Search Results

Search found 3060 results on 123 pages for 'sankar cs'.

Page 78/123 | < Previous Page | 74 75 76 77 78 79 80 81 82 83 84 85  | Next Page >

  • CruiseControl.NET, Visual Studio & SubVersion

    - by Ian
    Hi All, I am setting up a Continuous Integration server. I have one issue that doesn't seem to be mentioned in the tutorials. I have a ASP.net Web Application that I need to compile and them publish. My Problem is that I seem to be able to compile the app but when I attempt to use a buildPublisher this copies every thing including .svn files & folders and ms CS files. I am using an MSBuild task to compile my source. I tried setting my MSBuild Output Directory to directory but this didn't seem to have any effect. What am I not understanding? Thanks

    Read the article

  • Do I have partial view/code behind in Flask?

    - by hbrlovehaku
    I'm migrating from C#.NET to Python/Flask. In .NET I have MasterPage, UserControl, PartialView each has its own code behind. e.g. I can save the check login functions in Login.ascx.cs and render the Login.ascx wherever I'd like to. If logged in, it shows the welcome message, else shows the login form. But in Flask I only found {% include 'login.html' %} which include the static html file. How can I implement this design in Flask?

    Read the article

  • How to set ItemsSource?

    - by Mark
    This dialog makes no sense to me And I'm having trouble finding good tutorials on it. Most of the examples aren't detailed enough, or do stuff via code, but I'd like to take advantage of the IDE as much as possible. Whats the difference between ItemsSource and DataContext? I'd like to bind it to just a List for starters. I don't need SQL or databases or anything fancy. Where would I declare my list? In MainWindow.xaml.cs? How do I get it to appear in that dialog?

    Read the article

  • How does the dataset determine the return type of a scalar query?

    - by Tobias Funke
    I am attempting to add a scalar query to a dataset. The query is pretty straight forward, it's just adding up some decimal values in a few columns and returning them. I am 100% confident that only one row and one column is returned, and that it is of decimal type (SQL money type). The problem is that for some reason, the generated method (in the .designer.cs code file) is returning a value of type object, when it should be decimal. What's strange is that there's another scalar query that has the exact same SQL but is returning decimal like it should. How does the dataset designer determine the data type, and how can I tell it to return decimal?

    Read the article

  • Paging with jQuery

    - by zurna
    I get data from another page using jQuery get method. But I have a small problem. Sometimes, data that I take from another page is too long so it's divided into pages. When the user clicks on 1, 2, 3, ... links he/she is redirected to the other page. However, I want data to be reloaded on the same page. Edit $('ul.thumbs li.pagination a').live('click', function() { var pageNumber = parseInt($(this).text().replace(/[^0-9]/g, '')); $.ajax({ type: "GET", url: "images.cs.asp?Process=ViewImages&PAGEID=<%=Request.QueryString("PAGEID")%>", success: function(data) { $("#ViewImages").html(data); }, error: function (XMLHttpRequest, textStatus, errorThrown) { $("#ViewImages").html('.'); } }); return false; });

    Read the article

  • C++ Vector of pointers

    - by xbonez
    For my latest CS homework, I am required to create a class called Movie which holds title, director, year, rating, actors etc. Then, I am required to read a file which contains a list of this info and store it in a vector of pointers to Movies. I am not sure what the last line means. Does it mean, I read the file, create multiple Movie objects. Then make a vector of pointers where each element (pointer) points to one of those Movie objects? Do I just make two vectors - one of pointers and one of Movies and make a one-to-one mapping of the two vectors?

    Read the article

  • from JS to iphone dev - what's the best language to start with?

    - by Enkai
    I am a total beginner and would like to eventually learn to develop for the iphone. I have just done a beginner's CS course where the language we learned was JavaScript. We studied basic concepts like: variables, arrays, loops (for,while,if,if..else..), properties and functions. I'm wondering if I am starting in the right/wrong place by following this book: Learn C on the Mac by Dave Mark? I have read a few chapters and am finding it a bit hard to get my head around the way that C works, for example the way that Strings are printed seems overly complicated as compared to JS. Do you think that JS was the wrong language to start off with and would I be better to go from JS straight to Objective-C rather than to C? I have tried to read up on previous threads on the merits/demerits of learning C first but haven't found any that relate JS to learning C/Obj C/ Cocoa. Any advice appreciated as I am very new to this. Thanks

    Read the article

  • Passing derived objects in a constructure

    - by Clarence Klopfstein
    This is a bit of a convoluted question, hopefully I can make it clear. I am finding that this may not be possible, but am trying to see if anybody has a solution. I have four classes, two are core classes and two are those core classes extended: extUser Extends coreUser extSecurity Extends coreSecurity In the constructor for coreUser you have this: public coreUser(string id, ref coreSecurity cs) When trying to extend coreUser you would have this: public extUser(string id ref extSecurity es) : base(id, ref es) This fails because es is of type, extSecurity and the base class expects a type of coreSecurity. I've not found anyway to cast this to allow for me to override this base class in C#. In VB it works just fine. Ideas?

    Read the article

  • Reason for different segments in Linux on x86

    - by anjruu
    Hey all, So, I know that Linux uses four default segments for an x86 processor (kernel code, kernel data, user code, user data), but they all have the same base and limit (0x00000000 and 0xfffff), meaning each segment maps to the same set of linear addresses. Given this, why even have user/kernel segments? I understand why there should be separate segments for code and data (just due to how the x86 processor deals with the cs and ds registers), but why not have a single code segment and a single data segment? Memory protection is done through paging, and the user and kernel segments map to the same linear addresses anyway. Thanks! anjruu

    Read the article

  • How to port C# code which uses a callback to VB.NET?

    - by Bob
    I need to port the following from the ASP.NET MVC 2 sourcecode from C# to VB.NET. It's from AuthorizeAttribute.cs beginning on line 86: HttpCachePolicyBase cachePolicy = filterContext.HttpContext.Response.Cache; cachePolicy.SetProxyMaxAge(new TimeSpan(0)); cachePolicy.AddValidationCallback(CacheValidateHandler, null /* data */); where CacheValidateHandler is: private void CacheValidateHandler(HttpContext context, object data, ref HttpValidationStatus validationStatus) { validationStatus = OnCacheAuthorization(new HttpContextWrapper(context)); } The VB.NET port from http://converter.telerik.com doesn't quite work for this line: cachePolicy.AddValidationCallback(CacheValidateHandler, Nothing) ' Error where CacheValidateHandler is: Private Sub CacheValidateHandler(ByVal context As HttpContext, ByVal data As Object, _ ByRef validationStatus As HttpValidationStatus) validationStatus = OnCacheAuthorization(New HttpContextWrapper(context)) End Sub VS2008 complains that CacheValidateHandler does not specify its arguments for context, data, and validationStatus. Any ideas how to port this code?

    Read the article

  • Creating a relative path to a Database in Asp.net for a library

    - by Greener
    In school I am part of a team of four working to create a GUI to translate the paper records of a made-up company and their functionality to a digital format. We're using an ASP.NET website for this purpose. Basically we use stored procedures and C# classes to represent the database. The folder we're using for the project contains the site and the libraries in separate folders. If I try to open the site from the folder containing both these elements the site will not run. I want to know if there is some way I can set up a relative path to the database in the Settings.Settings.cs file (or by some other means) of my libraries so I don't have to constantly change the database location for the connection string value every time we move the project. I suppose I should also mention that the database is in an App_Data folder.

    Read the article

  • Firing events in script task

    - by Anonymouslemming
    I've got an SSIS project where I am constructing an SQL command based on some variables. I'm constructing the command in a script task, and want to output the constructed SQL to the 'Execution Results' window. I am trying to do this using a FireInformation line from inside my script as follows: Dts.Events.FireInformation(99, "test", "Make this event appear!", "", 0, true); However, in the script editor when editing ScriptMain.cs, that line is underlined in red, and on mouseover, I get the following message: Error: The best overloaded method match for 'Microsoft.SqlServer.Dts.Tasks.ScriptTask.EventsObjectWrapper.FireInformation(int, string, string, string, int, ref bool') has some invalid arguments As a result, my script does not compile and I cannot execute it. Any idea what I'm doing wrong here, or what I need to change to be able to see the values of my variables at this point in the Execution output?

    Read the article

  • OnClientClick event for keeping track of prints?

    - by Ram
    Hello, I am trying to keep track of prints that are made for a page. The page has Print this page link. And the code for it is like below: This is written in .cs file as there are many conditions for displaying this. And i am appending here using String Builder. sbOutput.AppendFormat("<td align=\"right\" valign=\"bottom\"><div style =\"float:right;text-align:right; valign:bottom;width:200px\"class=\"print_button notPrinted\"><a class=\"notPrinted\" href=\"#\" onclick=\"window.print();\">PRINT THIS COUPON </a><img src=\"images/print-icon-34x34.gif\" class=\"notPrinted\" align=\"absmiddle\" /></div> </td></tr></table>", couponid, Userid, locationid); Do i have to use onclientclick or something else?? Thanks so much in advance.

    Read the article

  • Visual Studio swapping code between projects?!?!?!?!??!

    - by Tom
    Are there any known issues with visual studio and code being swapped between projects? I had a project running in VS2008 and when i went back to it, the code from another project had been swapped in the Program.cs class. I havent made any mistakes, im not talking about some code- i mean the whole project had been swapped out. Its as if the .proj files or .soln files had been swapped from their project folders??? EDIT Ive restarted laptop, opened the code again and its still showing the wrong code BUT when i execute it, its the right code?!?!?!

    Read the article

  • Text property in a UserControl in C#

    - by yeyeyerman
    I have a control with a inner TextBox. I want to make a direct relationship between the Text property of the UserControl and the Text property of the TextBox. The first thing I realized is that Text was not being displayed in the Properties of the UserControl. Then I added the Browsable(true) attribute. [Browsable(true)] public override string Text { get { return m_textBox.Text; } set { m_textBox.Text = value; } } Now, the text will be shown for a while, but then is deleted. This is because the information is not written within the xxxx.Designer.cs. How can this behviour be changed?

    Read the article

  • How does the dataset designer determine the return type of a scalar query?

    - by Tobias Funke
    I am attempting to add a scalar query to a dataset. The query is pretty straight forward, it's just adding up some decimal values in a few columns and returning them. I am 100% confident that only one row and one column is returned, and that it is of decimal type (SQL money type). The problem is that for some reason, the generated method (in the .designer.cs code file) is returning a value of type object, when it should be decimal. What's strange is that there's another scalar query that has the exact same SQL but is returning decimal like it should. How does the dataset designer determine the data type, and how can I tell it to return decimal?

    Read the article

  • Clear the form once form submitted

    - by zurna
    Once the form submitted, response from another page is printed to #GameStorySys. But values entered to the form still stays there. Is it possible for the form values to disappear (but the form should still stay) once the form submitted? $("[name='GameStoryForm']").click(function() { $.ajax({ type: "POST", data: $("#GameStoryForm").serialize(), url: "content/commentary/index.cs.asp?Process=EditLiveCommentaryStory&CommentaryID=<%=Request.QueryString("CommentaryID")%>", success: function(output) { $('#GameStorySys').html(output); }, error: function(output) { $('#GameStorySys').html(output); } }); });

    Read the article

  • Is there any Application Server Frameworks for other languages/platforms than JavaEE and .NET?

    - by Jonas
    I'm a CS student and has rare experience from the enterprise software industry. When I'm reading about enterprise software platforms, I mostly read about these two: Java Enterprise Edition, JavaEE .NET and Windows Communication Foundation By "enterprise software platforms" I mean frameworks and application servers with support for the same characteristics as J2EE and WCF has: [JavaEE] provide functionality to deploy fault-tolerant, distributed, multi-tier Java software, based largely on modular components running on an application server. WCF is designed in accordance with service oriented architecture principles to support distributed computing where services are consumed by consumers. Clients can consume multiple services and services can be consumed by multiple clients. Services are loosely coupled to each other. Is there any alternatives to these two "enterprise software platforms"? Isn't any other programming languages used in a bigger rate for this problem area? I.e Why isn't there any popular application servers for C++/Qt?

    Read the article

  • How is the implicit segment register of a near pointer determined?

    - by Daniel Trebbien
    In section 4.3 of Intel 64® and IA-32 Architectures Software Developer's Manual. Volume 1: Basic Architecture, it says: A near pointer is a 32-bit offset ... within a segment. Near pointers are used for all memory references in a flat memory model or for references in a segmented model where the identity of the segment being accessed is implied. This leads me to wondering: how is the implied segment register determined? I know that (%eip) and displaced (%eip) (e.g. -4(%eip)) addresses use %cs by default, and that (%esp) and displaced (%esp) addresses use %ss, but what about (%eax), (%edx), (%edi), (%ebp) etc., and can the implicit segment register depend also on the instruction that the memory address operand appears in?

    Read the article

  • avoid caching of page in browser

    - by Shan
    I am using an iframe to show the child pages.In that one one particular page contains hidden div and i am showing it as a pop-up like thing with javascript by changing the visibility of the hidden div. Problem is before showing the hidden div , some manipulations are done at server level and I am calling the div from C# code after the manipulations like Page.ClientScript.RegisterStartupScript(GetType(), "MyKey", "javascript:OpenModelPopup('cb','cs');", true); so the page is getting posted back and the div is shown. after this, after going to next page if i click browser back it shows that page with that hidden div and on next click of browser back gives the page without hidden div. but I want to show only the initial stage of the page ie. without showing the hidden div that stage with hidden div should not be cached or it should not be shown on click of browser back.

    Read the article

  • Example applications and benefits of using "C" , "C++" or "Java"

    - by Waltzy
    Ok, I'm revising for my upcoming year 2 exams on a CS course and its likely something like this will come up. my question is what is an ideal application that would especially benefit from the program features of each of the three languages? I have a vague idea but getting a second opinion could really help. JavaPortability, easy - good for GUIs. C++Fast but may requite significant changes in order to be moved from system to system, good for image processing. CI'm unsure here small embedded applications? Some clarification on this would be really appreciated, thanks again StackOverflow

    Read the article

  • Programmatically Setting the Version of a Window's Service on the ProjectInstaller

    - by user302004
    I have a Windows Service created in Visual Studio 2005 in C#. I have a setup project and a ProjectInstaller class. I also have code to programmatically get the version from the AssemblyFileVersionAttribute. I need to figure out where I set the version that I've obtained (and where this code should go). I tried placing it in the InitializeComponent method on ProjectInstaller.Designer.cs and then appending the version to serviceInstaller1.DisplayName and serviceInstaller1.ServiceName. This didn't work and you're not supposed to modify the contents of this method. Any ideas?

    Read the article

  • C++ Questions about vectors

    - by xbonez
    Hey guys, I have a CS exam tomorrow. Just want to get a few questions cleared up. Thanks a lot, and I really appreciate the help. Que 1. What are parallel vectors? Vectors of the same length that contain data that is meant to be processed together Vectors that are all of the same data type Vectors that are of the same length Any vector of data type parallel Que 2. Arrays are faster and more efficient than vectors. True False Que 3. Arrays can be a return type of a function call. True False Que 4. Vectors can be a return type of a function call. True False

    Read the article

  • issue with c# xml documentation

    - by galford13x
    I have the following comment. /// <summary> /// MSDN Time Format compatible with <see cref="DateTime.ParseExact(string, string, IFormatProvider)"/> /// </summary> /// <returns>MSDN Time Format compatible with <see cref="DateTime.ParseExact(string, string, IFormatProvider)"/></returns> but I'm not sure why I receive the following warning Warning 7 XML comment on 'MSLab.DateTime.SystemTimeProvider.GetTimeFormat()' has cref attribute 'DateTime.ParseExact(string, string, IFormatProvider)' that could not be resolved F:\My Documents\Visual Studio 2010\Projects\MSLab\trunk\MSLab\MSLab\DateTime\SystemTimeProvider.cs 110 57 MSLab

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

< Previous Page | 74 75 76 77 78 79 80 81 82 83 84 85  | Next Page >