Search Results

Search found 10383 results on 416 pages for 'exact match'.

Page 79/416 | < Previous Page | 75 76 77 78 79 80 81 82 83 84 85 86  | Next Page >

• Query with multiple IN-statements but without the cartesian product

  - by Janne

  How could I make this kind of query e.g. in MySQL SELECT * FROM Table t WHERE t.a IN (1,2,3) AND t.b IN (4,5,6) AND t.c IN (7,8,9) ... so that the result would contain only the three rows: t.a|t.b|t.c ---+---+--- 1 | 4 | 7 2 | 5 | 8 3 | 6 | 9 The above query of course returns all the combinations of the values in the IN clauses but I would like to get just the ones where the first elements of each tuple match, second elements of each tuple match and so on. Is there any efficient way to do this? By the way is there some common term for this kind of query or concept? I'm having hard time coming up with the question's title because I can't put this into words..

  Read the article

• Java: How do I get the IP of the local interface that can reach a remote IP?

  - by Per Fagrell

  I have a Java application that registers a server component in a service provider, and then sends the service name to a client. The client uses the service name to get an address out of the service provider to the server. However, the server has several interfaces only 1 of which the client get get at, so the service must be registered with the right IP. We discovered the client through a broadcast, so I have the client IP and an Enumeration of the computers network interfaces. How do I match the IP to an interface, not knowing what the netmask of the client IP is? Spontaneously I imagine turning all the addresses to ints and chomping the local ips with their netmask and looking for a 'best match', but I wonder if there is a better way? (this is an enterprise(tm) solution, so cutting out the service provider isn't an option, at least not w/o a political campaign first ;) )

  Read the article

• How can I implement a tail-recursive list append?

  - by martingw

  A simple append function like this (in F#): let rec app s t = match s with | [] -> t | (x::ss) -> x :: (app ss t) will crash when s becomes big, since the function is not tail recursive. I noticed that F#'s standard append function does not crash with big lists, so it must be implemented differently. So I wondered: How does a tail recursive definition of append look like? I came up with something like this: let rec comb s t = match s with | [] -> t | (x::ss) -> comb ss (x::t) let app2 s t = comb (List.rev s) t which works, but looks rather odd. Is there a more elegant definition?

  Read the article

• in_array() - help on what specifically would return true

  - by Kerri

  I am using in_array, and I'm trying to use it in a way where it will only return true if it's an exact match of one of the objects in the array, not just if it's "in" the array. e.g. 1. $sample_array = array('123', '234', '345'); 2. $sample_array = array('23', '34', '45'); in_array('23', $sample_array); In the above example, I would only want version 2 to return true, because it has the exact string, '23'. Version 1 returns true as well though, because the array contains instances of the string '23'. How would I get this to work so that only version 2 returns true? Am I even using the right function?

  Read the article

• perl negative look behind with groupings

  - by user1539348

  I have a problem trying to get a certain match to work with negative look behind example @list = qw( apple banana cherry); $comb_tlist = join ("|", @tlist); $string1 = "include $(dir)/apple"; $string2 = "#include $(dir)/apple"; if( string1 =~ /^(?<!#).*($comb_tlist)/) #matching regex I tried, works The array holds a set of variables that is matched against the string. I need the regex to match $string1, but not $string2. It matches $string1, but it ALSO matches $string2. Can anyone tell me what I am attempting wrong here. Thanks!

  Read the article

• Regular expression question

  - by llm

  Please help me construct a regex to match: some text(x,x,x,x) where x can be any integer either positive or negative.

  Read the article

• What is the REGEX of a CSS selector

  - by user421563

  I'd like to parce a CSS file and add before every CSS selector another selector. From: p{margin:0 0 10px;} .lead{margin-bottom:20px;font-size:21px;font-weight:200;line-height:30px;} I'd like: .mySelector p{margin:0 0 10px;} .mySelector .lead{margin-bottom:20px;font-size:21px;font-weight:200;line-height:30px;} But my CSS file is really complex (in fact it is the bootstrap css file) so the regex should match all CSS selectors. For now I have this regex: ([^\r\n,{};]+)(,|{) and you can see the result here http://regexr.com?328ps but as you can see there are a lot of matches that shouldn't match for example: text-shadow:0 -1px 0 rgba(0, matchs positive but it shouldn't Does someone have a solution ? THX

  Read the article

• Will the next iPhone Simulator be able to simulate the high resolution of iPhone 4?

  - by dontWatchMyProfile

  As a follow-up to this question, the next one is: Will we be able to simulate our interfaces how they look on the new high resolution display, even without owning an iPhone 4? I guess that there is a formula that we can use to calculate the exact needed distance between our monitors and our eyes, to achieve the exact same visual effect of the Retina Display. This would help a lot to get things right. The first thing we need is an high resolution iPhone Simulator. I can't get any sleep until I know.

  Read the article

• Reverse Search Best Practices?

  - by edub

  I'm making an app that has a need for reverse searches. By this, I mean that users of the app will enter search parameters and save them; then, when any new objects get entered onto the system, if they match the existing search parameters that a user has saved, a notification will be sent, etc. I am having a hard time finding solutions for this type of problem. I am using Django and thinking of building the searches and pickling them using Q objects as outlined here: http://www.djangozen.com/blog/the-power-of-q The way I see it, when a new object is entered into the database, I will have to load every single saved query from the db and somehow run it against this one new object to see if it would match that search query... This doesn't seem ideal - has anyone tackled such a problem before?

  Read the article

• meaning of (\/?) in regex / is (\w+)([^>]*?) a redundancy?

  - by thomas

  this regular expression should match an html start tag, I think. var results = html.match(/<(\/?)(\w+)([^>]*?)>/); I see it should first capture the <, but then I am confused what this capture (\/?) accomplishes. Am I correct in reasoning that the ([^>]*?)> searches for every character except > = 0 times? If so, why is the (\w+) capture necessary? Doesn't it fall within the purview of [^>]*?

  Read the article

• Is there a way to pass a regex capture to a block in Ruby?

  - by Gordon Fontenot

  I have a hash with a regex for the key and a block for the value. Something like the following: { 'test (.+?)' => { puts $1 } } Not exactly like that, obviously, since the block is being stored as a Proc, but that's the idea. I then have a regex match later on that looks a lot like this hash.each do |pattern, action| if /#{pattern}/i.match(string) action.call end end The idea was to store the block away in the hash to make it a bit easier for me to expand upon in the future, but now the regex capture doesn't get passed to the block. Is there a way to do this cleanly that would support any number of captures I put in the regex (as in, some regex patterns may have 1 capture, others may have 3)?

  Read the article

• Best way to search a point across several polygons

  - by user1474341

  I have a requirement whereby I need to match a given point (lat,lon) against several polygons to decide if there is a match. The easiest way would be to iterative over each polygon and apply the point-in-polygon check algorithm, but that is prohibitively expensive. The next optimization that I did was to define a bounding rectangle for each polygon (upper bound, lower bound) and iteratively check the point against the bounding box (fewer comparisons as against checking all the points in the polygon). Is there any other optimization possible? Would a spatial index on the bound rectangle points or a geohash help ? Any guidance would be greatly appreciated. Thanks!

  Read the article

• Substitute all matches with values in Ruby regular expression

  - by Lewisham

  Hi all, I'm having a problem with getting a Ruby string substitution going. I'm writing a preprocessor for a limited language that I'm using, that doesn't natively support arrays, so I'm hacking in my own. I have a line: x[0] = x[1] & x[1] = x[2] I want to replace each instance with a reformatted version: x__0 = x__1 & x__1 = x__2 The line may include square brackets elsewhere. I've got a regex that will match the array use: array_usage = /(\w+)\[(\d+)\]/ but I can't figure out the Ruby construct to replace each instance one by one. I can't use .gsub() because that will match every instance on the line, and replace every array declaration with whatever the first one was. .scan() complains that the string is being modified if you try and use scan with a .sub()! inside a block. Any ideas would be appreciated!

  Read the article

• extracting string occurrence in c

  - by David78

  I have a string from a text file that look something like this: long_str = "returns between paragraphs 20102/34.23" - 9203 1232 "test" "basic HTML" Note: Quotes are part of the string. int match(char *long_str){ char * str; if ((str = strchr(long_str, '"')) != NULL) str++; // last " ? else return 1; return 0; } Using strstr I'm trying to get the whole substring between the last two quotes: "basic HTML". I'm just not quite sure what would be a good and efficient way of getting that match. I'm open to any other ideas on how to approach this. Thanks

  Read the article

• difference between form id and form name used in html.

  - by ebrish mateta

  i want to know the exact difference between form id and form name used in html.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Unable to replace & with &amp; in XML uses Preg_replace in PHP

  - by Raind

  Hi, Need help here. Am not able to replace the '&' with '&' uses Preg_replace in PhP. But, if i do it manually (edited) on the xml file, it works out fine. Here are the sample: $XMLCharactersPreg = "/[&<\"\'()^*@+]/"; $XMLPregReplace = "&"; $d_Description = "50% offer & 20% further reduction for member"; if (preg_match($XMLCharactersPreg, $d_Description)) { echo "A match was found."; $XMLDealDescription = preg_replace($XMLCharactersPreg , $XMLPregReplace, $d_Description); echo "$XMLDealDescription "; } else { echo "A match was not found."; } Thanks.

  Read the article

• VS2010 (older) installer project - two or more objects have the same target location.

  - by Hamish Grubijan

  This installer project was created back in 2004 and upgraded ever since. There are two offending dll files, which produce a total of 4 errors. I have searched online for this warning message and did not find a permanent fix (I did manage to make it go away once until I have done something like a clean, or built in Release, and then in Debug). I also tried cleaning, and then refreshing the dependencies. The duplicated entries are still in there. I also did not find a good explanation for what this error means. Additional warnings are of this nature: Warning 36 The version of the .NET Framework launch condition '.NET Framework 4' does not match the selected .NET Framework bootstrapper package. Update the .NET Framework launch condition to match the version of the .NET Framework selected in the Prerequisites Dialog Box. So, where is this prerequisites box? I want to make both things agree on .Net 4.0, just having a hard time locating both of them.

  Read the article

• Where is the 'indeterminate type'?

  - by Daniel

  I'm defining the following type extension: type System.Reflection.MemberInfo with member x.GetAttribute<'T when 'T :> Attribute>(required, inherit') = match required, Attribute.GetCustomAttribute(x, typeof<'T>, inherit') with | true, null -> invalidOp (sprintf "Missing required attribute: %s" typeof<'T>.FullName) | _, attr -> attr :> 'T The last match expression (attr :> 'T) gives the error: The static coercion from Attribute to 'T involves an indeterminate type based on information prior to this program point. Static coercions are not allowed on some types. Further type annotations are needed. I've tried annotating the function return type, but got the same result. I would hate to change this to a dynamic cast. Is there a way to make the static cast work?

  Read the article

• Rails Routes Mappings

  - by rdasxy

  I'm a rails newbie, and I have a controller called resource_links that I've mapped to resources: resources :resources, :as => :resource_links, :controller => :resource_links And this works (basically /resources works as /resource_links). However, trying to go to /resources/tags does not work. To get around this, I added more mappings as: match 'resource_links/tag/:tag(.:format)' => 'resource_links#tag', :via => :get, :as => 'resource_links_tagged', :constraints => {:tag => /.*/} match 'resource_links/tags' => 'resource_links#tags', :via => :get, :as => 'resource_links_tags' Is there any way I can get /resources/tags to be mapped to /resource_links/tag?

  Read the article

• Normalizing Strings using Regexes

  - by RasputinJones

  How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

  Read the article

• Strange SQL problem selecting multiple values for same column

  - by Nubber

  Hello there, Been at this for a few hours now and I can't make any sense of it. I've used this way of selecting multiple values for same column a few times, but there is something weird with this one. SELECT * FROM employee as s INNER JOIN works AS w1 ON w1.name = s.name INNER JOIN employee AS w2 ON w2.name = s.name INNER JOIN employee AS w3 ON w3.name = s.name WHERE w2.city = 'Washington' Basically what I want to do is find all companies which have people in all the cities. The company name is under 'works'. The problem is however that if I have the WHERE w2.city='Washington' it will make ALL the cities match Washington when it should only touch w2 and leave w3 alone so I could match it with another value. Anyone know why its doing this? Or know a better way to do it. Thank you very much in advance.

  Read the article

• C# matching two text files, case sensitive issue

  - by Mike

  What i have is two files, sourcecolumns.txt and destcolumns.txt. What i need to do is compare source to dest and if the text doesnt match write out to a new file. The code below works except i have case sensitive issues like this: CPI Cpi These say they dont match because of captial letters, any help is always thanked! string[] sourcelinestotal = File.ReadAllLines(@"C:\testdirectory\" + "sourcecolumns.txt"); string[] destlinestotal = File.ReadAllLines(@"C:\testdirectory\" + "destcolumns.txt"); foreach (string sline in sourcelinestotal) { if(destlinestotal.Contains(sline)) { } else { File.AppendAllText(@"C:\testdirectory\" + "missingcolumns.txt", sline); } }

  Read the article

• Prototype setStyle not working in IE6.

  - by Smickie

  Hi, I'm using prototype and setStyle in IE6 is just messing everything up. It's throwing a big error. I've Googled it but cant find a solution. I've identified the line in prototype with the IE script debugger, it's the final else block: setStyle: function(element, styles) { element = $(element); var elementStyle = element.style, match; if (Object.isString(styles)) { element.style.cssText += ';' + styles; return styles.include('opacity') ? element.setOpacity(styles.match(/opacity:\s*(\d?\.?\d*)/)[1]) : element; } for (var property in styles) if (property == 'opacity') element.setOpacity(styles[property]); else elementStyle[(property == 'float' || property == 'cssFloat') ? (Object.isUndefined(elementStyle.styleFloat) ? 'cssFloat' : 'styleFloat') : property] = styles[property]; return element; }, Anyone had this problem? P.S. normally I would use jQuery however this is someone else code I've had to update.

  Read the article

• SQL Server FTS: possible to get information how/why rows were matched?

  - by jimmy_keen

  Is it possible to get the information why/how given row returned by FTS query was matched (or which substring caused row to match)? For example, consider simpliest table with id and text columns, with FTS index on the later one. SELECT * FROM Example WHERE CONTAINS(text, 'FORMSOF(INFLECTIONAL, jump)'); This examplary query could return, say row {1, 'Jumping Jack'}. Now, is it possible to somehow get information that this very row was matched because of 'Jumping' word? It doesn't even have to be exact information, more of a which substring caused row to match. Why I'm asking - I got C# app that builds up those queries basing on user input (keywords to search for), and I need the very basic information why/how row was matched back, to use further in C# code. If it's not possible, any alternatives?

  Read the article

< Previous Page | 75 76 77 78 79 80 81 82 83 84 85 86  | Next Page >