Search Results

Search found 36719 results on 1469 pages for 'value chain'.

Page 751/1469 | < Previous Page | 747 748 749 750 751 752 753 754 755 756 757 758  | Next Page >

  • How to pass an integration property to a batch file with CruiseControlNet ?

    - by TridenT
    In the build log of my project, i can see these properties: <integrationProperties> <CCNetProject>Gdet_T</CCNetProject> ... <LastChangeNumber>0</LastChangeNumber> <LastIntegrationStatus>Success</LastIntegrationStatus> <LastSuccessfulIntegrationLabel>25</LastSuccessfulIntegrationLabel> <LastModificationDate>4/6/2010 1:29:04 PM</LastModificationDate> <LastChangeNumber>10841</LastChangeNumber> </integrationProperties> I want to pass the property CCNetProject and LastChangeNumber to a batch file. it works well with CCNetProject, as it can be used in the batch as an environment variable %CCNetProject%. But it doesn't work with other properties (those are not starting with the CCnet prefix) as LastChangeNumber or LastModificationDate. I tried to pass it as environment variable, but it fails ! <exec> <executable>$(WorkingFolderBase)\MyBatch.bat</executable> <baseDirectory>$(WorkingFolderBase)\</baseDirectory> <buildArgs>$(LastModificationDate)</buildArgs> </exec> I tried to pass it as argument, but it fails: <exec> <executable>$(WorkingFolderBase)\MyBatch.bat</executable> <baseDirectory>$(WorkingFolderBase)\</baseDirectory> <environment> <variable> <name>svn_label</name> <value>"${LastModificationDate}"</value> </variable> </environment> </exec> The results is always the same when I display the parameter or variable : empty string or the variable name $(svn_label) I'm sure it is simple, but ... I can't find ! Any idea ?

    Read the article

  • Get dragged / saved items state back from Sql Server

    - by user571507
    Ok i saw many post's on how to serialize the value of dragged items to get hash and they tell how to save them. Now the question is how do i persist the dragged items the next time when user log's in using the has value that i got eg: <ul class="list"> <li id="id_1"> <div class="item ui-corner-all ui-widget ui-widget-content"> </div> </li> <li id="id_2"> <div class="item ui-corner-all ui-widget ui-widget-content"> </div> </li> <li id="id_3"> <div class="item ui-corner-all ui-widget ui-widget-content"> </div> </li> <li id="id_4"> <div class="item ui-corner-all ui-widget"> </div> </li> </ul> which on serialize will give "id[]=1&id[]=2&id[]=3&id[]=4" Now think that i saved it to Sql server database in a single field called SortOrder. Now how do i get the items to these order again ? the code to make these sort is below,without which people didn't know which library i had used to sort and serialize <script type="text/javascript"> $(document).ready(function() { $(".list li").css("cursor", "move"); $(".list").sortable(); }); </script>

    Read the article

  • jQuery indexOf select box manipulation

    - by kenny99
    Hi, I'm trying to figure out how to remove options from a select box when that option has been selected in an adjacent select box. Basically the user has the option to add multiple records here via select boxes, but I want to remove the list of options available to them so that, for example, they can't enter the same value in two select boxes. When an Add More button is clicked, I fade in the next select box container. A number of select boxes have been generated by PHP and I use JS to hide them. Each select box has a unique number appended to the ID, so i want to access those select boxes which contain the string "other_pet_types", then I want to iterate through the currently visible ones and build an array of the values which have been selected, which I will then remove from the list of options in the newly displayed select box. This is what I have so far, but it's definitely not right - I can't get the initial test on the ID to work. Any pointers greatly appreciated as i realise i'm pretty wide of the mark at the moment! var vals = new Array(); //build array with currently selected options $('p.mult_entries select').each(function(){ vals += $(this).val(); }); $("p.mult_entries:hidden:first").fadeIn("slow", function() { $(this).find(('select').attr('id').indexOf('other_pet_types') > 0).each(function(){ console.log($(this).val()); //as expected prints nothing - need to iterate through the options of the above select //once i extract the correct values, iterate through new select box and use inArray to remove options where that value already exists in one of previous select boxes }); });

    Read the article

  • Help Optimizing MySQL Table (~ 500,000 records) and PHP Code.

    - by Pyrite
    I have a MySQL table that collects player data from various game servers (Urban Terror). The bot that collects the data runs 24/7, and currently the table is up to about 475,000+ records. Because of this, querying this table from PHP has become quite slow. I wonder what I can do on the database side of things to make it as optomized as possible, then I can focus on the application to query the database. The table is as follows: CREATE TABLE IF NOT EXISTS `people` ( `id` bigint(20) unsigned NOT NULL AUTO_INCREMENT, `name` varchar(40) NOT NULL, `ip` int(4) unsigned NOT NULL, `guid` varchar(32) NOT NULL, `server` int(4) unsigned NOT NULL, `date` int(11) NOT NULL, PRIMARY KEY (`id`), UNIQUE KEY `Person` (`name`,`ip`,`guid`), KEY `server` (`server`), KEY `date` (`date`), KEY `PlayerName` (`name`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 COMMENT='People that Play on Servers' AUTO_INCREMENT=475843 ; I'm storying the IPv4 (ip and server) as 4 byte integers, and using the MySQL functions NTOA(), etc to encode and decode, I heard that this way is faster, rather than varchar(15). The guid is a md5sum, 32 char hex. Date is stored as unix timestamp. I have a unique key on name, ip and guid, as to avoid duplicates of the same player. Do I have my keys setup right? Is the way I'm storing data efficient? Here is the code to query this table. You search for a name, ip, or guid, and it grabs the results of the query and cross references other records that match the name, ip, or guid from the results of the first query, and does it for each field. This is kind of hard to explain. But basically, if I search for one player by name, I'll see every other name he has used, every IP he has used and every GUID he has used. <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> Search: <input type="text" name="query" id="query" /><input type="submit" name="btnSubmit" value="Submit" /> </form> <?php if (!empty($_POST['query'])) { ?> <table cellspacing="1" id="1up_people" class="tablesorter" width="300"> <thead> <tr> <th>ID</th> <th>Player Name</th> <th>Player IP</th> <th>Player GUID</th> <th>Server</th> <th>Date</th> </tr> </thead> <tbody> <?php function super_unique($array) { $result = array_map("unserialize", array_unique(array_map("serialize", $array))); foreach ($result as $key => $value) { if ( is_array($value) ) { $result[$key] = super_unique($value); } } return $result; } if (!empty($_POST['query'])) { $query = trim($_POST['query']); $count = 0; $people = array(); $link = mysql_connect('localhost', 'mysqluser', 'yea right!'); if (!$link) { die('Could not connect: ' . mysql_error()); } mysql_select_db("1up"); $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (name LIKE \"%$query%\" OR INET_NTOA(ip) LIKE \"%$query%\" OR guid LIKE \"%$query%\")"; $result = mysql_query($sql, $link); if (!$result) { die(mysql_error()); } // Now take the initial results and parse each column into its own array while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } // now for each name, ip, guid in results, find additonal records $people2 = array(); foreach ($people AS $person) { $ip = $person['ip']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (ip = \"$ip\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people2[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } $people3 = array(); foreach ($people AS $person) { $guid = $person['guid']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (guid = \"$guid\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people3[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } $people4 = array(); foreach ($people AS $person) { $name = $person['name']; $sql = "SELECT id, name, INET_NTOA(ip) AS ip, guid, INET_NTOA(server) AS server, date FROM 1up_people WHERE (name = \"$name\")"; $result = mysql_query($sql, $link); while ($row = mysql_fetch_array($result, MYSQL_NUM)) { $name = htmlspecialchars($row[1]); $people4[] = array( 'id' => $row[0], 'name' => $name, 'ip' => $row[2], 'guid' => $row[3], 'server' => $row[4], 'date' => $row[5] ); } } // Combine people and people2 into just people $people = array_merge($people, $people2); $people = array_merge($people, $people3); $people = array_merge($people, $people4); $people = super_unique($people); foreach ($people AS $person) { $date = ($person['date']) ? date("M d, Y", $person['date']) : 'Before 8/1/10'; echo "<tr>\n"; echo "<td>".$person['id']."</td>"; echo "<td>".$person['name']."</td>"; echo "<td>".$person['ip']."</td>"; echo "<td>".$person['guid']."</td>"; echo "<td>".$person['server']."</td>"; echo "<td>".$date."</td>"; echo "</tr>\n"; $count++; } // Find Total Records //$result = mysql_query("SELECT id FROM 1up_people", $link); //$total = mysql_num_rows($result); mysql_close($link); } ?> </tbody> </table> <p> <?php echo $count." Records Found for \"".$_POST['query']."\" out of $total"; ?> </p> <?php } $time_stop = microtime(true); print("Done (ran for ".round($time_stop-$time_start)." seconds)."); ?> Any help at all is appreciated! Thank you.

    Read the article

  • How to use ID selector after jQuery html()

    - by user555617
    It's amazing to try to understand why the function alert("hello") is not generated after clicking more than once... There is some method to do this function is executed? Note that doesn't work after update using html() involving id "press" in button. Any idea? See: http://jsbin.com/atuqu3 JavaScript: $(document).ready(function (){ $("#press").click(function() { $("#relation-states").html('<select id="state" name="state"> <option value="Texas">Texas</option> </select><button id="press" type="button" title="" aria-haspopup="true" style="width: 175px;"><span>Select an item</span></button>');; alert("hello"); }); }); HTML: <div id="relation-states"> <select id="state" name="state"> <option value="New York">New York</option> </select> <button id="press" type="button" title="" aria-haspopup="true" style="width: 175px;"><span>Select an item</span></button> </div>

    Read the article

  • a way to use log4j pass values like java -DmyEnvVar=A_VALUE to my code

    - by raticulin
    I need to pass some value to enable certain code in may app (in this case is to optionally enable writing some stats to a file in certain conditions, but it might be anything generally). My java app is installed as a service. So every way I have thought of has some drawbacks: Add another param to main(): cumbersome as customers already have the tool installed, and the command line would need to be changed every time. Adding java -DmyEnvVar=A_VALUE to my command line: same as above. Set an environment variable: service should at least be restarted, and even then you must take care of what user is the service running under etc. Adding the property in the config file: I prefer not to have this visible on the config file so the user does not see it, it is something for debugging etc. So I thought maybe there is some way (or hack) to use log4j loggers to pass that value to my code. I have thought of one way already, although is very limited: Add a dummy class to my codebase com.dummy.DevOptions public class DevOptions { public static final Logger logger = Logger.getLogger(DevOptions.class); In my code, use it like this: if (DevOptions.logger.isInfoEnabled()){ //do my optional stuff } //... if (DevOptions.logger.isDebugEnabled()){ //do other stuff } This allows me to use discriminate among various values, and I could increase the number by adding more loggers to DevOptions. But I wonder whether there is a cleaner way, possibly by configuring the loggers only in log4j.xml??

    Read the article

  • jQuery: If, Else with buttons error

    - by Wipqozn
    I'm running into an odd error. I'm working in Django 1.2, and have implemented the commenting framework. I'm trying to attach a hide/show button to each comment field, but whenever click on a hide/show button, it behaves as if each hide/show button beneath it on the page was clicked. Here's the jQuery code: <input type="Button" id="hideShow" name="hide/show" value="Hide"></input> <script> $("#hideShow").click(function() { if($(this).val() == "Hide") { $("textarea").hide("fast"); $(this).val("Show"); } else { $("textarea").show("fast"); $(this).val( "Hide"); } }); </script> So, when I click the Hide/show button, it will perform the action for each button beneath the clicked button + once for the button itself. So If I click a button, and there are two buttons beneath it, and value=hide it will first hide the 'textarea', than show the text area, than finally hide it again. I'm new to jQuery (although I do have experience in other languages), and I have an -idea- why it's not working: that whenever an action is performed jQuery jumps to the first one, than continues down the page looking for any other actions performed, and responds to each one. So it comes to my first button, sets it as being clicked, and so when jQuery comes across the other buttons it views them all as being 'clicked' and performs actions accordingly. I've thought of a semi-solution to my problem, putting in a variable which tracks how many times it has gone through, and than acting based on -that- action. But I would rather not do that, since it's not really a solution to the problem at hand but a work around. Any input is appreciated.

    Read the article

  • Please help with IFrame callback

    - by Code Sherpa
    Hi - thanks for clicking. I am trying to get status feedback using an IFrame for file uploads. I am not trying to get progress or percentages - just when a file is done uploading and if it was a success or failure. THE PROBLEM is that I can't seem to get the server response to appear on the client. I have to following design: I have an iframe on my page: <iframe id="target_frame" src="" style="border:0px; width:0px; height:0px"></iframe> The form tag points to it: <form enctype="multipart/form-data" id="fileUploadForm" name="fileUploadForm" action="picupload.aspx" method="post" target="target_frame"> And the submit button starts a file upload via the iframe: <input id="submit" type="submit" value="upload" /> In the picupload.aspx.cs file, I have a method that returns dynamic data. I then send it to the client: message = data; Response.Write(String.Format("<script language='javascript' type='text/javascript'>window.parent.handleResponse('{0}');</script>", message)); On the client, I have a response handler: function handleResponse(msg) { document.getElementById('statusDiv').innerHTML = msg; } My intent is to see the msg value change for each uploaded file but I never see anything appear in statusDiv, let alone dynamically changing messages. Can somebody please help??

    Read the article

  • shreding xml column

    - by csetzkorn
    Hi, I have a XML column which contains XML like this: <Set> <Element> <ID> 1 </ID> <List> <ListElement> <Part1> ListElement 1 </Part1> </ListElement> <ListElement> <Part1> ListElement2 </Part1> </ListElement> </List> </Element> <Element> <ID> 2 </ID> <List> <ListElement> <Part1> ListElement3 </Part1> </ListElement> <ListElement> <Part1> ListElement4 </Part1> </ListElement> </List> </Element> </Set> I would like to shred this into a relation table containing this: ID, ListElement 1, ListElement1 1, ListElement2 2, ListElement3 2, ListElement4 I am able to obtain the content of the Parts using something like this: select List.value('(Part1/text())[1]', 'varchar(max)') as test from Table CROSS APPLY xml.nodes('// Element/List/ListElement') AS List(List) but I have not yet achieved to keep the ‘foreign key’ (the ID value). Thanks. Best wishes, Christian

    Read the article

  • im i doing this right or wrong using pointers in C

    - by Amandeep Singh Dhari
    i like to point out that i need some help with my home work, ok the lectuer gave us the idea of a program and we have to make it from bottom to top. got to have user to type in two set of string. pointers take in the value and then puts into a prototype i need to make a 3rd pointer that has the value of p1 and p2. like this p1 = asd, p2 = qwe and p3 = asdqwe #include "stdafx.h" #include <ctype.h> char *mystrcat(char*s1p, char*s2p); // Prototype char main(void) { char string1[80]; char string2[80]; printf("%s", "enter in your srting one "); gets_s(string1); printf("%s", "enter in your srting two "); gets_s(string2); *mystrcat(string1, string2); return 0; } char *mystrcat(char *s1p,char *s2p) { //char *string3; //char *string4; //string3 = s1p; //string4 = s2p; printf("whatever = %s%s\n", s1p, s2p); return 0; } this is the code that i made so far just need some help, thank guys in advance.

    Read the article

  • clang does not compile but g++ does

    - by user1095108
    Can someone help me with this code: #include <type_traits> #include <vector> struct nonsense { }; template <struct nonsense const* ptr, typename R> typename std::enable_if<!std::is_void<R>::value, int>::type fo(void* const) { return 0; } template <struct nonsense const* ptr, typename R> typename std::enable_if<std::is_void<R>::value, int>::type fo(void* const) { return 1; } typedef int (*func_type)(void*); template <std::size_t O> void run_me() { static struct nonsense data; typedef std::pair<char const* const, func_type> pair_type; std::vector<pair_type> v; v.push_back(pair_type{ "a", fo<&data, int> }); v.push_back(pair_type{ "b", fo<&data, void> }); } int main(int, char*[]) { run_me<2>(); return 0; } clang-3.3 does not compile this code, but g++-4.8.1 does, which of the two compiler is right? Is something wrong with the code, as I suspect? The error reads: a.cpp:32:15: error: no matching constructor for initialization of 'pair_type' (aka 'pair<const char *const, func_type>') v.push_back(pair_type{ "a", fo<&data, int> }); ^ ~~~~~~~~~~~~~~~~~~~~~~~ a.cpp:33:15: error: no matching constructor for initialization of 'pair_type' (aka 'pair<const char *const, func_type>') v.push_back(pair_type{ "b", fo<&data, void> }); ^ ~~~~~~~~~~~~~~~~~~~~~~~~

    Read the article

  • When I try to pass large amounts of information using jquery $.ajax(post) method. it throws potenti

    - by dotnetrocks
    I am trying to create a preview window for my texteditor in my blog page. I need to send the content to the server to clean up the text entered before I can preview it on the preview window. I was trying to use $.ajax({ type: method, url: url, data: values, success: LoadPageCallback(targetID), error: function(msg) { $('#' + targetID).attr('innerHTML', 'An error has occurred. Please try again.'); } }); Whenever I tried to click on the preview button it returns an XMLHTTPRequest error. The error description - Description: Request Validation has detected a potentially dangerous client input value, and processing of the request has been aborted. This value may indicate an attempt to compromise the security of your application, such as a cross-site scripting attack. You can disable request validation by setting validateRequest=false in the Page directive or in the configuration section. However, it is strongly recommended that your application explicitly check all inputs in this case. The ValidateRequest for the page is set to false. Is there a way I can set validaterequest to false for the ajax call.Please advise Thank you for reading my post.

    Read the article

  • How do I get 2-way data binding to work for nested asp.net Repeater controls

    - by jimblanchard
    I have the following (trimmed) markup: <asp:Repeater ID="CostCategoryRepeater" runat="server"> <ItemTemplate> <div class="costCategory"> <asp:Repeater ID="CostRepeater" runat="server" DataSource='<%# Eval("Costs")%>'> <ItemTemplate> <tr class="oddCostRows"> <td class="costItemTextRight"><span><%# Eval("Variance", "{0:c0}")%></span></td> <td class="costItemTextRight"><input id="SupplementAmount" class="costEntryRight" type="text" value='<%# Bind("SupplementAmount")%>' runat="server" /></td> </tr> </ItemTemplate> </asp:Repeater> </div> </ItemTemplate> </asp:Repeater> The outer repeater's DataSource is set in the code-beside. I've snipped them, but there are Eval statements that wire up to the properties in the outer Repeater. Anyway, one of the fields in the inner Repeater needs to be a Bind instead of an Eval, as I want to get the values that the user types in. The SupplementAmount input element correctly receives it's value when the page loads, but on the other side, when I inspect the contents of the Costs List when the form posts back, the changes the user made aren't present. Thanks.

    Read the article

  • jquery can't get the change event on select element

    - by user63898
    i have this code the jquery code never got triggered none of the scripts are triggered : $('select[name=privileges]').change(function(){ alert("id"); var id = $(this).find(':selected')[0].id; alert(id); $('#changevalue').val(id); }) or this: $("#privileges_select").change(function() { alert($('#privileges_select option:selected').html()); }); <form method="GET" action="create_new_user.php"> user:<input type="text" size="40" name="user_name"/> password:<input type="text" size="40" name="password"/> <select name=privileges id="privileges_select"> <option name='opt_1'>admin</option> <option name='opt_2'>ordinary</option> </select> <input type="hidden" name="item_options_id" value="" id="changevalue" /> <input type="submit" value ="create" /> <input type="reset" /> </form> in the end i like to send the selected option id in the form get

    Read the article

  • c++ figuring out memory layout of members programatically

    - by anon
    Suppose in one program, I'm given: class Foo { int x; double y; char z; }; class Bar { Foo f1; int t; Foo f2; }; int main() { Bar b; bar.f1.z = 'h'; bar.f2.z = 'w'; ... some crap setting value of b; FILE *f = fopen("dump", "wb"); // c-style file fwrite(&b, sizeof(Bar), 1, f); } Suppose in another program, I have: int main() { File *f = fopen("dump", "rb"); std::string Foo = "int x; double y; char z;"; std::string Bar = "Foo f1; int t; Foo f2;"; // now, given this is it possible to read out // the value of bar.f1.z and bar.f2.z set earlier? } WHat I'm asking is: given I have the types of a class, can I figure out how C++ lays it out?

    Read the article

  • Userdefined margins in WPF printing

    - by MTR
    Most printing samples for WPF go like this: PrintDialog dialog = new PrintDialog(); if (dialog.ShowDialog() == true) { StackPanel myPanel = new StackPanel(); myPanel.Margin = new Thickness(15); Image myImage = new Image(); myImage.Width = dialog.PrintableAreaWidth; myImage.Stretch = Stretch.Uniform; myImage.Source = new BitmapImage(new Uri("pack://application:,,,/Images/picture.bmp")); myPanel.Children.Add(myImage); myPanel.Measure(new Size(dialog.PrintableAreaWidth, dialog.PrintableAreaHeight)); myPanel.Arrange(new Rect(new Point(0, 0), myPanel.DesiredSize)); dialog.PrintVisual(myPanel, "A Great Image."); } What I don't like about this is, that they always set the margin to a fixed value. But in PrintDialog the user has the option to choose a individual margin that no sample cares about. If the user now selects a margin that is larger as the fixed margin set by program, the printout is truncated. Is there a way to get the user selected margin value from PrintDialog? TIA Michael

    Read the article

  • Enlist a table's columns in other component

    - by bungrudi
    The main goal is to have a dropdown menu where each of its menuItems represents one column of a <rich:extendedDataTable />. Above the table I have this: <rich:dropDownMenu value="Column visibility" submitMode="none" direction="bottom-right"> <c:forEach var="columnConfigVO" items="#{gridConfigurationManager.getColumnConfigs(listId)}"> <rich:menuItem value="columnConfigVO.columnId" /> </c:forEach> </rich:dropDownMenu> And then bellow that I have the usual <rich:extendedDataTable /> with its columns. I register the table columns to gridConfigurationManager component by overriding beforeRenderResponse() in ExtendedDataTable class. The problem is that <c:forEach /> is executing before renderResponse phase, thus gridConfigurationManager.getColumnConfigs(listId) return empty. The question is, how do I register the columns in gridConfigurationManager component before <c:forEach /> start executing? Or, anyone know a different approach to accomplish this? Thanks.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Refactor link to show/hide a table row

    - by abatishchev
    I have a table with row which cab be hidden by user. It's implemented this way: Markup: <table> <tr> <td> <table style="margin-left: auto; text-align: right;"> <tr> <td class="stats-hide"> <a href="#" onclick="hideStats();">Hide</a> </td> <td class="stats-show" style="display: none;"> <a href="#" onclick="showStats();">Show</a> </td> </tr> </table> </td> </tr> <tr class="stats-hide"> <td> <!-- data --> </td> </tr> </table> And jQuery code: <script type="text/javascript" language="javascript"> function hideStats() { hideControls(true, $('.stats-hide')); hideControls(false, $('.stats-show')); } function showStats() { hideControls(false, $('.stats-hide')); hideControls(true, $('.stats-show')); } function hideControls(value, arr) { $(arr).each(function () { if (value) { $(this).hide(); } else { $(this).show(); } }); } </script> How to implement the same behavior with one, single link and one, probably, CSS class? My idea - store somewhere a boolean variable and toggle controls visibility relatively to this variable. Are there more?

    Read the article

  • Can I attach data gathered by a form to a file that is being uploaded?

    - by Jacob
    I need customers to upload files to my website and I want to gather their name or company name and attach it to the file name or create a folder on the server with that as the name so we can keep the files organized. Using PHP to upload file PHP: if(isset($_POST['submit'])){ $target = "upload/"; $file_name = $_FILES['file']['name']; $tmp_dir = $_FILES ['file']['tmp_name']; try{ if(!preg_match('/(jpe?g|psd|ai|eps|zip|rar|tif?f|pdf)$/i', $file_name)) { throw new Exception("Wrong File Type"); exit; } move_uploaded_file($tmp_dir, $target . $file_name); $status = true; } catch (Exception $e) { $fail = true; } } Other PHPw/form: <form enctype="multipart/form-data" action="" method="post"> input type="hidden" name="MAX_FILE_SIZE" value="1073741824" /> label for="file">Choose File to Upload </label> <br />input name="file" type="file" id="file" size="50" maxlength="50" /><br /> input type="submit" name="submit" value="Upload" /> php if(isset($status)) { $yay = "alert-success"; echo "<div class=\"$yay\"> <br/> <h2>Thank You!</h2> <p>File Upload Successful!</p></div>"; } if(isset($fail)) { $boo = "alert-error"; echo "<div class=\"$boo\"> <br/> <h2>Sorry...</h2> <p>There was a problem uploading the file.</p><br/><p>Please make sure that you are trying to upload a file that is less than 50mb and an acceptable file type.</p></div>"; }

    Read the article

  • JSP - Beginner question , Bypass the if..statement on page load?

    - by TatMing
    i am new in JSP,i have some problem with the following code : <%@ page contentType="text/html;charset=Big5" %> <html> <head> <title></title> </head> <body> <form method="post" action="InsertStudent.jsp"> <input type="text" size="20" name="txtName" /> <input type="text" size="20" name="txtDob" /> <input type="text" size="20" name="txtProStudied" /> <input type="submit" name="B1" value="Submit" /> </form> <% if (request.getParameter("txtName") !="" && request.getParameter("txtDob") != "" && request.getParameter("txtProStudied") != "" ) { out.println("...bypass the if....statement"); } %> </body> </html> If run this code, the out.println will fire even the 3 input box have value or not..

    Read the article

  • Namespace Traversal

    - by RikSaunderson
    I am trying to parse the following sample piece of XML: <?xml version="1.0" encoding="UTF-8"?> <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <soapenv:Body> <d2LogicalModel modelBaseVersion="1.0" xmlns="http://datex2.eu/schema/1_0/1_0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://datex2.eu/schema/1_0/1_0 http://datex2.eu/schema/1_0/1_0/DATEXIISchema_1_0_1_0.xsd"> <payloadPublication xsi:type="PredefinedLocationsPublication" lang="en"> <predefinedLocationSet id="GUID-NTCC-VariableMessageSignLocations"> <predefinedLocation id="VMS30082775"> <predefinedLocationName> <value lang="en">VMS M60/9084B</value> </predefinedLocationName> </predefinedLocation> </predefinedLocationSet> </payloadPublication> </d2LogicalModel> </soapenv:Body> </soapenv:Envelope> I specifically need to get at the contents of the top-level predefinedLocation tag. By my calculations, the correct XPath should be /soapenv:Envelope/soapenv:Body/d2LogicalModel/payloadPublication/predefinedLocationSet/predefinedLocation I am using the following C# code to parse the XML: string filename = "content-sample.xml"; XmlDocument xmlDoc = new XmlDocument(); xmlDoc.Load(filename); XmlNamespaceManager nsmanager = new XmlNamespaceManager(xmlDoc.NameTable); nsmanager.AddNamespace("soapenv", "http://schemas.xmlsoap.org/soap/Envelope"); string xpath ="/soapenv:Envelope/soapenv:Body/d2LogicalModel/payloadPublication/predefinedLocationSet/predefinedLocation"; XmlNodeList itemNodes = xmlDoc.SelectNodes(xpath, nsmanager); However, this keeps coming up with no results. Can anyone shed any light on this, because I feel like I'm banging my head on a brick wall.

    Read the article

  • I need some ideas on my algortihm for a Hit Counter

    - by stckvrflw
    My algorithm is for a hit count, I am tring to not count for the same person twice if that person came to the site twice in a time internval (For example if he comes twice in 5 minutes, I want to count it as 1 for this person) Here how my database looks like UserIp UserId Date of user came 127.0.0.1 new.user.akb 26.03.2010 10:15:44 127.0.0.1 new.user.akb 26.03.2010 10:16:44 127.0.0.1 new.user.akb 26.03.2010 10:17:44 127.0.0.1 new.user.akb 26.03.2010 10:18:44 127.0.0.1 new.user.akb 26.03.2010 10:19:44 127.0.0.1 new.user.akb 26.03.2010 10:20:44 127.0.0.1 new.user.akb 26.03.2010 10:21:44 127.0.0.1 new.user.akb 26.03.2010 10:22:44 127.0.0.1 new.user.akb 26.03.2010 10:23:44 What I need to do is get number of distinct UserIPs from the table above that occured within a time interval. For example if I set the time interval for 5 minutes, and let say that is starts at 26.03.2010 10:15:44 Then I will get 2 as the results, since 1 distinct value between 10:15 to 10:20 and , 1 distinct value from 10:20 to 10:23, For example if my interval is 3 minutes than the return result will be 3 Thanks.

    Read the article

  • Enforce link in Team foundation server bug work item for duplicates

    - by Tewr
    We have just started out with Team Foundation Server 2008 / Visual Studio Team System and we are pleased to find how we can export and modify work items to our needs. However, this last thing that would make the setup perfect for us has proved somewhat difficult: We have exported the Bug work item type and have made modifications to it to appear differently to different groups of users. We do, however, see a potential problem in non-developers reporting bugs which turn out to be duplicates. We would like to enforce that users who close a ticket with resolved reason:duplicate also creates a link to the bug which is perceived as the first bug report. I have looked at System.RelatedLinkCount, and put the rule <FIELD type="Integer" name="RelatedLinkCount" refname="System.RelatedLinkCount"> <WHEN field="Microsoft.VSTS.Common.ResolvedReason" value="duplicate"> <PROHIBITEDVALUES> <LISTITEM value="0" /> </PROHIBITEDVALUES> </WHEN> </FIELD> However, when I try to put anything in that scope, the importer tells me that System.RelatedLinkCount does not accept the rule, no matter what I put, but the rule above shows what I am trying to do (even though the most preferable rule would also check that the bug that I link to is not a duplicate as well, though this is overkill :P) Has anyone else tried to enforce rules like this in work items? Is there another approach to solving the same issue? I am thankful for any thoughts on the matter.

    Read the article

  • beautifulsoup can't find exist href in file

    - by young001
    I have a html file like following: <form action="/2811457/follow?gsid=3_5bce9b871484d3af90c89f37" method="post"> <div> <a href="/2811457/follow?page=2&amp;gsid=3_5bce9b871484d3af90c89f37">next_page</a> &nbsp;<input name="mp" type="hidden" value="3" /> <input type="text" name="page" size="2" style='-wap-input-format: "*N"' /> <input type="submit" value="jump" />&nbsp;1/3 </div> </form> how to extract the "1/3" from the file? It is a part of html,I intend to make it clear. When I use beautifulsoup, I'm new to beautifulsoup,and I have look the document,but still confused. how to extract"1/3" from the html file? total_urls_num = soup.find(re.compile('.*/d\//d.*')) doesn't work As JBernardo said,\d should be a number,When I change to .*\d/\d.*,it doesn't work too. my code: from BeautifulSoup import BeautifulSoup import re with open("html.txt","r") as f: response = f.read() print response soup = BeautifulSoup(response) delete_urls = soup.findAll('a', href=re.compile('follow\?page')) #works print delete_urls #total_urls_num = soup.find(re.compile('.*\d/\d.*')) total_urls_num = soup.find('input',style='submit') #can't work print total_urls_num

    Read the article

< Previous Page | 747 748 749 750 751 752 753 754 755 756 757 758  | Next Page >