Search Results

Search found 26214 results on 1049 pages for 'farm solution'.

Page 756/1049 | < Previous Page | 752 753 754 755 756 757 758 759 760 761 762 763  | Next Page >

• Interesting XSL Dilemma

  - by bobber205

  I've got this issue. A template called "checkbox" that's called from while inside a table HTML element and also outside of it. To solve an issue, I've added tags to "checkbox" input control. Here's what I'd like to do to but I'm not sure if it's possible or not. When I hit my "row" (part of the custom table markup) template, I would set some variable or pass some parameter, that for each template applied afterwards, would know it was in a "row" and do something special based on this information. I know I can't add parameters to apply-templates. I may be able to add a row "mode" but I can't make changes to each template and have one copy with the mod parameter and one without. Thanks for any suggestions. I know the ideal solution would to be to make changes to the XML but I'm not sure if I can do that as this point. That's a "content" issue. :P Thanks!

  Read the article

• How do I do pivoting in this query in SQL?

  - by dewacorp.alliances

  Hi there I have this table like this: Name; Amount1, Amount, Rate1, Rate2 Test; 1000; 2000; 1.0; 2.0 I want to display into: Parameter; Amount1; Rate1; Total 'Parameter 1'; 1000; 1.0; 1000 'Parameter 2'; 2000; 2.0; 4000 BTW ... I am using SQL2K5. All I can think of is CURSOR. Any other solution in elegant way? Thanks

  Read the article

• PhotobucketNet photo upload

  - by n1tr0

  I have a problem with PhotobucketNet user login(I need user to login so I can upload a picture from HDD to his Photobucket account). Photobucket photobucket = new Photobucket("myapikey", "myapisecret"); photobucket.LaunchUserLogin(); // the problem happens here photobucket.RequestUserToken(); If I call RequestUserToken() it will happen immediately, so I'll get a crash cause user didn't logged in, and there is no event that's been raised after user logs in. Is there some variable(bool or something else) that I can check to see if user logged in - maybe to put it in a loop with timer? Also is their a way to know if user canceled logging in? I know that timer isn't a good solution, so if anyone has anything better as an idea, I'm open for any suggestions...

  Read the article

• Upload files, form within form

  - by Alexd2

  Hello everyone and thanks in advance. I have a problem and I have 2 form into one another, the domestic form is to perform a file upload. As I can do to make when sending in internal form not run the main form. <form name="x" method="post" action="xxx.php"> .... <form action="" method="post" enctype="multipart/form-data" target="xxx"> <input type="file" /> <input type="submit" /> </form> <iframe id="xxx" src="process.php"> </iframe> .... <input type="submit" name="pro" value="Register user"/ > </form> Doing this does not work, as this within another form. Any help or possible solution.

  Read the article

• Zend Framework: How to handle exceptions in Ajax requests?

  - by understack

  Normally when an exception is thrown, Error controller takes command and displays error page with regular common header and footer. This behavior is not wanted in Ajax request. Because in case of error, whole html page is sent over. And in cases where I'm directly loading the content of http response in a div, this is even more unwanted. Instead in case of Ajax request, I just want to receive 'the actual error' thrown by exception. How can I do this? I think, one dirty way could be: set a var in ajax request and process accordingly. Not a good solution.

  Read the article

• using i18n characters in url of image tag does not display the image

  - by user363171

  I am using the image tag as the path /data/image/image.txt does exists. and it displays the image also. but when i introduce some i18n characters in the path lets say it says 404 error image not found, but the path /data/image??/image.txt does exists, please help me to find the solution for this? I used the firebug also to see whether the characters are decoded properly or not, in firebug I am able to see the correct characters they are not changed, still it is not able to pick the image. thanks a lot in advance. Note: I am using tag because it was not allowing me to write the img tab in the post, and i have changed the jif ext to txt. please consider this.

  Read the article

• INSERT INTO othertbl SELECT * tbl

  - by Harry

  Current situation: INSERT INTO othertbl SELECT * FROM tbl WHERE id = '1' So i want to copy a record from tbl to othertbl. Both tables have an autoincremented unique index. Now the new record should have a new index, rather then the value of the index of the originating record else copying results in a index not unique error. A solution would be to not use the * but since these tables have quite some columns i really think it's getting ugly. So,.. is there a better way to copy a record which results in a new record in othertbl which has a new autoincremented index without having to write out all columns in the query and using a NULL value for the index. -hope it makes sense....-

  Read the article

• jquery integrate form parameter in one object

  - by jesse

  There are many forms in my page. I want to merge them in one object and submit them in one object. But I find serializeArray() or serialize() do not match my request, the serializeArray function will generate a array object and serialize is used by get model, it is not an object. is there a jquery or local function can merge them in one object. I have one solution but it is not perfect, loop the array object generated by serializeArray, use $.extend to merge them in one object. is there a better method? kindly help, thanks.

  Read the article

• Getting Data Specific to Logged in user

  - by user1770470

  I need to list logged in users active leads,and allow paging and selectable sorting, I cant use the grid because of the layout requirement. I have been searching the web for the last 2 days and cant find any viable solution Any help or direction would be greatly appreciated. var query = db.Query("SELECT a.listingId, a.datetime, c.details, c.buycommercial, c.buyindustrial, c.buyretail, c.buyland, c.tencommercial, c.tenindustrial, c.tenretail, c.tenland, c.investor, c.developer, d.companyname, d.firstname, d.lastname, d.tel, d.cell, d.email FROM dbo.tblactivebroker a JOIN dbo.tblActiveListing b ON a.ListingId = b.ListingId JOIN dbo.tblListings c ON b.ListingId = c.ListingId JOIN dbo.tblContact d ON c.crmid = d.id WHERE b.active = 'True' AND a.ActiveBrokerID = @0",brokerid);

  Read the article

• Algorithm for finding all paths in a NxN grid

  - by Periastron

  Imagine a robot sitting on the upper left hand corner of an NxN grid. The robot can only move in two directions: right and down. How many possible paths are there for the robot? I could find solution to this problem on Google, but I am not very clear with the explanations. I am trying to clearly understand the logic on how to solve this and implement in Java. Any help is appreciated. Update: This is an interview question. For now, I am trying to reach the bottom-right end and print the possible paths.

  Read the article

• Magento: Product List Override

  - by Andrea

  Thanks for taking a look at this. I’ve been looking and looking for a solution to what seems like a simple thing to do but nothing yet. Here goes: When you click on "Specialty" in the main menu it goes here: Home /Specialty When you click one of the product images on the home page it goes here: Home /Specialty /Holiday Satin Stocking (Full product description page) I need all products with full product information to end up at Home /Specialty Page set-up would be: Click on Menu item or an image to show like this: |||Product1||| Product Description Add to cart |||Product2||| Product Description Add to cart |||Product3||| Product Description Add to cart I would like to override going "Home /Specialty /Holiday Satin Stocking" all together with listing all the information here: Home /Specialty "Specialty" is set up as an anchor and all products types are simple. Thanks so much!

  Read the article

• Is there a %in% operator accros multiple columns

  - by RobinLovelace

  Imagine you have two data frames df1 <- data.frame(V1 = c(1, 2, 3), v2 = c("a", "b", "c")) df2 <- data.frame(V1 = c(1, 2, 2), v2 = c("b", "b", "c")) Here's what they look like, side by side: > cbind(df1, df2) V1 v2 V1 v2 1 1 a 1 b 2 2 b 2 b 3 3 c 2 c You want to know which observations are duplicates, across all variables. This can be done by pasting the cols together and then using %in%: df1Vec <- apply(df1, 1, paste, collapse= "") df2Vec <- apply(df2, 1, paste, collapse= "") df2Vec %in% df1Vec [1] FALSE TRUE FALSE The second observation is thus the only one in df2 and also in df1. Is there no faster way of generating this output - something like %IN%, which is %in% across multiple variables, or should we just be content with the apply(paste) solution?

  Read the article

• detect a string contained by another discontinuously

  - by SpawnCxy

  Recently I'm working on bad content(such as advertise post) filter of a BBS.And I write a function to detect a string is in another string not continuously.Code as below: $str = 'helloguys'; $substr1 = 'hlu'; $substr2 = 'elf'; function detect($a,$b) //function that detect a in b { $c = ''; for($i=0;$i<=strlen($a);$i++) { for($j=0;$j<=strlen($b);$j++) { if($a[$i] == $b[$j]) { $b=substr($b,$j+1); $c .=$a[$i]; break; } } } if($c == $a) return true; else return false; } var_dump(detect($substr1,$str)); //true var_dump(detect($substr2,$str)); //false Since the filter works before the users do their posts so I think the efficiency here is important.And I wonder if there's any better solution? Thanks!

  Read the article

• iphone - navigation controller - move to first view from last view without traversing all intermedia

  - by satyam

  i'm working on iphone app which will show 4 buttons in first view. on click of a button, it will load a new view with navigation controller. this navigation controller view allows to travel upto 11 sub views. in 11th sub view, i've a reset button. on click of reset button, i've to go back to navigation controllers first view without traversing all the 11 views? is it possible to achieve it? if yes how? if no, what can be the solution?

  Read the article

• Oracle checking existence before deletion in a trigger

  I have analyzed a hibernate generated oracle database and discovered that a delete of a row from a single table will spawn the firing of 1200+ triggers in order to delete the related rows in child tables. The triggers are all auto-generated the same - an automatic delete of a child row without checking for existence first. As it is impossible to predict which child tables will actually have related rows, I think a viable solution to preventing the firing of the cascaded delete down a deeply branched completely empty limb, would be to check for the existence of a related row before attempting to delete. In other dbms', I could simply state " if exists....." before deleting. Is there a comparable way to do this in oracle?

  Read the article

• Fake Mouse (C# or C++)

  - by Hidden

  I need a way to fake that a mouse is connected. The problem: My HTPC (Windows 8) has no mouse connected and I wrote a program to simulate mouse input using my Xbox 360 Controller. This works just fine, the only problem is, that there is no cursor visible (I can move it, but I cant see it). My guess is, that Windows doesn't show a cursor when there is no mouse connected, so I need a way to pretend that a mouse is connected to the PC. Of course, if you know another way to make the cursor visible I would gladly take this solution as well. Regards, Hidden

  Read the article

• PivotControl item changing behavior in Silverlight Windows Phone 7

  - by Rosarch

  I have an app where the user is sent to a page with a PivotControl. The SelectedIndex is not known until the user navigates to the page. I'm setting the SelectedIndex, but it causes the PivotControl to start on index 0, then flip through to the index I set. This is kind of annoying, and I'd rather just have it go directly to the index I set. Is there some way around this? One hack I thought up was providing the data to pivotControl.ItemsSource in an order such that the item I want the user to start on is index 0 in ItemsSource. But that would be kind of messy, and I'm wondering if there's a more elegant solution.

  Read the article

• SQL: Optimize insensive SELECTs on DateTime fields

  - by Fedyashev Nikita

  I have an application for scheduling certain events. And all these events must be reviewed after each scheduled time. So basically we have 3 tables: items(id, name) scheduled_items(id, item_id, execute_at - datetime) - item_id column has an index option. reviewed_items(id, item_id, created_at - datetime) - item_id column has an index option. So core function of the application is "give me any items(which are not yet reviewed) for the actual moment". How can I optimize this solution for speed(because it is very core business feature and not micro optimization)? I suppose that adding index to the datetime fields doesn't make any sense because the cardinality or uniqueness on that fields are very high and index won't give any(?) speed-up. Is it correct? What would you recommend? Should I try no-SQL? -- mysql -V 5.075 I use caching where it makes sence.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Abort early in a fold

  - by Heptic

  What's the best way to terminate a fold early? As a simplified example, imagine I want to sum up the numbers in an Iterable, but if I encounter something I'm not expecting (say an odd number) I might want to terminate. This is a first approximation def sumEvenNumbers(nums: Iterable[Int]): Option[Int] = { nums.foldLeft (Some(0): Option[Int]) { case (None, _) => None case (Some(s), n) if n % 2 == 0 => Some(s + n) case (Some(_), _) => None } } However, this solution is pretty ugly (as in, if I did a .foreach and a return -- it'd be much cleaner and clearer) and worst of all, it traverses the entire iterable even if it encounters a non-even number. So what would be the best way to write a fold like this, that terminates early? Should I just go and write this recursively, or is there a more accepted way?

  Read the article

• How should 4 decimals places behave, being simple yet powerful

  - by vener

  I have a UI question that troubled me on the best method to handle 4 decimal places for prices. In an table already cramped full of data, I would want to simplified the interface to make it not so cluttered. The actual current UI is shown below. http://i41.tinypic.com/bg5tub.jpg The problem is, for a unit price/units/D.Price and Dis.(Discount) to have 4 decimal places ($0.3459) is quite rare but it still happens (5 in 100 entries). This will result a lot of junk decimal places, cluttering up the interface. What is the best solution to this problem? In short, I want to declutter it yet maintain the precision. Note: This is web app

  Read the article

• Event(s) for opening the workbook AND worksheets

  - by KeyMs92

  I'm looking for an elegant solution to trigger an event for opening the workbook as well as opening different worksheets. I don't need seperate operations for each worksheet: they all trigger the same method. I know I can use the events Workbook_Activate / Workbook_Open and Workbook_SheetActivate at the same time but I don't know if this is 'the official way' to do it. Perhaps there's a way to do this with one event. I was also wondering if it is relevant in this matter where I put the code. I now have all the code inside "ThisWorkbook" and not in a "Module"...

  Read the article

• Restricting IFRAME access in PHP

  - by m0j0

  I am creating a small web page using PHP that will be accessed as an IFRAME from a couple of sites. I'm wanting to restrict access to this site to work ONLY within the "approved" sites, and not other sites or accessed directly. Does anyone have any suggestions? Is this even possible? The PHP site will be Apache, and the sites iframing the content will probably be .NET. Just to clarify, any site can view the page, as long as it's iframe'd within an approved site. I want to block people from accessing it directly. I'm thinking cookies might be a solution, but I'm not sure.

  Read the article

• How to arrange labels in a flowlayout manner?

  - by Tim Büthe

  How do I arrange some UILabels and/or UIButtons of a variable length? I just want to add them to a UITableViewCell and they should arrange in a left-to-right flow, much like lines of text in a paragraph. I only found possibilities to create lables with a fixed size and position using "initWithFrame:...". Same seems to be true for Interface Builder, as far as I can tell. Any solution is appreciated no matter if it's done in code or using a custom cell XIB-file.

  Read the article

• While programming, what to do when facing with a seemingly unsolvable situation with a time limit?

  - by Ersan Tasan

  This is not a technical question, but rather a social and methodical one. I am a computer sciences student and I usually have really tough programming assignments. I don`t know if it is only happening to me but sometimes, particularly when deadline is approaching, i find myself in a harsh situation. I cannot find my mistake in the code or come up with a another great idea. Then boredom comes in and the problem begins to seem unsolvable. I know there are more-than-great professional coders here. I would like to learn their ideas to cope with this situation. Is it better to focus on something else for a while and try again or try harder and harder and look for the solution on the net etc...

  Read the article

< Previous Page | 752 753 754 755 756 757 758 759 760 761 762 763  | Next Page >