88.77.66 - - [06/Apr/2010:00:59:33 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/css/smoothness/images/ui-icons_222222_256x240.png HTTP/1.1" 304 - 99.88.77.66 - - [06/Apr/2010:00:59:34 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/css/smoothness/images/ui-bg_glass_75_dadada_1x400.png HTTP/1.1" 200 111 99.88.77.66 - - [06/Apr/2010:00:59:34 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/css/smoothness/images/ui-bg_glass_75_dadada_1x400.png HTTP/1.1" 200 111 99.88.77.66 - mpeu [06/Apr/2010:00:59:40 -0400] "GET /some/dynamic/content HTTP/1.1" 200 145049 55.44.33.22 - mpeu [06/Apr/2010:01:06:56 -0400] "GET /other/dynamic/content HTTP/1.1" 200 12311 55.44.33.22 - - [06/Apr/2010:01:06:56 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/css/smoothness/jquery-ui-1.7.1.custom.css HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:56 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/js/jquery-1.3.2.min.js HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:56 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/js/jquery-ui-1.7.1.custom.min.js HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:56 -0400] "GET /WebRepository/jquery.tablesorter.min.js HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:56 -0400] "GET /WebRepository/date.js HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:56 -0400] "GET /WebRepository/pdfs/image1.gif HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:56 -0400] "GET /WebRepository/pdfs/image2.png HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:56 -0400] "GET /WebRepository/pdfs/image3.png HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:56 -0400] "GET /WebRepository/pdfs/image4.png HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:56 -0400] "GET /WebRepository/pdfs/image5.png HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:56 -0400] "GET /WebRepository/pdfs/image6.png HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:56 -0400] "GET /WebRepository/pdfs/image7.png HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:57 -0400] "GET /WebRepository/pdfs/image8.png HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:57 -0400] "GET /WebRepository/pdfs/image9.png HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:57 -0400] "GET /WebRepository/pdfs/imageA.png HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:57 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/css/smoothness/images/ui-bg_flat_75_ffffff_40x100.png HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:59 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/css/smoothness/images/ui-bg_highlight-soft_75_cccccc_1x100.png HTTP/1.1" 304 - 55.44.33.22 - - [06/Apr/2010:01:06:59 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/css/smoothness/images/ui-bg_glass_75_e6e6e6_1x400.png HTTP/1.1" 200 110 55.44.33.22 - - [06/Apr/2010:01:06:59 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/css/smoothness/images/ui-bg_glass_75_e6e6e6_1x400.png HTTP/1.1" 200 110 11.22.33.44 - mpeu [06/Apr/2010:01:18:03 -0400] "GET /other/dynamic/content HTTP/1.1" 200 12311 11.22.33.44 - - [06/Apr/2010:01:18:03 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/js/jquery-1.3.2.min.js HTTP/1.1" 304 - 11.22.33.44 - - [06/Apr/2010:01:18:04 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/css/smoothness/jquery-ui-1.7.1.custom.css HTTP/1.1" 200 27374 11.22.33.44 - - [06/Apr/2010:01:18:04 -0400] "GET /WebRepository/jquery/jquery-ui-1.7.1.custom/js/jquery-ui-1.7.1.custom.min.js HTTP/1.1" 304 - 11.22.33.44 - - [06/Apr/2010:01:18:04 -0400] "GET /WebRepository/jquery.tablesorter.min.js HTTP/1.1" 200 12795 11.22.33.44 - - [06/Apr/2010:01:18:04 -0400] "GET /WebRepository/date.js HTTP/1.1" 200 25809 For what it's worth, we're running the version of Apache that ships with Oracle 10g (some 2.0 version), and we're using mod_plsql to generate our dynamic content. Since the Apache server runs as a separate process and the database doesn't record any problems when this error occurs, I'm doubtful that Oracle is the problem. Unfortunately, the errors are freaking out our sysadmins, who are inclined to blame any and all problems which occur with the server on this error. Is this a known bug in Apache that I simply haven't been able to find any reference to through Google?

    Read the article

  • Use a non-coalescing parser in Axis2

    - by Nathan
    Does anyone know how I can get Axis2 to use a non-coalescing XMLStreamReader when it parses a SOAP message? I am writing code that reads a large base64 binary text element. Coalescing is the default behaviour, and this causes the default XMLStreamReader to load the entire text into memory rather than returning multiple CHARACTERS events. The upshot of this is that I run out of heap space when running the following code: reader = element.getTextAsStream( true ); The OutOfMemory error occurs in com.sun.org.apache.xerces.internal.impl.XMLStreamReaderImpl.next: java.lang.OutOfMemoryError: Java heap space at com.sun.org.apache.xerces.internal.util.XMLStringBuffer.append(XMLStringBuffer.java:208) at com.sun.org.apache.xerces.internal.util.XMLStringBuffer.append(XMLStringBuffer.java:226) at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl.scanContent(XMLDocumentFragmentScannerImpl.java:1552) at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl$FragmentContentDriver.next(XMLDocumentFragmentScannerImpl.java:2864) at com.sun.org.apache.xerces.internal.impl.XMLDocumentScannerImpl.next(XMLDocumentScannerImpl.java:607) at com.sun.org.apache.xerces.internal.impl.XMLNSDocumentScannerImpl.next(XMLNSDocumentScannerImpl.java:116) at com.sun.org.apache.xerces.internal.impl.XMLStreamReaderImpl.next(XMLStreamReaderImpl.java:558) at org.apache.axiom.util.stax.wrapper.XMLStreamReaderWrapper.next(XMLStreamReaderWrapper.java:225) at org.apache.axiom.util.stax.dialect.DisallowDoctypeDeclStreamReaderWrapper.next(DisallowDoctypeDeclStreamReaderWrapper.java:34) at org.apache.axiom.util.stax.wrapper.XMLStreamReaderWrapper.next(XMLStreamReaderWrapper.java:225) at org.apache.axiom.util.stax.dialect.SJSXPStreamReaderWrapper.next(SJSXPStreamReaderWrapper.java:138) at org.apache.axiom.om.impl.builder.StAXOMBuilder.parserNext(StAXOMBuilder.java:668) at org.apache.axiom.om.impl.builder.StAXOMBuilder.next(StAXOMBuilder.java:214) at org.apache.axiom.om.impl.llom.SwitchingWrapper.updateNextNode(SwitchingWrapper.java:1098) at org.apache.axiom.om.impl.llom.SwitchingWrapper.<init>(SwitchingWrapper.java:198) at org.apache.axiom.om.impl.llom.OMStAXWrapper.<init>(OMStAXWrapper.java:73) at org.apache.axiom.om.impl.llom.OMContainerHelper.getXMLStreamReader(OMContainerHelper.java:67) at org.apache.axiom.om.impl.llom.OMContainerHelper.getXMLStreamReader(OMContainerHelper.java:40) at org.apache.axiom.om.impl.llom.OMElementImpl.getXMLStreamReader(OMElementImpl.java:790) at org.apache.axiom.om.impl.llom.OMElementImplUtil.getTextAsStream(OMElementImplUtil.java:114) at org.apache.axiom.om.impl.llom.OMElementImpl.getTextAsStream(OMElementImpl.java:826) at org.example.UploadFileParser.invokeBusinessLogic(UploadFileParser.java:160)

    Read the article

  • How Do I Cache Just the Homepage with Apache .htaccess?

    - by Volomike
    This config is close... <FilesMatch "\.(php)$"> Header set Cache-Control "max-age=7200, must-revalidate" </FilesMatch> ...but it does all php pages, not just the home page like I want. Basically the developer said he wants example.com to be cached, while: http://example.com/electronics/ would not be cached. Note the developer is using pretty URLs with an MVC framework that runs everything through index.php.

    Read the article

  • Why won't these permissions do what I wish?

    - by Chris B.
    I am trying to make my folder owned by "apache" and then chmod that folder so that only the owner and group can access it. I am trying to do this to keep visitors from executing user-uploaded files directly. Here are the commands I am using: chown -R apache uploads chmod -R 770 uploads Source: http://www.mysql-apache-php.com/fileupload-security.htm Instead it seems that although it is keeping visitors from seeing the files, it is not allowing apache to serve them. Do you have any ideas?

    Read the article

  • How come my Apache can't read my media folder, but it can load the site? (static files don't work)

    - by Alex
    Alias /media/ /home/matt/repos/hello/media <Directory /home/matt/repos/hello/media> Options -Indexes Order deny,allow Allow from all </Directory> WSGIScriptAlias / /home/matt/repos/hello/wsgi/django.wsgi /media is my directory. When I go to mydomain.com/media/, it says 403 Forbidden. And, the rest of my site doesn't work because all static files are 404s. Why? The page loads. Just not the media folder. Edit: hello is my project folder. I have tried 777 all my permissions of that folder.

    Read the article

< Previous Page | 69 70 71 72 73 74 75 76 77 78 79 80  | Next Page >