Search Results

Search found 216 results on 9 pages for 'remainder'.

Page 8/9 | < Previous Page | 4 5 6 7 8 9  | Next Page >

  • mootools fx working except in ie9

    - by Craig
    This is my first attempt with Mootools, so I welcome a critique of the code. I have a dynamic list of images that expand on the 'click" event and contract on the 'mouseout' event. The code works fine in all browsers (FF, Safari, Chrome, even the smartphones) but not in IE9 (JS is enabled) Anyone with similar problem or solution? I plan to use a lightbox effect, downloading a larger & clearer image to the center of the page, instead of just resizing a small image. However, I am hesitant to attempt this, if there is problems with IE9. I have coded three image sizes with the upload commit, so the larger image is available for the lightbox, but, I don't see anything in mootools for a lightbox, or am I missing it? $i = 0; while($i < count($validate)) { <div class="validate"> <div class="validate_image_<?php echo $validate[$i]['validate_type']; ?>"> <div class="validate_image" id="validate_image_wrapper_<?php echo $i; ?>"> <?php if ($validate[$i]['validate_image_filename'] != '') { if (file_exists(UPLOAD_DIR . 'validate_image/' . str_replace('.', '_medium.', $validate[$i]['validate_image_filename']))) { echo '<img src="' . UPLOAD_URL . 'validate_image/' . str_replace('.', '_medium.', $validate[$i]['validate_image_filename']) . '" alt="Listing Image" />'; } else { echo '<img src="' . UPLOAD_URL . 'validate_image/' . str_replace('.', '_large.', $validate[$i]['validate_image_filename']) . '" alt="Listing image" />'; } } else { ?> <img src="/images/no_image_posted_validate.png" alt="no image posted" /> <?php } ?> </div> ... remainder of HTML display code function setupEnlargeImage() { window.myFx = new Fx({ duration: 200, transition: Fx.Transitions.Sine.easeOut }); $$('.validate_image').addEvent('click', function() { window.selectedImage = this.id; myFx.start(1,2.0); }); $$('.validate_image').addEvent('mouseout', function() { window.selectedImage = this.id; myFx.start(1.0,1); }); myFx.set = function(value) { var style = "scale(" + (value) + ")"; $(window.selectedImage).setStyles({ "-webkit-transform": style, "-moz-transform": style, "-o-transform": style, "-ms-transform": style, transform: style }); } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • PHP Based session variable not retaining value. Works on localhost, but not on server.

    - by Foo
    I've been trying to debug this problem for many hours, but to no avail. I've been using PHP for many years, and got back into it after long hiatus, so I'm still a bit rusty. Anyways, my $_SESSION vars are not retaining their value for some reason that I can't figure out. The site worked on localhost perfectly, but uploading it to the server seemed to break it. First thing I checked was the PHP.ini server settings. Everything seems fine. In fact, my login system is session based and it works perfectly. So now that I know $_SESSIONS are working properly and retaining their value for my login, I'm presuming the server is setup and the problem is in my script. Here's a stripped version of the code that's causing a problem. $type, $order and $style are not being retained after they are set via a GET variable. The user clicks a link, which sets a variable via GET, and this variable is retained for the remainder of their session. Is there some problem with my logic that I'm not seeing? <?php require_once('includes/top.php'); //first line includes a call to session_start(); require_once('includes/db.php'); $type = filter_input(INPUT_GET, 't', FILTER_VALIDATE_INT); $order = filter_input(INPUT_GET, 'o', FILTER_VALIDATE_INT); $style = filter_input(INPUT_GET, 's', FILTER_VALIDATE_INT); /* According to documentation, filter_input returns a NULL when variables are undefined. So, if t, o, or s are not set via URL, $type, $order and $style will be NULL. */ print_r($_SESSION); /* All other sessions, such as the login session, etc. are displayed here. After the sessions are set below, they are displayed up here to... simply with no value. This leads me to believe the problem is with the code below, perhaps? */ // If $type is not null (meaning it WAS set via the get method above) // or it's false because the validation failed for some reason, // then set the session to the $type. I removed the false check for simplicity. // This code is being successfully executed, and the data is being stored... if(!is_null($type)) { $_SESSION['type'] = $type; } if(!is_null($order)) { $_SESSION['order'] = $order; } if(!is_null($style)) { $_SESSION['style'] = $style; } $smarty->display($template); ?> If anyone can point me in the right direction, I'd greatly appreciate it. Thanks.

    Read the article

  • Network Restructure Method for Double-NAT network

    - by Adrian
    Due to a series of poor network design decisions (mostly) made many years ago in order to save a few bucks here and there, I have a network that is decidedly sub-optimally architected. I'm looking for suggestions to improve this less-than-pleasant situation. We're a non-profit with a Linux-based IT department and a limited budget. (Note: None of the Windows equipment we have runs does anything that talks to the Internet nor do we have any Windows admins on staff.) Key points: We have a main office and about 12 remote sites that essentially double NAT their subnets with physically-segregated switches. (No VLANing and limited ability to do so with current switches) These locations have a "DMZ" subnet that are NAT'd on an identically assigned 10.0.0/24 subnet at each site. These subnets cannot talk to DMZs at any other location because we don't route them anywhere except between server and adjacent "firewall". Some of these locations have multiple ISP connections (T1, Cable, and/or DSLs) that we manually route using IP Tools in Linux. These firewalls all run on the (10.0.0/24) network and are mostly "pro-sumer" grade firewalls (Linksys, Netgear, etc.) or ISP-provided DSL modems. Connecting these firewalls (via simple unmanaged switches) is one or more servers that must be publically-accessible. Connected to the main office's 10.0.0/24 subnet are servers for email, tele-commuter VPN, remote office VPN server, primary router to the internal 192.168/24 subnets. These have to be access from specific ISP connections based on traffic type and connection source. All our routing is done manually or with OpenVPN route statements Inter-office traffic goes through the OpenVPN service in the main 'Router' server which has it's own NAT'ing involved. Remote sites only have one server installed at each site and cannot afford multiple servers due to budget constraints. These servers are all LTSP servers several 5-20 terminals. The 192.168.2/24 and 192.168.3/24 subnets are mostly but NOT entirely on Cisco 2960 switches that can do VLAN. The remainder are DLink DGS-1248 switches that I am not sure I trust well enough to use with VLANs. There is also some remaining internal concern about VLANs since only the senior networking staff person understands how it works. All regular internet traffic goes through the CentOS 5 router server which in turns NATs the 192.168/24 subnets to the 10.0.0.0/24 subnets according to the manually-configured routing rules that we use to point outbound traffic to the proper internet connection based on '-host' routing statements. I want to simplify this and ready All Of The Things for ESXi virtualization, including these public-facing services. Is there a no- or low-cost solution that would get rid of the Double-NAT and restore a little sanity to this mess so that my future replacement doesn't hunt me down? Basic Diagram for the main office: These are my goals: Public-facing Servers with interfaces on that middle 10.0.0/24 network to be moved in to 192.168.2/24 subnet on ESXi servers. Get rid of the double NAT and get our entire network on one single subnet. My understanding is that this is something we'll need to do under IPv6 anyway, but I think this mess is standing in the way.

    Read the article

  • smartctl -t long isn't finishing

    - by xenoterracide
    I been running smartctl -t long on a drive for about 2 days now and it seems to be stalled at 10%. short and conveyance both passed. I have to send 1 of 2 drives purchased back I found badblocks with badblocks (none on this drive and I'ts made over a pass already). I'm just wondering if I should be concerned about this. smartctl 5.39.1 2010-01-28 r3054 [x86_64-unknown-linux-gnu] (local build) Copyright (C) 2002-10 by Bruce Allen, http://smartmontools.sourceforge.net === START OF INFORMATION SECTION === Device Model: WDC WD10EARS-00Y5B1 Serial Number: WD-WMAV51582123 Firmware Version: 80.00A80 User Capacity: 1,000,204,886,016 bytes Device is: Not in smartctl database [for details use: -P showall] ATA Version is: 8 ATA Standard is: Exact ATA specification draft version not indicated Local Time is: Mon May 10 22:19:52 2010 EDT SMART support is: Available - device has SMART capability. SMART support is: Enabled === START OF READ SMART DATA SECTION === SMART overall-health self-assessment test result: PASSED General SMART Values: Offline data collection status: (0x82) Offline data collection activity was completed without error. Auto Offline Data Collection: Enabled. Self-test execution status: ( 241) Self-test routine in progress... 10% of test remaining. Total time to complete Offline data collection: (20100) seconds. Offline data collection capabilities: (0x7b) SMART execute Offline immediate. Auto Offline data collection on/off support. Suspend Offline collection upon new command. Offline surface scan supported. Self-test supported. Conveyance Self-test supported. Selective Self-test supported. SMART capabilities: (0x0003) Saves SMART data before entering power-saving mode. Supports SMART auto save timer. Error logging capability: (0x01) Error logging supported. General Purpose Logging supported. Short self-test routine recommended polling time: ( 2) minutes. Extended self-test routine recommended polling time: ( 231) minutes. Conveyance self-test routine recommended polling time: ( 5) minutes. SCT capabilities: (0x3031) SCT Status supported. SCT Feature Control supported. SCT Data Table supported. SMART Attributes Data Structure revision number: 16 Vendor Specific SMART Attributes with Thresholds: ID# ATTRIBUTE_NAME FLAG VALUE WORST THRESH TYPE UPDATED WHEN_FAILED RAW_VALUE 1 Raw_Read_Error_Rate 0x002f 200 200 051 Pre-fail Always - 2 3 Spin_Up_Time 0x0027 131 131 021 Pre-fail Always - 6408 4 Start_Stop_Count 0x0032 100 100 000 Old_age Always - 12 5 Reallocated_Sector_Ct 0x0033 200 200 140 Pre-fail Always - 0 7 Seek_Error_Rate 0x002e 200 200 000 Old_age Always - 0 9 Power_On_Hours 0x0032 100 100 000 Old_age Always - 148 10 Spin_Retry_Count 0x0032 100 253 000 Old_age Always - 0 11 Calibration_Retry_Count 0x0032 100 253 000 Old_age Always - 0 12 Power_Cycle_Count 0x0032 100 100 000 Old_age Always - 10 192 Power-Off_Retract_Count 0x0032 200 200 000 Old_age Always - 7 193 Load_Cycle_Count 0x0032 200 200 000 Old_age Always - 174 194 Temperature_Celsius 0x0022 106 102 000 Old_age Always - 41 196 Reallocated_Event_Count 0x0032 200 200 000 Old_age Always - 0 197 Current_Pending_Sector 0x0032 200 200 000 Old_age Always - 0 198 Offline_Uncorrectable 0x0030 200 200 000 Old_age Offline - 0 199 UDMA_CRC_Error_Count 0x0032 200 200 000 Old_age Always - 0 200 Multi_Zone_Error_Rate 0x0008 200 200 000 Old_age Offline - 0 SMART Error Log Version: 1 No Errors Logged SMART Self-test log structure revision number 1 Num Test_Description Status Remaining LifeTime(hours) LBA_of_first_error # 1 Conveyance offline Completed without error 00% 99 - # 2 Extended offline Interrupted (host reset) 10% 30 - # 3 Short offline Completed without error 00% 0 - SMART Selective self-test log data structure revision number 1 SPAN MIN_LBA MAX_LBA CURRENT_TEST_STATUS 1 0 0 Not_testing 2 0 0 Not_testing 3 0 0 Not_testing 4 0 0 Not_testing 5 0 0 Not_testing Selective self-test flags (0x0): After scanning selected spans, do NOT read-scan remainder of disk. If Selective self-test is pending on power-up, resume after 0 minute delay.

    Read the article

  • Using a "white list" for extracting terms for Text Mining

    - by [email protected]
    In Part 1 of my post on "Generating cluster names from a document clustering model" (part 1, part 2, part 3), I showed how to build a clustering model from text documents using Oracle Data Miner, which automates preparing data for text mining. In this process we specified a custom stoplist and lexer and relied on Oracle Text to identify important terms.  However, there is an alternative approach, the white list, which uses a thesaurus object with the Oracle Text CTXRULE index to allow you to specify the important terms. INTRODUCTIONA stoplist is used to exclude, i.e., black list, specific words in your documents from being indexed. For example, words like a, if, and, or, and but normally add no value when text mining. Other words can also be excluded if they do not help to differentiate documents, e.g., the word Oracle is ubiquitous in the Oracle product literature. One problem with stoplists is determining which words to specify. This usually requires inspecting the terms that are extracted, manually identifying which ones you don't want, and then re-indexing the documents to determine if you missed any. Since a corpus of documents could contain thousands of words, this could be a tedious exercise. Moreover, since every word is considered as an individual token, a term excluded in one context may be needed to help identify a term in another context. For example, in our Oracle product literature example, the words "Oracle Data Mining" taken individually are not particular helpful. The term "Oracle" may be found in nearly all documents, as with the term "Data." The term "Mining" is more unique, but could also refer to the Mining industry. If we exclude "Oracle" and "Data" by specifying them in the stoplist, we lose valuable information. But it we include them, they may introduce too much noise. Still, when you have a broad vocabulary or don't have a list of specific terms of interest, you rely on the text engine to identify important terms, often by computing the term frequency - inverse document frequency metric. (This is effectively a weight associated with each term indicating its relative importance in a document within a collection of documents. We'll revisit this later.) The results using this technique is often quite valuable. As noted above, an alternative to the subtractive nature of the stoplist is to specify a white list, or a list of terms--perhaps multi-word--that we want to extract and use for data mining. The obvious downside to this approach is the need to specify the set of terms of interest. However, this may not be as daunting a task as it seems. For example, in a given domain (Oracle product literature), there is often a recognized glossary, or a list of keywords and phrases (Oracle product names, industry names, product categories, etc.). Being able to identify multi-word terms, e.g., "Oracle Data Mining" or "Customer Relationship Management" as a single token can greatly increase the quality of the data mining results. The remainder of this post and subsequent posts will focus on how to produce a dataset that contains white list terms, suitable for mining. CREATING A WHITE LIST We'll leverage the thesaurus capability of Oracle Text. Using a thesaurus, we create a set of rules that are in effect our mapping from single and multi-word terms to the tokens used to represent those terms. For example, "Oracle Data Mining" becomes "ORACLEDATAMINING." First, we'll create and populate a mapping table called my_term_token_map. All text has been converted to upper case and values in the TERM column are intended to be mapped to the token in the TOKEN column. TERM                                TOKEN DATA MINING                         DATAMINING ORACLE DATA MINING                  ORACLEDATAMINING 11G                                 ORACLE11G JAVA                                JAVA CRM                                 CRM CUSTOMER RELATIONSHIP MANAGEMENT    CRM ... Next, we'll create a thesaurus object my_thesaurus and a rules table my_thesaurus_rules: CTX_THES.CREATE_THESAURUS('my_thesaurus', FALSE); CREATE TABLE my_thesaurus_rules (main_term     VARCHAR2(100),                                  query_string  VARCHAR2(400)); We next populate the thesaurus object and rules table using the term token map. A cursor is defined over my_term_token_map. As we iterate over  the rows, we insert a synonym relationship 'SYN' into the thesaurus. We also insert into the table my_thesaurus_rules the main term, and the corresponding query string, which specifies synonyms for the token in the thesaurus. DECLARE   cursor c2 is     select token, term     from my_term_token_map; BEGIN   for r_c2 in c2 loop     CTX_THES.CREATE_RELATION('my_thesaurus',r_c2.token,'SYN',r_c2.term);     EXECUTE IMMEDIATE 'insert into my_thesaurus_rules values                        (:1,''SYN(' || r_c2.token || ', my_thesaurus)'')'     using r_c2.token;   end loop; END; We are effectively inserting the token to return and the corresponding query that will look up synonyms in our thesaurus into the my_thesaurus_rules table, for example:     'ORACLEDATAMINING'        SYN ('ORACLEDATAMINING', my_thesaurus)At this point, we create a CTXRULE index on the my_thesaurus_rules table: create index my_thesaurus_rules_idx on        my_thesaurus_rules(query_string)        indextype is ctxsys.ctxrule; In my next post, this index will be used to extract the tokens that match each of the rules specified. We'll then compute the tf-idf weights for each of the terms and create a nested table suitable for mining.

    Read the article

  • Does Test Driven Development (TDD) improve Quality and Correctness? (Part 1)

    - by David V. Corbin
    Since the dawn of the computer age, various methodologies have been introduced to improve quality and reduce cost. In this posting, I will by sharing my experiences with Test Driven Development; both its benefits and limitations. To start this topic, we need to agree on what TDD is. The first is to define each of the three words as used in this context. Test - An item or action which measures something in some quantifiable form. Driven - The primary motivation or focus of a series of activities (process) Development - All phases of a software project/product from concept through delivery. The above are very simple definitions that result in the following: "TDD is a process where the primary focus is on measuring and quantifying all aspects of the creation of a (software) product." There are many places where TDD is used outside of software development, even though it is not known by this name. Consider the (conventional) education process that most of us grew up on. The focus was to get the best grades as measured by different tests. Many of these tests measured rote memorization and not understanding of the subject matter. The result of this that many people graduated with high scores but without "quality and correctness" in their ability to utilize the subject matter (of course, the flip side is true where certain people DID understand the material but were not very good at taking this type of test). Returning to software development, let us look at some common scenarios. While these items are generally applicable regardless of platform, language and tools; the remainder of this post will utilize Microsoft Visual Studio and Team Foundation Server (TFS) for examples. It should be realized that everyone does at least some aspect of TDD. At the most rudimentary level, getting a program to compile involves a "pass/fail" measurement (is the syntax valid) that drives their ability to proceed further (run the program). Other developers may create "Unit Tests" in the belief that having a test for every method/property of a class and good code coverage is the goal of TDD. These items may be helpful and even important, but really only address a small aspect of the overall effort. To see TDD in a bigger view, lets identify the various activities that are part of the Software Development LifeCycle. These are going to be presented in a Waterfall style for simplicity, but each item also occurs within Iterative methodologies such as Agile/Scrum. the key ones here are: Requirements Gathering Architecture Design Implementation Quality Assurance Can each of these items be subjected to a process which establishes metrics (quantified metrics) that reflect both the quality and correctness of each item? It should be clear that conventional Unit Tests do not apply to all of these items; at best they can verify that a local aspect (e.g. a Class/Method) of implementation matches the (test writers perspective of) the appropriate design document. So what can we do? For each of area, the goal is to create tests that are quantifiable and durable. The ability to quantify the measurements (beyond a simple pass/fail) is critical to tracking progress(eventually measuring the level of success that has been achieved) and for providing clear information on what items need to be addressed (along with the appropriate time to address them - in varying levels of detail) . Durability is important so that the test can be reapplied (ideally in an automated fashion) over the entire cycle. Returning for a moment back to our "education example", one must also be careful of how the tests are organized and how the measurements are taken. If a test is in a multiple choice format, there is a significant statistical probability that a correct answer might be the result of a random guess. Also, in many situations, having the student simply provide a final answer can obscure many important elements. For example, on a math test, having the student simply provide a numeric answer (rather than showing the methodology) may result in a complete mismatch between the process and the result. It is hard to determine which is worse: The student who makes a simple arithmetric error at one step of a long process (resulting in a wrong answer) or The student who (without providing the "workflow") uses a completely invalid approach, yet still comes up with the right number. The "Wrong Process"/"Right Answer" is probably the single biggest problem in software development. Even very simple items can suffer from this. As an example consider the following code for a "straight line" calculation....Is it correct? (for Integral Points)         int Solve(int m, int b, int x) { return m * x + b; }   Most people would respond "Yes". But let's take the question one step further... Is it correct for all possible values of m,b,x??? (no fair if you cheated by being focused on the bolded text!)  Without additional information regarding constrains on "the possible values of m,b,x" the answer must be NO, there is the risk of overflow/wraparound that will produce an incorrect result! To properly answer this question (i.e. Test the Code), one MUST be able to backtrack from the implementation through the design, and architecture all the way back to the requirements. And the requirement itself must be tested against the stakeholder(s). It is only when the bounding conditions are defined that it is possible to determine if the code is "Correct" and has "Quality". Yet, how many of us (myself included) have written such code without even thinking about it. In many canses we (think we) "know" what the bounds are, and that the code will be correct. As we all know, requirements change, "code reuse" causes implementations to be applied to different scenarios, etc. This leads directly to the types of system failures that plague so many projects. This approach to TDD is much more holistic than ones which start by focusing on the details. The fundamental concepts still apply: Each item should be tested. The test should be defined/implemented before (or concurrent with) the definition/implementation of the actual item. We also add concepts that expand the scope and alter the style by recognizing: There are many things beside "lines of code" that benefit from testing (measuring/evaluating in a formal way) Correctness and Quality can not be solely measured by "correct results" In the future parts, we will examine in greater detail some of the techniques that can be applied to each of these areas....

    Read the article

  • Nashorn, the rhino in the room

    - by costlow
    Nashorn is a new runtime within JDK 8 that allows developers to run code written in JavaScript and call back and forth with Java. One advantage to the Nashorn scripting engine is that is allows for quick prototyping of functionality or basic shell scripts that use Java libraries. The previous JavaScript runtime, named Rhino, was introduced in JDK 6 (released 2006, end of public updates Feb 2013). Keeping tradition amongst the global developer community, "Nashorn" is the German word for rhino. The Java platform and runtime is an intentional home to many languages beyond the Java language itself. OpenJDK’s Da Vinci Machine helps coordinate work amongst language developers and tool designers and has helped different languages by introducing the Invoke Dynamic instruction in Java 7 (2011), which resulted in two major benefits: speeding up execution of dynamic code, and providing the groundwork for Java 8’s lambda executions. Many of these improvements are discussed at the JVM Language Summit, where language and tool designers get together to discuss experiences and issues related to building these complex components. There are a number of benefits to running JavaScript applications on JDK 8’s Nashorn technology beyond writing scripts quickly: Interoperability with Java and JavaScript libraries. Scripts do not need to be compiled. Fast execution and multi-threading of JavaScript running in Java’s JRE. The ability to remotely debug applications using an IDE like NetBeans, Eclipse, or IntelliJ (instructions on the Nashorn blog). Automatic integration with Java monitoring tools, such as performance, health, and SIEM. In the remainder of this blog post, I will explain how to use Nashorn and the benefit from those features. Nashorn execution environment The Nashorn scripting engine is included in all versions of Java SE 8, both the JDK and the JRE. Unlike Java code, scripts written in nashorn are interpreted and do not need to be compiled before execution. Developers and users can access it in two ways: Users running JavaScript applications can call the binary directly:jre8/bin/jjs This mechanism can also be used in shell scripts by specifying a shebang like #!/usr/bin/jjs Developers can use the API and obtain a ScriptEngine through:ScriptEngine engine = new ScriptEngineManager().getEngineByName("nashorn"); When using a ScriptEngine, please understand that they execute code. Avoid running untrusted scripts or passing in untrusted/unvalidated inputs. During compilation, consider isolating access to the ScriptEngine and using Type Annotations to only allow @Untainted String arguments. One noteworthy difference between JavaScript executed in or outside of a web browser is that certain objects will not be available. For example when run outside a browser, there is no access to a document object or DOM tree. Other than that, all syntax, semantics, and capabilities are present. Examples of Java and JavaScript The Nashorn script engine allows developers of all experience levels the ability to write and run code that takes advantage of both languages. The specific dialect is ECMAScript 5.1 as identified by the User Guide and its standards definition through ECMA international. In addition to the example below, Benjamin Winterberg has a very well written Java 8 Nashorn Tutorial that provides a large number of code samples in both languages. Basic Operations A basic Hello World application written to run on Nashorn would look like this: #!/usr/bin/jjs print("Hello World"); The first line is a standard script indication, so that Linux or Unix systems can run the script through Nashorn. On Windows where scripts are not as common, you would run the script like: jjs helloWorld.js. Receiving Arguments In order to receive program arguments your jjs invocation needs to use the -scripting flag and a double-dash to separate which arguments are for jjs and which are for the script itself:jjs -scripting print.js -- "This will print" #!/usr/bin/jjs var whatYouSaid = $ARG.length==0 ? "You did not say anything" : $ARG[0] print(whatYouSaid); Interoperability with Java libraries (including 3rd party dependencies) Another goal of Nashorn was to allow for quick scriptable prototypes, allowing access into Java types and any libraries. Resources operate in the context of the script (either in-line with the script or as separate threads) so if you open network sockets and your script terminates, those sockets will be released and available for your next run. Your code can access Java types the same as regular Java classes. The “import statements” are written somewhat differently to accommodate for language. There is a choice of two styles: For standard classes, just name the class: var ServerSocket = java.net.ServerSocket For arrays or other items, use Java.type: var ByteArray = Java.type("byte[]")You could technically do this for all. The same technique will allow your script to use Java types from any library or 3rd party component and quickly prototype items. Building a user interface One major difference between JavaScript inside and outside of a web browser is the availability of a DOM object for rendering views. When run outside of the browser, JavaScript has full control to construct the entire user interface with pre-fabricated UI controls, charts, or components. The example below is a variation from the Nashorn and JavaFX guide to show how items work together. Nashorn has a -fx flag to make the user interface components available. With the example script below, just specify: jjs -fx -scripting fx.js -- "My title" #!/usr/bin/jjs -fx var Button = javafx.scene.control.Button; var StackPane = javafx.scene.layout.StackPane; var Scene = javafx.scene.Scene; var clickCounter=0; $STAGE.title = $ARG.length>0 ? $ARG[0] : "You didn't provide a title"; var button = new Button(); button.text = "Say 'Hello World'"; button.onAction = myFunctionForButtonClicking; var root = new StackPane(); root.children.add(button); $STAGE.scene = new Scene(root, 300, 250); $STAGE.show(); function myFunctionForButtonClicking(){   var text = "Click Counter: " + clickCounter;   button.setText(text);   clickCounter++;   print(text); } For a more advanced post on using Nashorn to build a high-performing UI, see JavaFX with Nashorn Canvas example. Interoperable with frameworks like Node, Backbone, or Facebook React The major benefit of any language is the interoperability gained by people and systems that can read, write, and use it for interactions. Because Nashorn is built for the ECMAScript specification, developers familiar with JavaScript frameworks can write their code and then have system administrators deploy and monitor the applications the same as any other Java application. A number of projects are also running Node applications on Nashorn through Project Avatar and the supported modules. In addition to the previously mentioned Nashorn tutorial, Benjamin has also written a post about Using Backbone.js with Nashorn. To show the multi-language power of the Java Runtime, there is another interesting example that unites Facebook React and Clojure on JDK 8’s Nashorn. Summary Nashorn provides a simple and fast way of executing JavaScript applications and bridging between the best of each language. By making the full range of Java libraries to JavaScript applications, and the quick prototyping style of JavaScript to Java applications, developers are free to work as they see fit. Software Architects and System Administrators can take advantage of one runtime and leverage any work that they have done to tune, monitor, and certify their systems. Additional information is available within: The Nashorn Users’ Guide Java Magazine’s article "Next Generation JavaScript Engine for the JVM." The Nashorn team’s primary blog or a very helpful collection of Nashorn links.

    Read the article

  • Book Review: Brownfield Application Development in .NET

    - by DotNetBlues
    I recently finished reading the book Brownfield Application Development in .NET by Kyle Baley and Donald Belcham.  The book is available from Manning.  First off, let me say that I'm a huge fan of Manning as a publisher.  I've found their books to be top-quality, over all.  As a Kindle owner, I also appreciate getting an ebook copy along with the dead tree copy.  I find ebooks to be much more convenient to read, but hard-copies are easier to reference. The book covers, surprisingly enough, working with brownfield applications.  Which is well and good, if that term has meaning to you.  It didn't for me.  Without retreading a chunk of the first chapter, the authors break code bases into three broad categories: greenfield, brownfield, and legacy.  Greenfield is, essentially, new development that hasn't had time to rust and is (hopefully) being approached with some discipline.  Legacy applications are those that are more or less stable and functional, that do not expect to see a lot of work done to them, and are more likely to be replaced than reworked. Brownfield code is the gray (brown?) area between the two and the authors argue, quite effectively, that it is the most likely state for an application to be in.  Brownfield code has, in some way, been allowed to tarnish around the edges and can be difficult to work with.  Although I hadn't realized it, most of the code I've worked on has been brownfield.  Sometimes, there's talk of scrapping and starting over.  Sometimes, the team dismisses increased discipline as ivory tower nonsense.  And, sometimes, I've been the ignorant culprit vexing my future self. The book is broken into two major sections, plus an introduction chapter and an appendix.  The first section covers what the authors refer to as "The Ecosystem" which consists of version control, build and integration, testing, metrics, and defect management.  The second section is on actually writing code for brownfield applications and discusses object-oriented principles, architecture, external dependencies, and, of course, how to deal with these when coming into an existing code base. The ecosystem section is just shy of 140 pages long and brings some real meat to the matter.  The focus on "pain points" immediately sets the tone as problem-solution, rather than academic.  The authors also approach some of the topics from a different angle than some essays I've read on similar topics.  For example, the chapter on automated testing is on just that -- automated testing.  It's all well and good to criticize a project as conflating integration tests with unit tests, but it really doesn't make anyone's life better.  The discussion on testing is more focused on the "right" level of testing for existing projects.  Sometimes, an integration test is the best you can do without gutting a section of functional code.  Even if you can sell other developers and/or management on doing so, it doesn't actually provide benefit to your customers to rewrite code that works.  This isn't to say the authors encourage sloppy coding.  Far from it.  Just that they point out the wisdom of ignoring the sleeping bear until after you deal with the snarling wolf. The other sections take a similarly real-world, workable approach to the pain points they address.  As the section moves from technical solutions like version control and continuous integration (CI) to the softer, process issues of metrics and defect tracking, the authors begin to gently suggest moving toward a zero defect count.  While that really sounds like an unreasonable goal for a lot of ongoing projects, it's quite apparent that the authors have first-hand experience with taming some gruesome projects.  The suggestions are grounded and workable, and the difficulty of some situations is explicitly acknowledged. I have to admit that I started getting bored by the end of the ecosystem section.  No matter how valuable I think a good project manager or business analyst is to a successful ALM, at the end of the day, I'm a gear-head.  Also, while I agreed with a lot of the ecosystem ideas, in theory, I didn't necessarily feel that a lot of the single-developer projects that I'm often involved in really needed that level of rigor.  It's only after reading the sidebars and commentary in the coding section that I had the context for the arguments made in favor of a strong ecosystem supporting the development process.  That isn't to say that I didn't support good product management -- indeed, I've probably pushed too hard, on occasion, for a strong ALM outside of just development.  This book gave me deeper insight into why some corners shouldn't be cut and how damaging certain sins of omission can be. The code section, though, kept me engaged for its entirety.  Many technical books can be used as reference material from day one.  The authors were clear, however, that this book is not one of these.  The first chapter of the section (chapter seven, over all) addresses object oriented (OO) practices.  I've read any number of definitions, discussions, and treatises on OO.  None of the chapter was new to me, but it was a good review, and I'm of the opinion that it's good to review the foundations of what you do, from time to time, so I didn't mind. The remainder of the book is really just about how to apply OOP to existing code -- and, just because all your code exists in classes does not mean that it's object oriented.  That topic has the potential to be extremely condescending, but the authors miraculously managed to never once make me feel like a dolt or that they were wagging their finger at me for my prior sins.  Instead, they continue the "pain points" and problem-solution presentation to give concrete examples of how to apply some pretty academic-sounding ideas.  That's a point worth emphasizing, as my experience with most OO discussions is that they stay in the academic realm.  This book gives some very, very good explanations of why things like the Liskov Substitution Principle exist and why a corporate programmer should even care.  Even if you know, with absolute certainty, that you'll never have to work on an existing code-base, I would recommend this book just for the clarity it provides on OOP. This book goes beyond just theory, or even real-world application.  It presents some methods for fixing problems that any developer can, and probably will, encounter in the wild.  First, the authors address refactoring application layers and internal dependencies.  Then, they take you through those layers from the UI to the data access layer and external dependencies.  Finally, they come full circle to tie it all back to the overall process.  By the time the book is done, you're left with a lot of ideas, but also a reasonable plan to begin to improve an existing project structure. Throughout the book, it's apparent that the authors have their own preferred methodology (TDD and domain-driven design), as well as some preferred tools.  The "Our .NET Toolbox" is something of a neon sign pointing to that latter point.  They do not beat the reader over the head with anything resembling a "One True Way" mentality.  Even for the most emphatic points, the tone is quite congenial and helpful.  With some of the near-theological divides that exist within the tech community, I found this to be one of the more remarkable characteristics of the book.  Although the authors favor tools that might be considered Alt.NET, there is no reason the advice and techniques given couldn't be quite successful in a pure Microsoft shop with Team Foundation Server.  For that matter, even though the book specifically addresses .NET, it could be applied to a Java and Oracle shop, as well.

    Read the article

  • laptop crashed: why?

    - by sds
    my linux (ubuntu 12.04) laptop crashed, and I am trying to figure out why. # last sds pts/4 :0 Tue Sep 4 10:01 still logged in sds pts/3 :0 Tue Sep 4 10:00 still logged in reboot system boot 3.2.0-29-generic Tue Sep 4 09:43 - 11:23 (01:40) sds pts/8 :0 Mon Sep 3 14:23 - crash (19:19) this seems to indicate a crash at 09:42 (= 14:23+19:19). as per another question, I looked at /var/log: auth.log: Sep 4 09:17:02 t520sds CRON[32744]: pam_unix(cron:session): session closed for user root Sep 4 09:43:17 t520sds lightdm: pam_unix(lightdm:session): session opened for user lightdm by (uid=0) no messages file syslog: Sep 4 09:24:19 t520sds kernel: [219104.819975] CPU0: Package power limit normal Sep 4 09:43:16 t520sds kernel: imklog 5.8.6, log source = /proc/kmsg started. kern.log: Sep 4 09:24:19 t520sds kernel: [219104.819969] CPU1: Package power limit normal Sep 4 09:24:19 t520sds kernel: [219104.819971] CPU2: Package power limit normal Sep 4 09:24:19 t520sds kernel: [219104.819974] CPU3: Package power limit normal Sep 4 09:24:19 t520sds kernel: [219104.819975] CPU0: Package power limit normal Sep 4 09:43:16 t520sds kernel: imklog 5.8.6, log source = /proc/kmsg started. Sep 4 09:43:16 t520sds kernel: [ 0.000000] Initializing cgroup subsys cpuset Sep 4 09:43:16 t520sds kernel: [ 0.000000] Initializing cgroup subsys cpu I had a computation running until 9:24, but the system crashed 18 minutes later! kern.log has many pages of these: Sep 4 09:43:16 t520sds kernel: [ 0.000000] total RAM covered: 8086M Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 64K num_reg: 10 lose cover RAM: 38M Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 128K num_reg: 10 lose cover RAM: 38M Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 256K num_reg: 10 lose cover RAM: 38M Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 512K num_reg: 10 lose cover RAM: 38M Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 1M num_reg: 10 lose cover RAM: 38M Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 2M num_reg: 10 lose cover RAM: 38M Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 4M num_reg: 10 lose cover RAM: 38M Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 8M num_reg: 10 lose cover RAM: 38M Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 16M num_reg: 10 lose cover RAM: 38M Sep 4 09:43:16 t520sds kernel: [ 0.000000] *BAD*gran_size: 64K chunk_size: 32M num_reg: 10 lose cover RAM: -16M Sep 4 09:43:16 t520sds kernel: [ 0.000000] *BAD*gran_size: 64K chunk_size: 64M num_reg: 10 lose cover RAM: -16M Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 128M num_reg: 10 lose cover RAM: 0G Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 256M num_reg: 10 lose cover RAM: 0G Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 512M num_reg: 10 lose cover RAM: 0G Sep 4 09:43:16 t520sds kernel: [ 0.000000] gran_size: 64K chunk_size: 1G num_reg: 10 lose cover RAM: 0G Sep 4 09:43:16 t520sds kernel: [ 0.000000] *BAD*gran_size: 64K chunk_size: 2G num_reg: 10 lose cover RAM: -1G does this mean that my RAM is bad?! it also says Sep 4 09:43:16 t520sds kernel: [ 2.944123] EXT4-fs (sda1): INFO: recovery required on readonly filesystem Sep 4 09:43:16 t520sds kernel: [ 2.944126] EXT4-fs (sda1): write access will be enabled during recovery Sep 4 09:43:16 t520sds kernel: [ 3.088001] firewire_core: created device fw0: GUID f0def1ff8fbd7dff, S400 Sep 4 09:43:16 t520sds kernel: [ 8.929243] EXT4-fs (sda1): orphan cleanup on readonly fs Sep 4 09:43:16 t520sds kernel: [ 8.929249] EXT4-fs (sda1): ext4_orphan_cleanup: deleting unreferenced inode 658984 ... Sep 4 09:43:16 t520sds kernel: [ 9.343266] EXT4-fs (sda1): ext4_orphan_cleanup: deleting unreferenced inode 525343 Sep 4 09:43:16 t520sds kernel: [ 9.343270] EXT4-fs (sda1): 56 orphan inodes deleted Sep 4 09:43:16 t520sds kernel: [ 9.343271] EXT4-fs (sda1): recovery complete Sep 4 09:43:16 t520sds kernel: [ 9.645799] EXT4-fs (sda1): mounted filesystem with ordered data mode. Opts: (null) does this mean my HD is bad? As per FaultyHardware, I tried smartctl -l selftest, which uncovered no errors: smartctl 5.41 2011-06-09 r3365 [x86_64-linux-3.2.0-30-generic] (local build) Copyright (C) 2002-11 by Bruce Allen, http://smartmontools.sourceforge.net === START OF INFORMATION SECTION === Model Family: Seagate Momentus 7200.4 Device Model: ST9500420AS Serial Number: 5VJE81YK LU WWN Device Id: 5 000c50 0440defe3 Firmware Version: 0003LVM1 User Capacity: 500,107,862,016 bytes [500 GB] Sector Size: 512 bytes logical/physical Device is: In smartctl database [for details use: -P show] ATA Version is: 8 ATA Standard is: ATA-8-ACS revision 4 Local Time is: Mon Sep 10 16:40:04 2012 EDT SMART support is: Available - device has SMART capability. SMART support is: Enabled === START OF READ SMART DATA SECTION === SMART overall-health self-assessment test result: PASSED See vendor-specific Attribute list for marginal Attributes. General SMART Values: Offline data collection status: (0x82) Offline data collection activity was completed without error. Auto Offline Data Collection: Enabled. Self-test execution status: ( 0) The previous self-test routine completed without error or no self-test has ever been run. Total time to complete Offline data collection: ( 0) seconds. Offline data collection capabilities: (0x7b) SMART execute Offline immediate. Auto Offline data collection on/off support. Suspend Offline collection upon new command. Offline surface scan supported. Self-test supported. Conveyance Self-test supported. Selective Self-test supported. SMART capabilities: (0x0003) Saves SMART data before entering power-saving mode. Supports SMART auto save timer. Error logging capability: (0x01) Error logging supported. General Purpose Logging supported. Short self-test routine recommended polling time: ( 1) minutes. Extended self-test routine recommended polling time: ( 109) minutes. Conveyance self-test routine recommended polling time: ( 2) minutes. SCT capabilities: (0x103b) SCT Status supported. SCT Error Recovery Control supported. SCT Feature Control supported. SCT Data Table supported. SMART Attributes Data Structure revision number: 10 Vendor Specific SMART Attributes with Thresholds: ID# ATTRIBUTE_NAME FLAG VALUE WORST THRESH TYPE UPDATED WHEN_FAILED RAW_VALUE 1 Raw_Read_Error_Rate 0x000f 117 099 034 Pre-fail Always - 162843537 3 Spin_Up_Time 0x0003 100 100 000 Pre-fail Always - 0 4 Start_Stop_Count 0x0032 100 100 020 Old_age Always - 571 5 Reallocated_Sector_Ct 0x0033 100 100 036 Pre-fail Always - 0 7 Seek_Error_Rate 0x000f 069 060 030 Pre-fail Always - 17210154023 9 Power_On_Hours 0x0032 095 095 000 Old_age Always - 174362787320258 10 Spin_Retry_Count 0x0013 100 100 097 Pre-fail Always - 0 12 Power_Cycle_Count 0x0032 100 100 020 Old_age Always - 571 184 End-to-End_Error 0x0032 100 100 099 Old_age Always - 0 187 Reported_Uncorrect 0x0032 100 100 000 Old_age Always - 0 188 Command_Timeout 0x0032 100 100 000 Old_age Always - 1 189 High_Fly_Writes 0x003a 100 100 000 Old_age Always - 0 190 Airflow_Temperature_Cel 0x0022 061 043 045 Old_age Always In_the_past 39 (0 11 44 26) 191 G-Sense_Error_Rate 0x0032 100 100 000 Old_age Always - 84 192 Power-Off_Retract_Count 0x0032 100 100 000 Old_age Always - 20 193 Load_Cycle_Count 0x0032 099 099 000 Old_age Always - 2434 194 Temperature_Celsius 0x0022 039 057 000 Old_age Always - 39 (0 15 0 0) 195 Hardware_ECC_Recovered 0x001a 041 041 000 Old_age Always - 162843537 196 Reallocated_Event_Count 0x000f 095 095 030 Pre-fail Always - 4540 (61955, 0) 197 Current_Pending_Sector 0x0012 100 100 000 Old_age Always - 0 198 Offline_Uncorrectable 0x0010 100 100 000 Old_age Offline - 0 199 UDMA_CRC_Error_Count 0x003e 200 200 000 Old_age Always - 0 254 Free_Fall_Sensor 0x0032 100 100 000 Old_age Always - 0 SMART Error Log Version: 1 No Errors Logged SMART Self-test log structure revision number 1 Num Test_Description Status Remaining LifeTime(hours) LBA_of_first_error # 1 Extended offline Completed without error 00% 4545 - SMART Selective self-test log data structure revision number 1 SPAN MIN_LBA MAX_LBA CURRENT_TEST_STATUS 1 0 0 Not_testing 2 0 0 Not_testing 3 0 0 Not_testing 4 0 0 Not_testing 5 0 0 Not_testing Selective self-test flags (0x0): After scanning selected spans, do NOT read-scan remainder of disk. If Selective self-test is pending on power-up, resume after 0 minute delay. Googling for the messages proved inconclusive, I can't even figure out whether the messages are routine or catastrophic. So, what do I do now?

    Read the article

  • Confirm disk is broken when it passes all diagnostics

    - by Halfgaar
    I have a system with a potentially broken disk, but the disk passes all manner of diagnostics. I have been unable to confirm that the disk is broken. What are my options? I could just replace the disk, but because this situation is very similar to another more severe situation I have (long story), I'd like to actually make a proper diagnosis as opposed to randomly binning hardware. The issue and history is this: I had a Debian Linux PC (500 MHz P3) acting as router, nagios and munin. It crashed every couple of weeks. No logs or dmesg could be obtained (because it's an old Compaq that only boots when you configure it as keyboardless, making connecting a keyboard later, once it's booted, impossible). At the time, I just replaced the computer with another Compaq (P4 2.4 GHz) because I thought the hardware was faulty. However, it still crashed every couple of weeks. the difference is that on this computer, I can still SSH into it. It gives all kinds of errors on hda. I'd like to confirm that the disk is broken, but nothing I do confirms this: SMART error logs shows no errors. Normally when a disk starts acting up, SMART my pass, but it still records a read-error in the error log. SMART self-test (smartctl -t long /dev/sda) completes without errors. re-allocated sector count (a tell-tale parameter) has been 31 all its life, even when the disk was still in use in my desktop PC years ago, and it still is. The figure never changed. dd if=/dev/sda of=/dev/null bs=4096 passes with flying colors. What else can I do to assess the health of the drive? Again, this is not about making this router fully functional again, this is a disk forensic question, because it just so happens that I have another server that potentially has the same problem, and knowing the answer to this will possibly help me greatly. For the record, below are logs and such. This is the smartctl -a output: smartctl 5.40 2010-07-12 r3124 [i686-pc-linux-gnu] (local build) Copyright (C) 2002-10 by Bruce Allen, http://smartmontools.sourceforge.net === START OF INFORMATION SECTION === Model Family: Seagate Barracuda 7200.7 and 7200.7 Plus family Device Model: ST3120026A Serial Number: 5JT1CLQM Firmware Version: 3.06 User Capacity: 120,034,123,776 bytes Device is: In smartctl database [for details use: -P show] ATA Version is: 6 ATA Standard is: ATA/ATAPI-6 T13 1410D revision 2 Local Time is: Mon Jul 1 21:18:33 2013 CEST SMART support is: Available - device has SMART capability. SMART support is: Enabled === START OF READ SMART DATA SECTION === SMART overall-health self-assessment test result: PASSED General SMART Values: Offline data collection status: (0x82) Offline data collection activity was completed without error. Auto Offline Data Collection: Enabled. Self-test execution status: ( 24) The self-test routine was aborted by the host. Total time to complete Offline data collection: ( 430) seconds. Offline data collection capabilities: (0x5b) SMART execute Offline immediate. Auto Offline data collection on/off support. Suspend Offline collection upon new command. Offline surface scan supported. Self-test supported. No Conveyance Self-test supported. Selective Self-test supported. SMART capabilities: (0x0003) Saves SMART data before entering power-saving mode. Supports SMART auto save timer. Error logging capability: (0x01) Error logging supported. No General Purpose Logging support. Short self-test routine recommended polling time: ( 1) minutes. Extended self-test routine recommended polling time: ( 85) minutes. SMART Attributes Data Structure revision number: 10 Vendor Specific SMART Attributes with Thresholds: ID# ATTRIBUTE_NAME FLAG VALUE WORST THRESH TYPE UPDATED WHEN_FAILED RAW_VALUE 1 Raw_Read_Error_Rate 0x000f 050 046 006 Pre-fail Always - 47766662 3 Spin_Up_Time 0x0003 097 096 000 Pre-fail Always - 0 4 Start_Stop_Count 0x0032 100 100 020 Old_age Always - 10 5 Reallocated_Sector_Ct 0x0033 100 100 036 Pre-fail Always - 31 7 Seek_Error_Rate 0x000f 084 060 030 Pre-fail Always - 820305 9 Power_On_Hours 0x0032 048 048 000 Old_age Always - 46373 10 Spin_Retry_Count 0x0013 100 100 097 Pre-fail Always - 0 12 Power_Cycle_Count 0x0032 100 100 020 Old_age Always - 605 194 Temperature_Celsius 0x0022 036 065 000 Old_age Always - 36 195 Hardware_ECC_Recovered 0x001a 050 046 000 Old_age Always - 47766662 197 Current_Pending_Sector 0x0012 100 100 000 Old_age Always - 0 198 Offline_Uncorrectable 0x0010 100 100 000 Old_age Offline - 0 199 UDMA_CRC_Error_Count 0x003e 200 196 000 Old_age Always - 6 200 Multi_Zone_Error_Rate 0x0000 100 253 000 Old_age Offline - 0 202 Data_Address_Mark_Errs 0x0032 100 253 000 Old_age Always - 0 SMART Error Log Version: 1 No Errors Logged SMART Self-test log structure revision number 1 Num Test_Description Status Remaining LifeTime(hours) LBA_of_first_error # 1 Extended offline Aborted by host 80% 46361 - # 2 Extended offline Completed without error 00% 46358 - # 3 Short offline Completed without error 00% 12046 - # 4 Extended offline Completed without error 00% 10472 - # 5 Short offline Completed without error 00% 10471 - # 6 Short offline Completed without error 00% 10471 - # 7 Short offline Completed without error 00% 6770 - # 8 Extended offline Aborted by host 90% 5958 - # 9 Extended offline Aborted by host 90% 5951 - #10 Short offline Completed without error 00% 5024 - #11 Extended offline Aborted by host 80% 5024 - #12 Short offline Completed without error 00% 3697 - #13 Short offline Completed without error 00% 237 - #14 Short offline Completed without error 00% 145 - #15 Short offline Completed without error 00% 69 - #16 Extended offline Completed without error 00% 68 - #17 Short offline Completed without error 00% 66 - #18 Short offline Completed without error 00% 49 - #19 Short offline Completed without error 00% 29 - #20 Short offline Completed without error 00% 29 - SMART Selective self-test log data structure revision number 1 SPAN MIN_LBA MAX_LBA CURRENT_TEST_STATUS 1 0 0 Not_testing 2 0 0 Not_testing 3 0 0 Not_testing 4 0 0 Not_testing 5 0 0 Not_testing Selective self-test flags (0x0): After scanning selected spans, do NOT read-scan remainder of disk. If Selective self-test is pending on power-up, resume after 0 minute delay. And this is the dmesg error when it has crashed (which repeats for a bunch of different sectors): [1755091.211136] sd 0:0:0:0: [sda] Unhandled error code [1755091.211144] sd 0:0:0:0: [sda] Result: hostbyte=DID_BAD_TARGET driverbyte=DRIVER_OK [1755091.211151] sd 0:0:0:0: [sda] CDB: Read(10): 28 00 08 fe ad 38 00 00 08 00 [1755091.211166] end_request: I/O error, dev sda, sector 150908216

    Read the article

  • Skipping scheduled self-tests and predicting drive EOL

    - by Steve Madsen
    For a few weeks now, smartd has been reporting that it is skipping some of its scheduled self-tests on the weekends: Apr 24 18:29:32 calvin smartd[4758]: Device: /dev/sda, skip scheduled Offline Immediate Test; 40% remaining of current Self-Test. Apr 24 18:29:33 calvin smartd[4758]: Device: /dev/sdb, skip scheduled Offline Immediate Test; 50% remaining of current Self-Test. The drives in this RAID-1 array are set to run an offline test four times a day, a short self-test at 2am every day, and a long self-test on Saturdays at 2am. For some reason, it looks like the long self-test is taking longer, causing the other scheduled tests to be skipped. First question: is this a sign of likely drive failure? Then today, smartd reported that a self-test failed. Here is the output of smartctl -a /dev/sdb: smartctl version 5.38 [i686-pc-linux-gnu] Copyright (C) 2002-8 Bruce Allen Home page is http://smartmontools.sourceforge.net/ === START OF INFORMATION SECTION === Model Family: Seagate Barracuda 7200.8 family Device Model: ST3250823AS Serial Number: 3ND1GNBC Firmware Version: 3.03 User Capacity: 250,059,350,016 bytes Device is: In smartctl database [for details use: -P show] ATA Version is: 7 ATA Standard is: Exact ATA specification draft version not indicated Local Time is: Sun Apr 25 13:15:34 2010 EDT SMART support is: Available - device has SMART capability. SMART support is: Enabled === START OF READ SMART DATA SECTION === SMART overall-health self-assessment test result: PASSED General SMART Values: Offline data collection status: (0x82) Offline data collection activity was completed without error. Auto Offline Data Collection: Enabled. Self-test execution status: ( 0) The previous self-test routine completed without error or no self-test has ever been run. Total time to complete Offline data collection: ( 430) seconds. Offline data collection capabilities: (0x5b) SMART execute Offline immediate. Auto Offline data collection on/off support. Suspend Offline collection upon new command. Offline surface scan supported. Self-test supported. No Conveyance Self-test supported. Selective Self-test supported. SMART capabilities: (0x0003) Saves SMART data before entering power-saving mode. Supports SMART auto save timer. Error logging capability: (0x01) Error logging supported. General Purpose Logging supported. Short self-test routine recommended polling time: ( 1) minutes. Extended self-test routine recommended polling time: ( 84) minutes. SMART Attributes Data Structure revision number: 10 Vendor Specific SMART Attributes with Thresholds: ID# ATTRIBUTE_NAME FLAG VALUE WORST THRESH TYPE UPDATED WHEN_FAILED RAW_VALUE 1 Raw_Read_Error_Rate 0x000f 047 039 006 Pre-fail Always - 168450357 3 Spin_Up_Time 0x0003 098 098 000 Pre-fail Always - 0 4 Start_Stop_Count 0x0032 100 100 020 Old_age Always - 33 5 Reallocated_Sector_Ct 0x0033 100 100 036 Pre-fail Always - 9 7 Seek_Error_Rate 0x000f 087 060 030 Pre-fail Always - 654745480 9 Power_On_Hours 0x0032 055 055 000 Old_age Always - 40141 10 Spin_Retry_Count 0x0013 100 100 097 Pre-fail Always - 0 12 Power_Cycle_Count 0x0032 100 100 020 Old_age Always - 51 194 Temperature_Celsius 0x0022 037 062 000 Old_age Always - 37 (0 17 0 0) 195 Hardware_ECC_Recovered 0x001a 047 039 000 Old_age Always - 168450357 197 Current_Pending_Sector 0x0012 100 100 000 Old_age Always - 0 198 Offline_Uncorrectable 0x0010 100 100 000 Old_age Offline - 0 199 UDMA_CRC_Error_Count 0x003e 200 200 000 Old_age Always - 0 200 Multi_Zone_Error_Rate 0x0000 100 253 000 Old_age Offline - 0 202 TA_Increase_Count 0x0032 100 253 000 Old_age Always - 0 SMART Error Log Version: 1 No Errors Logged SMART Self-test log structure revision number 1 Num Test_Description Status Remaining LifeTime(hours) LBA_of_first_error # 1 Short offline Completed without error 00% 40131 - # 2 Extended offline Completed: read failure 30% 40129 379795511 # 3 Short offline Completed without error 00% 40084 - # 4 Short offline Completed without error 00% 40060 - # 5 Short offline Completed without error 00% 40036 - # 6 Short offline Completed without error 00% 40013 - # 7 Short offline Completed without error 00% 39990 - # 8 Extended offline Completed without error 00% 39977 - # 9 Short offline Completed without error 00% 39919 - #10 Short offline Completed without error 00% 39895 - #11 Short offline Completed without error 00% 39872 - #12 Short offline Completed without error 00% 39848 - #13 Short offline Completed without error 00% 39824 - #14 Short offline Completed without error 00% 39801 - #15 Extended offline Completed without error 00% 39789 - #16 Short offline Completed without error 00% 39754 - #17 Short offline Completed without error 00% 39732 - #18 Short offline Completed without error 00% 39707 - #19 Short offline Completed without error 00% 39683 - #20 Short offline Completed without error 00% 39660 - #21 Short offline Completed without error 00% 39636 - SMART Selective self-test log data structure revision number 1 SPAN MIN_LBA MAX_LBA CURRENT_TEST_STATUS 1 0 0 Not_testing 2 0 0 Not_testing 3 0 0 Not_testing 4 0 0 Not_testing 5 0 0 Not_testing Selective self-test flags (0x0): After scanning selected spans, do NOT read-scan remainder of disk. If Selective self-test is pending on power-up, resume after 0 minute delay. Given that this drive is about 4.5 years old, I am probably tempting fate by keeping it in service. SMART doesn't seem to get much respect as a reliable way to predict drive failure. What else can I use to get an early indication of drive failure?

    Read the article

  • Question about how to use strong typed dataset in N-tier application for .NET

    - by sb
    Hello All, I need some expert advice on strong typed data sets in ADO.NET that are generated by the Visual Studio. Here are the details. Thank you in advance. I want to write a N-tier application where Presentation layer is in C#/windows forms, Business Layer is a Web service and Data Access Layer is SQL db. So, I used Visual Studio 2005 for this and created 3 projects in a solution. project 1 is the Data access layer. In this I have used visual studio data set generator to create a strong typed data set and table adapter (to test I created this on the customers table in northwind). The data set is called NorthWindDataSet and the table inside is CustomersTable. project 2 has the web service which exposes only 1 method which is GetCustomersDataSet. This uses the project1 library's table adapter to fill the data set and return it to the caller. To be able to use the NorthWindDataSet and table adapter, I added a reference to the project 1. project 3 is a win forms app and this uses the web service as a reference and calls that service to get the data set. In the process of building this application, in the PL, I added a reference to the DataSet generated above in the project 1 and in form's load I call the web service and assign the received DataSet from the web service to this dataset. But I get the error: "Cannot implicitly convert type 'PL.WebServiceLayerReference.NorthwindDataSet' to 'BL.NorthwindDataSet' e:\My Documents\Visual Studio 2008\Projects\DataSetWebServiceExample\PL\Form1.cs". Both the data sets are same but because I added references from different locations, I am getting the above error I think. So, what I did was I added a reference to project 1 (which defines the data set) to project 3 (the UI) and used the web service to get the DataSet and assing to the right type, now when the project 3 (which has the web form) runs, I get the below runtime exception. "System.InvalidOperationException: There is an error in XML document (1, 5058). --- System.Xml.Schema.XmlSchemaException: Multiple definition of element 'http://tempuri.org/NorthwindDataSet.xsd:Customers' causes the content model to become ambiguous. A content model must be formed such that during validation of an element information item sequence, the particle contained directly, indirectly or implicitly therein with which to attempt to validate each item in the sequence in turn can be uniquely determined without examining the content or attributes of that item, and without any information about the items in the remainder of the sequence." I think this might be because of some cross referenceing errors. My question is, is there a way to use the visual studio generated DataSets in such a way that I can use the same DataSet in all layers (for reuse) but separate the Table Adapter logic to the Data Access Layer so that the front end is abstracted from all this by the web service? If I have hand write the code I loose the goodness the data set generator gives and also if there are columns added later I need to add it by hand etc so I want to use the visual studio wizard as much as possible. thanks for any help on this. sb

    Read the article

  • The best cross platform (portable) arbitrary precision math library

    - by Siu Ching Pong - Asuka Kenji
    Dear ninjas / hackers / wizards, I'm looking for a good arbitrary precision math library in C or C++. Could you please give me some advices / suggestions? The primary requirements: It MUST handle arbitrarily big integers (my primary interest is on integers). In case that you don't know what the word arbitrarily big means, imagine something like 100000! (the factorial of 100000). The precision MUST NOT NEED to be specified during library initialization / object creation. The precision should ONLY be constrained by the available resources of the system. It SHOULD utilize the full power of the platform, and should handle "small" numbers natively. That means on a 64-bit platform, calculating 2^33 + 2^32 should use the available 64-bit CPU instructions. The library SHOULD NOT calculate this in the same way as it does with 2^66 + 2^65 on the same platform. It MUST handle addition (+), subtraction (-), multiplication (*), integer division (/), remainder (%), power (**), increment (++), decrement (--), gcd(), factorial(), and other common integer arithmetic calculations efficiently. Ability to handle functions like sqrt() (square root), log() (logarithm) that do not produce integer results is a plus. Ability to handle symbolic computations is even better. Here are what I found so far: Java's BigInteger and BigDecimal class: I have been using these so far. I have read the source code, but I don't understand the math underneath. It may be based on theories / algorithms that I have never learnt. The built-in integer type or in core libraries of bc / Python / Ruby / Haskell / Lisp / Erlang / OCaml / PHP / some other languages: I have ever used some of these, but I have no idea on which library they are using, or which kind of implementation they are using. What I have already known: Using a char as a decimal digit, and a char* as a decimal string and do calculations on the digits using a for-loop. Using an int (or a long int, or a long long) as a basic "unit" and an array of it as an arbitrary long integer, and do calculations on the elements using a for-loop. Booth's multiplication algorithm What I don't know: Printing the binary array mentioned above in decimal without using naive methods. Example of a naive method: (1) add the bits from the lowest to the highest: 1, 2, 4, 8, 16, 32, ... (2) use a char* string mentioned above to store the intermediate decimal results). What I appreciate: Good comparisons on GMP, MPFR, decNumber (or other libraries that are good in your opinion). Good suggestions on books / articles that I should read. For example, an illustration with figures on how a un-naive arbitrarily long binary to decimal conversion algorithm works is good. Any help. Please DO NOT answer this question if: you think using a double (or a long double, or a long long double) can solve this problem easily. If you do think so, it means that you don't understand the issue under discussion. you have no experience on arbitrary precision mathematics. Thank you in advance! Asuka Kenji

    Read the article

  • Can't remove Enter_Frame and stop TimerEvent

    - by Hwang
    I wanted to remove an ENTER_FRAME object and stopping an TimerEvent when I click on a button, and rerun ENTER_FRAME and TimerEvent when I click on another button. I've tried removeAddEventListener and stop() for the time, but I won't work. Any idea whats the problem here? package{ import flash.display.MovieClip; import flash.display.DisplayObject; import flash.events.Event; import flash.events.TimerEvent; import flash.utils.Timer; public class clockFunction extends MovieClip { private var clock:clockMC=new clockMC(); private var countdownTimer:Timer; //seconds private var secTop1=clock.second.top1.digit; private var secTop2=clock.second.top2.digit; private var secBot1=clock.second.bot1.digit; private var secBot2=clock.second.bot2.digit; private var seconds:Number; private var minutes:Number; private var hours:Number; private var days:Number; public function clockFunction():void { decrease(); addChild(clock); } private function decrease():void { countdownTimer=new Timer(1000); //Adding an event listener to the timer object countdownTimer.addEventListener(TimerEvent.TIMER,updateTime); //Initializing timer object //countdownTimer.start(); } private function updateTime(event:TimerEvent):void { decreasTimerFunction(); clock.second.play(); if (seconds==1) { clock.minute.play(); } if ((minutes==1)&&(seconds==1)) { clock.hour.play(); } if ((hours==1)&&(minutes==1)&&(seconds==1)) { clock.day.play(); } } //Setting it back to its correct time so it won't have number changing in between of flipping issues. private function detect(event:Event):void { //seconds var sec1=seconds; var sec2=seconds-1; if (sec1<10) { sec1="0"+sec1; } if (sec2<10) { sec2="0"+sec2; } if (sec1==00) { sec2=59; } secTop1.text=sec1; secTop2.text=sec2; secBot1.text=sec1; secBot2.text=sec2; } public function startTime():void { addEventListener(Event.ENTER_FRAME,detect); countdownTimer.start(); trace("start"); } public function stopTime():void { countdownTimer.stop(); removeEventListener(Event.ENTER_FRAME,detect); trace("stop"); } private function decreasTimerFunction():void { //Create a date object for Christmas Morning var endTime:Date=new Date(2010,3,26,20,0,0); //Current date object var now:Date=new Date(); // Set the difference between the two date and times in milliseconds var timeDiff:Number=endTime.getTime()-now.getTime(); seconds=Math.floor(timeDiff/1000); minutes=Math.floor(seconds/60); hours=Math.floor(minutes/60); days=Math.floor(hours/24); // Set the remainder of the division vars above hours%=24; minutes%=60; seconds%=60; } } }

    Read the article

  • Retreiving multiple rows from a loop-created form... Stuck.

    - by hangston
    Hi All, Let me start by saying that I'm new to PHP, but I'm here to learn and would really appreciate your help. I use the following code to pull in data and create a form. This creates up to 40 lines for a user to fill out. Each line consists of the same information: Description, Amount, and Frequency. The remainder of the information needed is generated by the database. (See hidden fields) <?php $row = 0; do { $optid = $row_options['option_id']; echo "<tr>\n\t<td>" . htmlentities($row_options['option']) . "</td>\n"; echo "\t<td>" . "<input name='description' type='text' size='40' maxlength='120'/>" . "</td>\n"; echo "\t<td>" . "<input name='option_id' type='hidden' value='$optid' />$<input name='amount' type='text' size='10' maxlength='7'/>" . "</td>\n"; echo "\t<td>" . "<select name='assisted_frequency'> <option value='Monthly'>Monthly</option> <option value='Weekly'>Weekly</option> <option value='Daily'>Daily</option> <option value='Hourly'>Hourly</option> <option value='One-Time'>One-Time</option> </select>" . "</td>\n</tr>\n"; $array[$row] = array( $arraydesc[$row] = $_POST['description'], $arrayamto[$row] = $_POST['amount'], $arrayoptid[$row] = $optid, $arrayfreq[$row] = $_POST['frequency'], ); $row ++; } while ($row_options = mysql_fetch_assoc($options)); $counter = $row - 1; ?> I'm having troubles retrieving the information that the user inputs. My intent is to loop through each row after the user has input their information, then upload the mix of my database information and the user's information into another database. For example, the user would see, albeit prettier: form1 Option 1: description [input box] amount [input box] frequency [option box] Option 2: description [input box] amount [input box] frequency [option box] Option 3: description [input box] amount [input box] frequency [option box] Option 4: description [input box] amount [input box] frequency [option box] submit Upon submitting the form above, I'm using a query similar to the following to input the data into the database: for($row=0; $row<=$counter; $row++){ $insertSQL2 = sprintf("INSERT INTO table (option_id, amount, description, frequency) VALUES (%s, %s, %s, %s)", GetSQLValueString($arrayoptid[$row], "int"), GetSQLValueString($arrayamto[$row], "int"), GetSQLValueString($arraydesc[$row], "text"), GetSQLValueString($arrayfreq[$row], "text")); // code to submit query } I've tried for, foreach, arrays (what feels like the everything I know) to post each row (row by row) into the database. I either get just the last row of data, or no data at all. I also worry that the [$row] technique is adding characters to my data. What is the best way to retrieve each row of the user's inputs, then upload this data (row by row) into the database? Also, I would really appreciate your suggestions for improving my coding technique and the approach I'm taking. Thank you, Hangston

    Read the article

  • How to get selected category id after 1st page in pagination?

    - by Surjay
    //$id=$_REQUEST['category']; //$catid=mysql_escape_string($id); $catid = isset($_GET['category']) ? (int)$_GET['category'] : 0; $recordsPerPage =4; 0 // //default startup page $pageNum = 1; if(isset($_GET['p'])) { $pageNum = $_GET['p']; settype($pageNum, 'integer'); } $offset = ($pageNum - 1) * $recordsPerPage; //set the number of columns $columns = 1; //set the number of columns $columns = 1; $query = "SELECT temp_id, temp_img, temp_header, temp_resize, temp_small, temp_name, temp_type, cat_id, col_id, artist_id FROM templates where cat_id = '{$catid}' ORDER BY temp_id DESC LIMIT $offset, $recordsPerPage"; $result = mysql_query($query); //we add this line because we need to know the number of rows $num_rows = mysql_num_rows($result); echo ""; //changed this to a for loop so we can use the number of rows for($i = 0; $i < $num_rows; $i++) { while($row = mysql_fetch_array($result)){ if($i % $columns == 0) { //if there is no remainder, we want to start a new row echo ""; } echo ...........my data(s). if(($i % $columns) == ($columns - 1) || ($i + 1) == $num_rows) { echo ""; } } } echo ""; //} ? <div class="pagination"> <? $query = "SELECT COUNT( temp_id ) AS `temp_date` FROM `templates` where cat_id ='{$catid}'"; $result = mysql_query($query) or die('Mysql Err. 2'); $row = mysql_fetch_assoc($result); $numrows = $row['temp_date']; //$numrows = mysql_num_rows($result); $self = $_SERVER['PHP_SELF']; $maxPage = ceil($numrows/$recordsPerPage); $nav = ''; for($page = 1; $page <= $maxPage; $page++) { if ($page == $pageNum) { $nav .= "$page"; } else { $nav .= "$page"; } } if ($pageNum 1) { $page = $pageNum - 1; $prev = ""; $first = ""; } else { $prev = ' '; $first = ' '; } if ($pageNum < $maxPage) { $page = $pageNum + 1; $next = " "; $last = " "; } else { $next = ' '; $last = ' '; } echo " $first $prev $nav $next $last "; ? Here my ajax code: function GetXmlHttpObject(handler) { var objXMLHttp=null if (window.XMLHttpRequest) { objXMLHttp=new XMLHttpRequest() } else if (window.ActiveXObject) { objXMLHttp=new ActiveXObject("Microsoft.XMLHTTP") } return objXMLHttp } function stateChanged() { if (xmlHttp.readyState==4 || xmlHttp.readyState=="complete") { document.getElementById("txtResult").innerHTML=xmlHttp.responseText } else { //alert(xmlHttp.status); } } function htmlData(url, qStr) { if (url.length==0) { document.getElementById("txtResult").innerHTML=""; return; } xmlHttp=GetXmlHttpObject() if (xmlHttp==null) { alert ("Browser does not support HTTP Request"); return; } url=url+"?"+qStr; url=url+"&sid="+Math.random(); xmlHttp.onreadystatechange=stateChanged; xmlHttp.open("GET",url,true) ; xmlHttp.send(null); }

    Read the article

  • Delaying execution of Javascript function relative to Google Maps / geoxml3 parser?

    - by Terra Fimeira
    I'm working on a implementing a Google map on a website with our own tiles overlays and KML elements. I've been previously requested to create code so that, for instance, when the page is loaded from a specific URL, it would initialize with one of the tile overlays already enabled. Recently, I've been requested to do the same for the buildings which are outlined by KML elements so that, arriving at the page with a specific URL, it would automatically zoom, center, and display information on the building. However, while starting with the tile overlays work, the building KML does not. After doing some testing, I've determined that when the code which checks the URL executes, the page is still loading the KML elements and thus do not exist for the code to compare to or use: Code for evaluating URL (placed at the end of onLoad="initialize()") function urlClick() { var currentURL = window.location.href; //Retrieve page URL var URLpiece = currentURL.slice(-6); //pull the last 6 digits (for testing) if (URLpiece === "access") { //If the resulting string is "access": access_click(); //Display accessibility overlay } else if (URLpiece === "middle") { //Else if the string is "middle": facetClick('Middle College'); //Click on building "Middle College" }; }; facetClick(); function facetClick(name) { //Convert building name to building ID. for (var i = 0; i < active.placemarks.length; i++) { if (active.placemarks[i].name === name) { sideClick(i) //Click building whose id matches "Middle College" }; }; }; Firebug Console Error active is null for (var i = 0; i < active.placemarks.length; i++) { active.placemarks is which KML elements are loaded on the page, and being null, means no KML has been loaded yet. In short, I have a mistiming and I can't seem to find a suitable place to place the URL code to execute after the KMl has loaded. As noted above, I placed it at the end of onLoad="initialize()", but it would appear that, instead of waiting for the KML to completely load earlier in the function, the remainder of the function is executed: onLoad="initialize()" information(); //Use the buttons variables inital state to set up description buttons(); //and button state button_hover(0); //and button description to neutral. //Create and arrange the Google Map. //Create basic tile overlays. //Set up parser to work with KML elements. myParser = new geoXML3.parser({ //Parser: Takes KML and converts to JS. map: map, //Applies parsed KML to the map singleInfoWindow: true, afterParse: useTheData //Allows us to use the parsed KML in a function }); myParser.parse(['/maps/kml/shapes.kml','/maps/kml/shapes_hidden.kml']); google.maps.event.addListener(map, 'maptypeid_changed', function() { autoOverlay(); }); //Create other tile overlays to appear over KML elements. urlClick(); I suspect one my issues lies in using the geoxml3 parser (http://code.google.com/p/geoxml3/) which converts our KML files to Javascript. While the page has completed loading all of the elements, the map on the page is still loading, including the KML elements. I have also tried placing urlClick() in the parser itself in various places which appear to execute after all the shapes have been parsed, but I've had no success there either. While I've been intending to strip out the parser, I would like to know if there is any way of executing the "urlClick" after the parser has returned the KML shapes. Ideally, I don't want to use an arbitrary means of defining a time to wait, such as "wait 3 seconds, and go", as my various browsers all load the page at different times; rather, I'm looking for some way to say "when the parser is done, execute" or "when the Google map is completely loaded, execute" or perhaps even "hold until the parser is complete before advancing to urlClick".

    Read the article

  • Retrieving multiple rows from a loop-created form... Stuck.

    - by hangston
    Let me start by saying that I'm new to PHP, but I'm here to learn and would really appreciate your help. I use the following code to pull in data and create a form. This creates up to 40 lines for a user to fill out. Each line consists of the same information: Description, Amount, and Frequency. The remainder of the information needed is generated by the database. (See hidden fields) <?php $row = 0; do { $optid = $row_options['option_id']; echo "<tr>\n\t<td>" . htmlentities($row_options['option']) . "</td>\n"; echo "\t<td>" . "<input name='description' type='text' size='40' maxlength='120'/>" . "</td>\n"; echo "\t<td>" . "<input name='option_id' type='hidden' value='$optid' />$<input name='amount' type='text' size='10' maxlength='7'/>" . "</td>\n"; echo "\t<td>" . "<select name='assisted_frequency'> <option value='Monthly'>Monthly</option> <option value='Weekly'>Weekly</option> <option value='Daily'>Daily</option> <option value='Hourly'>Hourly</option> <option value='One-Time'>One-Time</option> </select>" . "</td>\n</tr>\n"; $array[$row] = array( $arraydesc[$row] = $_POST['description'], $arrayamto[$row] = $_POST['amount'], $arrayoptid[$row] = $optid, $arrayfreq[$row] = $_POST['frequency'], ); $row ++; } while ($row_options = mysql_fetch_assoc($options)); $counter = $row - 1; ?> I'm having troubles retrieving the information that the user inputs. My intent is to loop through each row after the user has input their information, then upload the mix of my database information and the user's information into another database. For example, the user would see, albeit prettier: form1 Option 1: description [input box] amount [input box] frequency [option box] Option 2: description [input box] amount [input box] frequency [option box] Option 3: description [input box] amount [input box] frequency [option box] Option 4: description [input box] amount [input box] frequency [option box] submit Upon submitting the form above, I'm using a query similar to the following to input the data into the database: for($row=0; $row<=$counter; $row++){ $insertSQL2 = sprintf("INSERT INTO table (option_id, amount, description, frequency) VALUES (%s, %s, %s, %s)", GetSQLValueString($arrayoptid[$row], "int"), GetSQLValueString($arrayamto[$row], "int"), GetSQLValueString($arraydesc[$row], "text"), GetSQLValueString($arrayfreq[$row], "text")); // code to submit query } I've tried for, foreach, arrays (what feels like the everything I know) to post each row (row by row) into the database. I either get just the last row of data, or no data at all. I also worry that the [$row] technique is adding characters to my data. What is the best way to retrieve each row of the user's inputs, then upload this data (row by row) into the database? Also, I would really appreciate your suggestions for improving my coding technique and the approach I'm taking.

    Read the article

  • Heaps of Trouble?

    - by Paul White NZ
    If you’re not already a regular reader of Brad Schulz’s blog, you’re missing out on some great material.  In his latest entry, he is tasked with optimizing a query run against tables that have no indexes at all.  The problem is, predictably, that performance is not very good.  The catch is that we are not allowed to create any indexes (or even new statistics) as part of our optimization efforts. In this post, I’m going to look at the problem from a slightly different angle, and present an alternative solution to the one Brad found.  Inevitably, there’s going to be some overlap between our entries, and while you don’t necessarily need to read Brad’s post before this one, I do strongly recommend that you read it at some stage; he covers some important points that I won’t cover again here. The Example We’ll use data from the AdventureWorks database, copied to temporary unindexed tables.  A script to create these structures is shown below: CREATE TABLE #Custs ( CustomerID INTEGER NOT NULL, TerritoryID INTEGER NULL, CustomerType NCHAR(1) COLLATE SQL_Latin1_General_CP1_CI_AI NOT NULL, ); GO CREATE TABLE #Prods ( ProductMainID INTEGER NOT NULL, ProductSubID INTEGER NOT NULL, ProductSubSubID INTEGER NOT NULL, Name NVARCHAR(50) COLLATE SQL_Latin1_General_CP1_CI_AI NOT NULL, ); GO CREATE TABLE #OrdHeader ( SalesOrderID INTEGER NOT NULL, OrderDate DATETIME NOT NULL, SalesOrderNumber NVARCHAR(25) COLLATE SQL_Latin1_General_CP1_CI_AI NOT NULL, CustomerID INTEGER NOT NULL, ); GO CREATE TABLE #OrdDetail ( SalesOrderID INTEGER NOT NULL, OrderQty SMALLINT NOT NULL, LineTotal NUMERIC(38,6) NOT NULL, ProductMainID INTEGER NOT NULL, ProductSubID INTEGER NOT NULL, ProductSubSubID INTEGER NOT NULL, ); GO INSERT #Custs ( CustomerID, TerritoryID, CustomerType ) SELECT C.CustomerID, C.TerritoryID, C.CustomerType FROM AdventureWorks.Sales.Customer C WITH (TABLOCK); GO INSERT #Prods ( ProductMainID, ProductSubID, ProductSubSubID, Name ) SELECT P.ProductID, P.ProductID, P.ProductID, P.Name FROM AdventureWorks.Production.Product P WITH (TABLOCK); GO INSERT #OrdHeader ( SalesOrderID, OrderDate, SalesOrderNumber, CustomerID ) SELECT H.SalesOrderID, H.OrderDate, H.SalesOrderNumber, H.CustomerID FROM AdventureWorks.Sales.SalesOrderHeader H WITH (TABLOCK); GO INSERT #OrdDetail ( SalesOrderID, OrderQty, LineTotal, ProductMainID, ProductSubID, ProductSubSubID ) SELECT D.SalesOrderID, D.OrderQty, D.LineTotal, D.ProductID, D.ProductID, D.ProductID FROM AdventureWorks.Sales.SalesOrderDetail D WITH (TABLOCK); The query itself is a simple join of the four tables: SELECT P.ProductMainID AS PID, P.Name, D.OrderQty, H.SalesOrderNumber, H.OrderDate, C.TerritoryID FROM #Prods P JOIN #OrdDetail D ON P.ProductMainID = D.ProductMainID AND P.ProductSubID = D.ProductSubID AND P.ProductSubSubID = D.ProductSubSubID JOIN #OrdHeader H ON D.SalesOrderID = H.SalesOrderID JOIN #Custs C ON H.CustomerID = C.CustomerID ORDER BY P.ProductMainID ASC OPTION (RECOMPILE, MAXDOP 1); Remember that these tables have no indexes at all, and only the single-column sampled statistics SQL Server automatically creates (assuming default settings).  The estimated query plan produced for the test query looks like this (click to enlarge): The Problem The problem here is one of cardinality estimation – the number of rows SQL Server expects to find at each step of the plan.  The lack of indexes and useful statistical information means that SQL Server does not have the information it needs to make a good estimate.  Every join in the plan shown above estimates that it will produce just a single row as output.  Brad covers the factors that lead to the low estimates in his post. In reality, the join between the #Prods and #OrdDetail tables will produce 121,317 rows.  It should not surprise you that this has rather dire consequences for the remainder of the query plan.  In particular, it makes a nonsense of the optimizer’s decision to use Nested Loops to join to the two remaining tables.  Instead of scanning the #OrdHeader and #Custs tables once (as it expected), it has to perform 121,317 full scans of each.  The query takes somewhere in the region of twenty minutes to run to completion on my development machine. A Solution At this point, you may be thinking the same thing I was: if we really are stuck with no indexes, the best we can do is to use hash joins everywhere. We can force the exclusive use of hash joins in several ways, the two most common being join and query hints.  A join hint means writing the query using the INNER HASH JOIN syntax; using a query hint involves adding OPTION (HASH JOIN) at the bottom of the query.  The difference is that using join hints also forces the order of the join, whereas the query hint gives the optimizer freedom to reorder the joins at its discretion. Adding the OPTION (HASH JOIN) hint results in this estimated plan: That produces the correct output in around seven seconds, which is quite an improvement!  As a purely practical matter, and given the rigid rules of the environment we find ourselves in, we might leave things there.  (We can improve the hashing solution a bit – I’ll come back to that later on). Faster Nested Loops It might surprise you to hear that we can beat the performance of the hash join solution shown above using nested loops joins exclusively, and without breaking the rules we have been set. The key to this part is to realize that a condition like (A = B) can be expressed as (A <= B) AND (A >= B).  Armed with this tremendous new insight, we can rewrite the join predicates like so: SELECT P.ProductMainID AS PID, P.Name, D.OrderQty, H.SalesOrderNumber, H.OrderDate, C.TerritoryID FROM #OrdDetail D JOIN #OrdHeader H ON D.SalesOrderID >= H.SalesOrderID AND D.SalesOrderID <= H.SalesOrderID JOIN #Custs C ON H.CustomerID >= C.CustomerID AND H.CustomerID <= C.CustomerID JOIN #Prods P ON P.ProductMainID >= D.ProductMainID AND P.ProductMainID <= D.ProductMainID AND P.ProductSubID = D.ProductSubID AND P.ProductSubSubID = D.ProductSubSubID ORDER BY D.ProductMainID OPTION (RECOMPILE, LOOP JOIN, MAXDOP 1, FORCE ORDER); I’ve also added LOOP JOIN and FORCE ORDER query hints to ensure that only nested loops joins are used, and that the tables are joined in the order they appear.  The new estimated execution plan is: This new query runs in under 2 seconds. Why Is It Faster? The main reason for the improvement is the appearance of the eager Index Spools, which are also known as index-on-the-fly spools.  If you read my Inside The Optimiser series you might be interested to know that the rule responsible is called JoinToIndexOnTheFly. An eager index spool consumes all rows from the table it sits above, and builds a index suitable for the join to seek on.  Taking the index spool above the #Custs table as an example, it reads all the CustomerID and TerritoryID values with a single scan of the table, and builds an index keyed on CustomerID.  The term ‘eager’ means that the spool consumes all of its input rows when it starts up.  The index is built in a work table in tempdb, has no associated statistics, and only exists until the query finishes executing. The result is that each unindexed table is only scanned once, and just for the columns necessary to build the temporary index.  From that point on, every execution of the inner side of the join is answered by a seek on the temporary index – not the base table. A second optimization is that the sort on ProductMainID (required by the ORDER BY clause) is performed early, on just the rows coming from the #OrdDetail table.  The optimizer has a good estimate for the number of rows it needs to sort at that stage – it is just the cardinality of the table itself.  The accuracy of the estimate there is important because it helps determine the memory grant given to the sort operation.  Nested loops join preserves the order of rows on its outer input, so sorting early is safe.  (Hash joins do not preserve order in this way, of course). The extra lazy spool on the #Prods branch is a further optimization that avoids executing the seek on the temporary index if the value being joined (the ‘outer reference’) hasn’t changed from the last row received on the outer input.  It takes advantage of the fact that rows are still sorted on ProductMainID, so if duplicates exist, they will arrive at the join operator one after the other. The optimizer is quite conservative about introducing index spools into a plan, because creating and dropping a temporary index is a relatively expensive operation.  It’s presence in a plan is often an indication that a useful index is missing. I want to stress that I rewrote the query in this way primarily as an educational exercise – I can’t imagine having to do something so horrible to a production system. Improving the Hash Join I promised I would return to the solution that uses hash joins.  You might be puzzled that SQL Server can create three new indexes (and perform all those nested loops iterations) faster than it can perform three hash joins.  The answer, again, is down to the poor information available to the optimizer.  Let’s look at the hash join plan again: Two of the hash joins have single-row estimates on their build inputs.  SQL Server fixes the amount of memory available for the hash table based on this cardinality estimate, so at run time the hash join very quickly runs out of memory. This results in the join spilling hash buckets to disk, and any rows from the probe input that hash to the spilled buckets also get written to disk.  The join process then continues, and may again run out of memory.  This is a recursive process, which may eventually result in SQL Server resorting to a bailout join algorithm, which is guaranteed to complete eventually, but may be very slow.  The data sizes in the example tables are not large enough to force a hash bailout, but it does result in multiple levels of hash recursion.  You can see this for yourself by tracing the Hash Warning event using the Profiler tool. The final sort in the plan also suffers from a similar problem: it receives very little memory and has to perform multiple sort passes, saving intermediate runs to disk (the Sort Warnings Profiler event can be used to confirm this).  Notice also that because hash joins don’t preserve sort order, the sort cannot be pushed down the plan toward the #OrdDetail table, as in the nested loops plan. Ok, so now we understand the problems, what can we do to fix it?  We can address the hash spilling by forcing a different order for the joins: SELECT P.ProductMainID AS PID, P.Name, D.OrderQty, H.SalesOrderNumber, H.OrderDate, C.TerritoryID FROM #Prods P JOIN #Custs C JOIN #OrdHeader H ON H.CustomerID = C.CustomerID JOIN #OrdDetail D ON D.SalesOrderID = H.SalesOrderID ON P.ProductMainID = D.ProductMainID AND P.ProductSubID = D.ProductSubID AND P.ProductSubSubID = D.ProductSubSubID ORDER BY D.ProductMainID OPTION (MAXDOP 1, HASH JOIN, FORCE ORDER); With this plan, each of the inputs to the hash joins has a good estimate, and no hash recursion occurs.  The final sort still suffers from the one-row estimate problem, and we get a single-pass sort warning as it writes rows to disk.  Even so, the query runs to completion in three or four seconds.  That’s around half the time of the previous hashing solution, but still not as fast as the nested loops trickery. Final Thoughts SQL Server’s optimizer makes cost-based decisions, so it is vital to provide it with accurate information.  We can’t really blame the performance problems highlighted here on anything other than the decision to use completely unindexed tables, and not to allow the creation of additional statistics. I should probably stress that the nested loops solution shown above is not one I would normally contemplate in the real world.  It’s there primarily for its educational and entertainment value.  I might perhaps use it to demonstrate to the sceptical that SQL Server itself is crying out for an index. Be sure to read Brad’s original post for more details.  My grateful thanks to him for granting permission to reuse some of his material. Paul White Email: [email protected] Twitter: @PaulWhiteNZ

    Read the article

  • CodePlex Daily Summary for Friday, March 26, 2010

    CodePlex Daily Summary for Friday, March 26, 2010New Projects.NET settings class generator T4 templates: A couple of T4 templates to generate a Settings class for your .NET project. Allows you to define your application settings in an XML file and have...AlphaPagedList: AlphaPagedList makes it easier for .Net developers to write paging code. Based on PagedList it allows you to take any List<T> and split it based on...C# Projects: C# ProjectsChitme: Aenean feugiat pharetra enim rhoncus viverra. In at nunc nec sem varius bibendum. Aliquam erat volutpat. Nullam fringilla facilisis massa et eleife...CloudCache - Distributed Cache Tier with Azure: Cloudcache makes it easier for you to manage and deploy a distributed caching tier to Windows Azure. Included is a web-dashboard in MVC 2.0, Memcac...Composer: Composer is an extensible Compositional Architecture framework, providing a set of functionality such as Inversion of Control container (IoC), Depe...Data Connection Suite: Data Connection Suite is a set of easy to use data connection string builder dialogs & controls ready to be integrated in any .NET application.DatabaseHandler: Database HandlerEPiServer Blog Page Provider: A example page provider implementation for EPiServer that supports external blog sources for pages, Blogger and WordPress supported out of the box ...Extended MessageBox: ExtendedMessageBox makes it easier to display messages from your Windows applications. Based on the built-in .NET MessageBox class functionality, i...FluentPath: FluentPath implements a modern wrapper around System.IO, using modern patterns such as fluent APIs and Lambdas. By using FluentPath instead of Syst...Halcyone : Silverlight without pain: Halcyone is application framework for Silverlight that should make live of developers easier =)IlluminaRT: Real-time renderingme2: Mista Engine 2MessegeBox RightToLeft Lib: This is really simple lib project for use RTL in MessegeBox class. This just for short code and default option for RTL.MS Word Automation Service: A MS Word Automation service that comsumes a Word template and combines with XML to produce a word document. Currently in production. Must add some...SharePoint - Site Request InfoPath Form Template: This template allow portal user to enter initial information for requesting of creating a new SharePoint site. TextFlow - Text Editor: TextFlow is a fast and light text editor that simplifies day-to-day tasks. You can create letters and documents through TextFlow. It also includes ...TiledLib: A library for using Tiled (http://mapeditor.org) levels in XNA Game Studio projects. Includes a content pipeline extension and runtime library.wcf learning 2010: myWCFprojectsNew Releases.NET settings class generator T4 templates: Example 1: An example project containing the T4 templates and associated files. SingleSite - generate settings for a single site MultiSite - generate setting...AccessibilityChecker: Accessibility Checker V0.1: SharePoint Accessibility Checker V0.1AlphaPagedList: AlphaPagedList v0.9: Initial release of AlphaPagedListASP.Net RIA Controls: Version 1.1 Beta: New XHTML compliant version with alternative content support if no plugin installed.Business & System Analysis Templates and Best Practices: R 00: You may find out here the structured on my own materials from from Luxoft ReqLabs 2009 + short presentation about System Analysis and Modelling. Th...CloudCache - Distributed Cache Tier with Azure: v1.0.0.0: First release! More information at http://blog.shutupandcode.net/?p=935CycleMania Starter Kit EAP - ASP.NET 4 Problem - Design - Solution: Cyclemania 0.08.39: implemented client side functions on remainder of account pagesDevTreks -social budgeting that improves lives and livelihoods: Social Budgeting Web Software, DevTreks alpha 3d: Alpha 3d is a general bug fix -tweaking pagination, navigation, packaging, file system storage, page validation, security, locals, and linked views.Digital Media Processing Project 1: Image Processor: Image Processor 1.01: Supports opening files through Windows Explorer or by drag and drop.Extended MessageBox: ExtendedMessageBox Runtime Version 1.2: Initial releaseExtended MessageBox: SourceCode for Version 1.2: Initial SourceCodeFluent Ribbon Control Suite: Fluent Ribbon Control Suite 1.0: Fluent Ribbon Control Suite 1.0 Includes: Fluent.dll (with .pdb and .xml, debug and release version) Showcase Application Samples Foundation (T...FluentPath: FluentPath Beta: The Beta release of FluentPath.HaterAide ORM: HaterAide ORM 1.5: This version is a, more or less, rewrite of the code base. Also many new features have been added in this release: 1) Foreign keys are now added to...iTuner - The iTunes Companion: iTuner 1.2.3735 Beta: V1.2 allows you to synchronize one or more iTunes playlists to a USB MP3 player. This continues the evolution yet maintains the minimalistic appro...LogWin-Logging Your Computer Activities: LogWin-Logging your computer activities: This program is logging your computer activities and display them as table and pie chart. It is made by native C , HTML Dialog and Google Chart API.MessegeBox RightToLeft Lib: MessegeBoxRTL-1.0.0.0_BIN: My First upload.. This is binary release only. Have fun.MessegeBox RightToLeft Lib: MessegeBoxRTL-1.0.0.0_SRC: My first upload.. This is source code with binary. Have fun.MS Word Automation Service: Alpha: In production already, but who cares. It works.MultiMenu ASP.NET Cascading Menu WebControl: MultiMenu 2.6 ASP.NET Menu: Fixed problems that prevented the menu from working with the XHTML DocTypes Added support for IE 7-8 Added XmlLoading and XmlLoaded events Ad...netgod: LanyoWebBrowser: Lanyo ERP ClientnopCommerce. Open Source online shop e-commerce solution.: nopCommerce 1.50: To see the full list of fixes and changes please visit the release notes page (http://www.nopCommerce.com/ReleaseNotes.aspx).Open NFe: Open NFe v1.9.7: Fontes do DANFe 1.9.7 Trim na conversão TXT para XMLpatterns & practices - Smart Client Guidance: Smart Client Software Factory 2010 Beta Source: The Smart Client Software Factory 2010 provides an integrated set of guidance that assists architects and developers in creating composite smart cl...Physics Helper for Silverlight, WPF, Blend, and Farseer: PhysicsHelper 3.0.0.5 Alpha: This release supports Windows Phone 7 Series Development, along with the Silverlight 3 and WPF support. It requires Visual Studio 2010, plus the Wi...Protein Insight: ProteinInsight V2.0.1: Protein Insight is protein structure visualization system. Visualization rendering engine is based on native C and Direct3D, plug-in is based on CL...PSFGeneric: ERP / CRM business management and administration: PSFGeneric 1.4.0.9000 Manual and power-ups ASNIA: PSFGeneric 1.4.0.9000 Tareas 2.1.0 MySQL Persistente 1.0.3 TM-U220 40 col. Driver 1.0.0 Gestor Contable Básico 1.1.2.1 Cafetería 1.1.6 Catalogo 1....QuestTracker: QuestTracker 0.2: Primary new feature: Import/Export Quest Log. Deleting anything will cause an automatic export prior to deletion, automatically backing up your log...Reusable Library: V1.0.5: A collection of reusable abstractions for enterprise application developer.Reusable Library Demo: Reusable Library Demo v1.0.3: A demonstration of reusable abstractions for enterprise application developerSharePoint - Site Request InfoPath Form Template: SharePoint - Site Request InfoPath Form Template: This template allow portal user to enter initial information for requesting of creating a new SharePoint site To install: 1. Run the SiteRequest.m...Silverlight Gantt Chart: Silverlight Gantt Chart 1.2: Updates include ability to add GanttNodeSections that allow for multiple GanttItems in a single row.Spiral Architecture Driven Development (SADD): SADD v.1.0: This is the First complete Release with the NEW materials now all in English ! The abstract from the main article named "SADD-MSAJ-The Spiral Arc...Spiral Architecture Driven Development (SADD) for Russian: SADD v.1.0: Это Первая Версия полного релиза SADD на русском языке. Отрывок из этой статьи опубликован в Microsoft Architecture Journal #23, вы можете найти в ...Sprite Sheet Packer: 2.3 Release: SpriteSheetPacker now supports saved user settings so the app will now remember your previous values for padding, image size, image options, whethe...Standalone XQuery Implementation in .NET: 1.4: This is version 1.4 of the QueryMachine.XQuery. It's includes bug fixes and performance optimization. Document load time is dramatically increased...TextFlow - Text Editor: Kernel: TextFlow core KernelTextFlow - Text Editor: TextFlow Beta 3 Technical Preview: This is a technical preview of TextFlow and is made to run for 40 days after which it will expire. Changes : 140 Bug fixes Supports Windows(R) 7...TiledLib: TiledLib 1.0: First release of TiledLib. This download is for prebuilt DLLs and a demo project. For the full source code, use the Source Code tab to download the...UnGrouper: Current build: This is a preview build. Hide and show the main window with winkey+a. IMPORTANT NOTE: You must close all applications before launching this build ...VCC: Latest build, v2.1.30325.0: Automatic drop of latest buildWCF Metal: WCFMetal 0.3.0.0: WCFMetal 0.3.0.0Copyright © 2010 John Leitch Distributed under the terms of the GNU General Public License Summary By utilizing LINQ to SQL gene...Web Log Analyzer: Release Indihiang 1.0: For installation and how to use, please read Indihiang portal: http://wiki.indihiang.com What's New in Indihiang 1.0 ? check http://geeks.netindone...異世界の新着動画: Ver. 10-03-25: ニコ生仕様に対応Most Popular ProjectsMetaSharpRawrWBFS ManagerASP.NET Ajax LibrarySilverlight ToolkitMicrosoft SQL Server Product Samples: DatabaseAJAX Control ToolkitLiveUpload to FacebookWindows Presentation Foundation (WPF)ASP.NETMost Active ProjectsRawrjQuery Library for SharePoint Web ServicesBlogEngine.NETFarseer Physics EngineFacebook Developer ToolkitLINQ to TwitterFluent Ribbon Control SuiteTable2ClassNB_Store - Free DotNetNuke Ecommerce Catalog ModulePHPExcel

    Read the article

  • SATA errors reported during boot: exception Emask 0x40 SAct 0x0 SErr 0x80800 action 0x0

    - by digby280
    I have noticed some error during the Linux boot. They seem to continue to occur after the boot adding lines to the log every few seconds. Once booted this normally does not appear to be causing any problems. However, around 1 in 10 boots results in a kernel panic and the computer has on two or three occasions suddenly rebooted after being powered on for a number of hours. I presume the cause of the reboot is a kernel panic as well. I am running Ubuntu 11.10 and I have had Ubuntu installed on the computer for around a year. I have googled around and not found anything useful. I have provided the kernel log lines and the output of smartctl. Can anyone explain exactly what these errors mean, or better still how to resolve them? Apr 2 16:51:27 dell580 kernel: [ 19.831140] EXT4-fs (sdb2): re-mounted. Opts: errors=remount-ro,user_xattr,commit=0 Apr 2 16:51:27 dell580 kernel: [ 19.934194] tg3 0000:03:00.0: eth0: Link is down Apr 2 16:51:28 dell580 kernel: [ 20.929468] tg3 0000:03:00.0: eth0: Link is up at 100 Mbps, full duplex Apr 2 16:51:28 dell580 kernel: [ 20.929471] tg3 0000:03:00.0: eth0: Flow control is on for TX and on for RX Apr 2 16:51:28 dell580 kernel: [ 20.929727] ADDRCONF(NETDEV_CHANGE): eth0: link becomes ready Apr 2 16:51:29 dell580 kernel: [ 21.609381] EXT4-fs (sdb2): re-mounted. Opts: errors=remount-ro,user_xattr,commit=0 Apr 2 16:51:29 dell580 kernel: [ 21.616515] ata2.01: exception Emask 0x40 SAct 0x0 SErr 0x80800 action 0x0 Apr 2 16:51:29 dell580 kernel: [ 21.616519] ata2.01: SError: { HostInt 10B8B } Apr 2 16:51:29 dell580 kernel: [ 21.616525] ata2.00: hard resetting link Apr 2 16:51:29 dell580 kernel: [ 21.934036] ata2.01: hard resetting link Apr 2 16:51:29 dell580 kernel: [ 22.408890] ata2.00: SATA link up 1.5 Gbps (SStatus 113 SControl 300) Apr 2 16:51:29 dell580 kernel: [ 22.408907] ata2.01: SATA link up 3.0 Gbps (SStatus 123 SControl 300) Apr 2 16:51:29 dell580 kernel: [ 22.440934] ata2.00: configured for UDMA/100 Apr 2 16:51:29 dell580 kernel: [ 22.449040] ata2.01: configured for UDMA/133 Apr 2 16:51:29 dell580 kernel: [ 22.449818] ata2: EH complete Apr 2 16:51:33 dell580 kernel: [ 26.122664] ata2.01: exception Emask 0x40 SAct 0x0 SErr 0x80800 action 0x0 Apr 2 16:51:33 dell580 kernel: [ 26.122670] ata2.01: SError: { HostInt 10B8B } Apr 2 16:51:33 dell580 kernel: [ 26.122677] ata2.00: hard resetting link Apr 2 16:51:33 dell580 kernel: [ 26.442684] ata2.01: hard resetting link Apr 2 16:51:34 dell580 kernel: [ 26.925545] ata2.00: SATA link up 1.5 Gbps (SStatus 113 SControl 300) Apr 2 16:51:34 dell580 kernel: [ 26.925561] ata2.01: SATA link up 3.0 Gbps (SStatus 123 SControl 300) Apr 2 16:51:34 dell580 kernel: [ 26.961542] ata2.00: configured for UDMA/100 Apr 2 16:51:34 dell580 kernel: [ 26.969616] ata2.01: configured for UDMA/133 Apr 2 16:51:34 dell580 kernel: [ 26.970400] ata2: EH complete Apr 2 16:51:35 dell580 kernel: [ 28.111180] ata2.01: exception Emask 0x40 SAct 0x0 SErr 0x80800 action 0x0 Apr 2 16:51:35 dell580 kernel: [ 28.111184] ata2.01: SError: { HostInt 10B8B } Apr 2 16:51:35 dell580 kernel: [ 28.111191] ata2.00: hard resetting link Apr 2 16:51:35 dell580 kernel: [ 28.429674] ata2.01: hard resetting link Apr 2 16:51:36 dell580 kernel: [ 28.904557] ata2.00: SATA link up 1.5 Gbps (SStatus 113 SControl 300) Apr 2 16:51:36 dell580 kernel: [ 28.904572] ata2.01: SATA link up 3.0 Gbps (SStatus 123 SControl 300) Apr 2 16:51:36 dell580 kernel: [ 28.936609] ata2.00: configured for UDMA/100 Apr 2 16:51:36 dell580 kernel: [ 28.944692] ata2.01: configured for UDMA/133 Apr 2 16:51:36 dell580 kernel: [ 28.945464] ata2: EH complete Apr 2 16:51:38 dell580 kernel: [ 31.581756] eth0: no IPv6 routers present Apr 2 16:51:38 dell580 kernel: [ 32.103066] ata2.01: exception Emask 0x40 SAct 0x0 SErr 0x80800 action 0x0 Apr 2 16:51:38 dell580 kernel: [ 32.103074] ata2.01: SError: { HostInt 10B8B } Apr 2 16:51:38 dell580 kernel: [ 32.103085] ata2.00: hard resetting link Apr 2 16:51:38 dell580 kernel: [ 32.419669] ata2.01: hard resetting link Apr 2 16:51:39 dell580 kernel: [ 32.894518] ata2.00: SATA link up 1.5 Gbps (SStatus 113 SControl 300) Apr 2 16:51:39 dell580 kernel: [ 32.894533] ata2.01: SATA link up 3.0 Gbps (SStatus 123 SControl 300) Apr 2 16:51:39 dell580 kernel: [ 32.926536] ata2.00: configured for UDMA/100 Apr 2 16:51:39 dell580 kernel: [ 32.934715] ata2.01: configured for UDMA/133 Apr 2 16:51:39 dell580 kernel: [ 32.935578] ata2: EH complete Here's the output of smartctl for the drive. smartctl 5.41 2011-06-09 r3365 [x86_64-linux-3.0.0-17-generic] (local build) Copyright (C) 2002-11 by Bruce Allen, http://smartmontools.sourceforge.net === START OF INFORMATION SECTION === Model Family: SAMSUNG SpinPoint F1 DT Device Model: SAMSUNG HD103UJ Serial Number: S13PJ90QC19706 LU WWN Device Id: 5 0000f0 00b1c7960 Firmware Version: 1AA01113 User Capacity: 1,000,204,886,016 bytes [1.00 TB] Sector Size: 512 bytes logical/physical Device is: In smartctl database [for details use: -P show] ATA Version is: 8 ATA Standard is: ATA-8-ACS revision 3b Local Time is: Mon Apr 2 17:13:48 2012 BST SMART support is: Available - device has SMART capability. SMART support is: Enabled === START OF READ SMART DATA SECTION === SMART overall-health self-assessment test result: PASSED General SMART Values: Offline data collection status: (0x00) Offline data collection activity was never started. Auto Offline Data Collection: Disabled. Self-test execution status: ( 41) The self-test routine was interrupted by the host with a hard or soft reset. Total time to complete Offline data collection: (11772) seconds. Offline data collection capabilities: (0x7b) SMART execute Offline immediate. Auto Offline data collection on/off support. Suspend Offline collection upon new command. Offline surface scan supported. Self-test supported. Conveyance Self-test supported. Selective Self-test supported. SMART capabilities: (0x0003) Saves SMART data before entering power-saving mode. Supports SMART auto save timer. Error logging capability: (0x01) Error logging supported. General Purpose Logging supported. Short self-test routine recommended polling time: ( 2) minutes. Extended self-test routine recommended polling time: ( 197) minutes. Conveyance self-test routine recommended polling time: ( 21) minutes. SCT capabilities: (0x003f) SCT Status supported. SCT Error Recovery Control supported. SCT Feature Control supported. SCT Data Table supported. SMART Attributes Data Structure revision number: 16 Vendor Specific SMART Attributes with Thresholds: ID# ATTRIBUTE_NAME FLAG VALUE WORST THRESH TYPE UPDATED WHEN_FAILED RAW_VALUE 1 Raw_Read_Error_Rate 0x000f 100 100 051 Pre-fail Always - 0 3 Spin_Up_Time 0x0007 076 076 011 Pre-fail Always - 7940 4 Start_Stop_Count 0x0032 099 099 000 Old_age Always - 521 5 Reallocated_Sector_Ct 0x0033 100 100 010 Pre-fail Always - 0 7 Seek_Error_Rate 0x000f 253 253 051 Pre-fail Always - 0 8 Seek_Time_Performance 0x0025 100 100 015 Pre-fail Offline - 0 9 Power_On_Hours 0x0032 100 100 000 Old_age Always - 642 10 Spin_Retry_Count 0x0033 100 100 051 Pre-fail Always - 0 11 Calibration_Retry_Count 0x0012 100 100 000 Old_age Always - 0 12 Power_Cycle_Count 0x0032 100 100 000 Old_age Always - 482 13 Read_Soft_Error_Rate 0x000e 100 100 000 Old_age Always - 0 183 Runtime_Bad_Block 0x0032 100 100 000 Old_age Always - 759 184 End-to-End_Error 0x0033 100 100 000 Pre-fail Always - 0 187 Reported_Uncorrect 0x0032 100 100 000 Old_age Always - 0 188 Command_Timeout 0x0032 100 100 000 Old_age Always - 0 190 Airflow_Temperature_Cel 0x0022 073 069 000 Old_age Always - 27 (Min/Max 16/27) 194 Temperature_Celsius 0x0022 073 067 000 Old_age Always - 27 (Min/Max 16/28) 195 Hardware_ECC_Recovered 0x001a 100 100 000 Old_age Always - 320028 196 Reallocated_Event_Count 0x0032 100 100 000 Old_age Always - 0 197 Current_Pending_Sector 0x0012 100 100 000 Old_age Always - 0 198 Offline_Uncorrectable 0x0030 100 100 000 Old_age Offline - 0 199 UDMA_CRC_Error_Count 0x003e 099 099 000 Old_age Always - 1494 200 Multi_Zone_Error_Rate 0x000a 100 100 000 Old_age Always - 0 201 Soft_Read_Error_Rate 0x000a 253 253 000 Old_age Always - 0 SMART Error Log Version: 1 ATA Error Count: 211 (device log contains only the most recent five errors) CR = Command Register [HEX] FR = Features Register [HEX] SC = Sector Count Register [HEX] SN = Sector Number Register [HEX] CL = Cylinder Low Register [HEX] CH = Cylinder High Register [HEX] DH = Device/Head Register [HEX] DC = Device Command Register [HEX] ER = Error register [HEX] ST = Status register [HEX] Powered_Up_Time is measured from power on, and printed as DDd+hh:mm:SS.sss where DD=days, hh=hours, mm=minutes, SS=sec, and sss=millisec. It "wraps" after 49.710 days. Error 211 occurred at disk power-on lifetime: 0 hours (0 days + 0 hours) When the command that caused the error occurred, the device was active or idle. After command completion occurred, registers were: ER ST SC SN CL CH DH -- -- -- -- -- -- -- 84 51 0f 31 63 8f e1 Error: ICRC, ABRT 15 sectors at LBA = 0x018f6331 = 26174257 Commands leading to the command that caused the error were: CR FR SC SN CL CH DH DC Powered_Up_Time Command/Feature_Name -- -- -- -- -- -- -- -- ---------------- -------------------- c8 00 00 40 62 8f e1 08 00:01:00.460 READ DMA c8 00 20 00 7c 30 e0 08 00:01:00.450 READ DMA c8 00 00 10 49 8f e1 08 00:01:00.440 READ DMA c8 00 e0 20 d0 30 e0 08 00:01:00.420 READ DMA c8 00 00 c0 59 90 e1 08 00:01:00.400 READ DMA Error 210 occurred at disk power-on lifetime: 0 hours (0 days + 0 hours) When the command that caused the error occurred, the device was active or idle. After command completion occurred, registers were: ER ST SC SN CL CH DH -- -- -- -- -- -- -- 84 51 cf e9 cf 66 e0 Error: ICRC, ABRT 207 sectors at LBA = 0x0066cfe9 = 6737897 Commands leading to the command that caused the error were: CR FR SC SN CL CH DH DC Powered_Up_Time Command/Feature_Name -- -- -- -- -- -- -- -- ---------------- -------------------- c8 00 00 b8 cf 66 e0 08 00:08:29.780 READ DMA c8 00 60 60 c9 18 e0 08 00:08:29.770 READ DMA c8 00 40 20 c9 18 e0 08 00:08:29.770 READ DMA c8 00 20 00 c9 18 e0 08 00:08:29.760 READ DMA c8 00 20 98 cf 66 e0 08 00:08:29.750 READ DMA Error 209 occurred at disk power-on lifetime: 0 hours (0 days + 0 hours) When the command that caused the error occurred, the device was active or idle. After command completion occurred, registers were: ER ST SC SN CL CH DH -- -- -- -- -- -- -- 84 51 2f d1 74 e0 e0 Error: ICRC, ABRT 47 sectors at LBA = 0x00e074d1 = 14709969 Commands leading to the command that caused the error were: CR FR SC SN CL CH DH DC Powered_Up_Time Command/Feature_Name -- -- -- -- -- -- -- -- ---------------- -------------------- c8 00 00 00 74 e0 e0 08 00:00:30.940 READ DMA c8 00 20 18 36 de e0 08 00:00:30.930 READ DMA c8 00 08 48 f1 dd e0 08 00:00:30.930 READ DMA c8 00 08 a8 f0 dd e0 08 00:00:30.930 READ DMA c8 00 08 90 f0 dd e0 08 00:00:30.930 READ DMA Error 208 occurred at disk power-on lifetime: 0 hours (0 days + 0 hours) When the command that caused the error occurred, the device was active or idle. After command completion occurred, registers were: ER ST SC SN CL CH DH -- -- -- -- -- -- -- 84 51 7f 21 88 9d e0 Error: ICRC, ABRT 127 sectors at LBA = 0x009d8821 = 10324001 Commands leading to the command that caused the error were: CR FR SC SN CL CH DH DC Powered_Up_Time Command/Feature_Name -- -- -- -- -- -- -- -- ---------------- -------------------- c8 00 a0 00 88 9d e0 08 00:00:27.610 READ DMA c8 00 58 a8 e7 9c e0 08 00:00:27.610 READ DMA c8 00 00 28 e6 9c e0 08 00:00:27.610 READ DMA c8 00 00 e0 e4 9c e0 08 00:00:27.610 READ DMA c8 00 00 90 e0 9c e0 08 00:00:27.600 READ DMA Error 207 occurred at disk power-on lifetime: 0 hours (0 days + 0 hours) When the command that caused the error occurred, the device was active or idle. After command completion occurred, registers were: ER ST SC SN CL CH DH -- -- -- -- -- -- -- 04 51 26 6a 6a c3 e0 Error: ABRT at LBA = 0x00c36a6a = 12806762 Commands leading to the command that caused the error were: CR FR SC SN CL CH DH DC Powered_Up_Time Command/Feature_Name -- -- -- -- -- -- -- -- ---------------- -------------------- ca 00 00 90 69 c3 e0 08 00:29:39.350 WRITE DMA ca 00 40 90 68 c3 e0 08 00:29:39.350 WRITE DMA ca 00 40 50 65 c3 e0 08 00:29:39.350 WRITE DMA ca 00 40 d0 64 c3 e0 08 00:29:39.350 WRITE DMA ca 00 40 90 63 c3 e0 08 00:29:39.350 WRITE DMA SMART Self-test log structure revision number 1 Num Test_Description Status Remaining LifeTime(hours) LBA_of_first_error # 1 Short offline Interrupted (host reset) 90% 638 - # 2 Short offline Interrupted (host reset) 90% 638 - # 3 Extended offline Interrupted (host reset) 90% 638 - # 4 Short offline Interrupted (host reset) 90% 638 - # 5 Extended offline Interrupted (host reset) 90% 638 - SMART Selective self-test log data structure revision number 1 SPAN MIN_LBA MAX_LBA CURRENT_TEST_STATUS 1 0 0 Not_testing 2 0 0 Not_testing 3 0 0 Not_testing 4 0 0 Not_testing 5 0 0 Not_testing Selective self-test flags (0x0): After scanning selected spans, do NOT read-scan remainder of disk. If Selective self-test is pending on power-up, resume after 0 minute delay.

    Read the article

  • Finding the Right Solution to Source and Manage Your Contractors

    - by mark.rosenberg(at)oracle.com
    Many of our PeopleSoft Enterprise applications customers operate in service-based industries, and all of our customers have at least some internal service units, such as IT, marketing, and facilities. Employing the services of contractors, often referred to as "contingent labor," to deliver either or both internal and external services is common practice. As we've transitioned from an industrial age to a knowledge age, talent has become a primary competitive advantage for most organizations. Contingent labor offers talent on flexible terms; it offers the ability to scale up operations, close skill gaps, and manage risk in the process of delivering services. Talent comes from many sources and the rise in the contingent worker (contractor, consultant, temporary, part time) has increased significantly in the past decade and is expected to reach 40 percent in the next decade. Managing the total pool of talent in a seamless integrated fashion not only saves organizations money and increases efficiency, but creates a better place for workers of all kinds to work. Although the term "contingent labor" is frequently used to describe both contractors and employees who have flexible schedules and relationships with an organization, the remainder of this discussion focuses on contractors. The term "contingent labor" is used interchangeably with "contractor." Recognizing the importance of contingent labor, our PeopleSoft customers often ask our team, "What Oracle vendor management system (VMS) applications should I evaluate for managing contractors?" In response, I thought it would be useful to describe and compare the three most common Oracle-based options available to our customers. They are:   The enterprise licensed software model in which you implement and utilize the PeopleSoft Services Procurement (sPro) application and potentially other PeopleSoft applications;  The software-as-a-service model in which you gain access to a derivative of PeopleSoft sPro from an Oracle Business Process Outsourcing Partner; and  The managed service provider (MSP) model in which staffing industry professionals utilize either your enterprise licensed software or the software-as-a-service application to administer your contingent labor program. At this point, you may be asking yourself, "Why three options?" The answer is that since there is no "one size fits all" in terms of talent, there is also no "one size fits all" for effectively sourcing and managing contingent workers. Various factors influence how an organization thinks about and relates to its contractors, and each of the three Oracle-based options addresses an organization's needs and preferences differently. For the purposes of this discussion, I will describe the options with respect to (A) pricing and software provisioning models; (B) control and flexibility; (C) level of engagement with contractors; and (D) approach to sourcing, employment law, and financial settlement. Option 1:  Enterprise Licensed Software In this model, you purchase from Oracle the license and support for the applications you need. Typically, you license PeopleSoft sPro as your VMS tool for sourcing, monitoring, and paying your contract labor. In conjunction with sPro, you can also utilize PeopleSoft Human Capital Management (HCM) applications (if you do not already) to configure more advanced business processes for recruiting, training, and tracking your contractors. Many customers choose this enterprise license software model because of the functionality and natural integration of the PeopleSoft applications and because the cost for the PeopleSoft software is explicit. There is no fee per transaction to source each contractor under this model. Our customers that employ contractors to augment their permanent staff on billable client engagements often find this model appealing because there are no fees to affect their profit margins. With this model, you decide whether to have your own IT organization run the software or have the software hosted and managed by either Oracle or another application services provider. Your organization, perhaps with the assistance of consultants, configures, deploys, and operates the software for managing your contingent workforce. This model offers you the highest level of control and flexibility since your organization can configure the contractor process flow exactly to your business and security requirements and can extend the functionality with PeopleTools. This option has proven very valuable and applicable to our customers engaged in government contracting because their contingent labor management practices are subject to complex standards and regulations. Customers find a great deal of value in the application functionality and configurability the enterprise licensed software offers for managing contingent labor. Some examples of that functionality are... The ability to create a tiered network of preferred suppliers including competencies, pricing agreements, and elaborate candidate management capabilities. Configurable alerts and online collaboration for bid, resource requisition, timesheet, and deliverable entry, routing, and approval for both resource and deliverable-based services. The ability to manage contractors with the same PeopleSoft HCM and Projects applications that are used to manage the permanent workforce. Because it allows you to utilize much of the same PeopleSoft HCM and Projects application functionality for contractors that you use for permanent employees, the enterprise licensed software model supports the deepest level of engagement with the contingent workforce. For example, you can: fill job openings with contingent labor; guide contingent workers through essential safety and compliance training with PeopleSoft Enterprise Learning Management; and source contingent workers directly to project-based assignments in PeopleSoft Resource Management and PeopleSoft Program Management. This option enables contingent workers to collaborate closely with your permanent staff on complex, knowledge-based efforts - R&D projects, billable client contracts, architecture and engineering projects spanning multiple years, and so on. With the enterprise licensed software model, your organization maintains responsibility for the sourcing, onboarding (including adherence to employment laws), and financial settlement processes. This means your organization maintains on staff or hires the expertise in these domains to utilize the software and interact with suppliers and contractors. Option 2:  Software as a Service (SaaS) The effort involved in setting up and operating VMS software to handle a contingent workforce leads many organizations to seek a system that can be activated and configured within a few days and for which they can pay based on usage. Oracle's Business Process Outsourcing partner, Provade, Inc., provides exactly this option to our customers. Provade offers its vendor management software as a service over the Internet and usually charges your organization a fee that is a percentage of your total contingent labor spending processed through the Provade software. (Percentage of spend is the predominant fee model, although not the only one.) In addition to lower implementation costs, the effort of configuring and maintaining the software is largely upon Provade, not your organization. This can be very appealing to IT organizations that are thinly stretched supporting other important information technology initiatives. Built upon PeopleSoft sPro, the Provade solution is tailored for simple and quick deployment and administration. Provade has added capabilities to clone users rapidly and has simplified business documents, like work orders and change orders, to facilitate enterprise-wide, self-service adoption with little to no training. Provade also leverages Oracle Business Intelligence Enterprise Edition (OBIEE) to provide integrated spend analytics and dashboards. Although pure customization is more limited than with the enterprise licensed software model, Provade offers a very effective option for organizations that are regularly on-boarding and off-boarding high volumes of contingent staff hired to perform discrete support tasks (for example, order fulfillment during the holiday season, hourly clerical work, desktop technology repairs, and so on) or project tasks. The software is very configurable and at the same time very intuitive to even the most computer-phobic users. The level of contingent worker engagement your organization can achieve with the Provade option is generally the same as with the enterprise licensed software model since Provade can automatically establish contingent labor resources in your PeopleSoft applications. Provade has pre-built integrations to Oracle's PeopleSoft and the Oracle E-Business Suite procurement, projects, payables, and HCM applications, so that you can evaluate, train, assign, and track contingent workers like your permanent employees. Similar to the enterprise licensed software model, your organization is responsible for the contingent worker sourcing, administration, and financial settlement processes. This means your organization needs to maintain the staff expertise in these domains. Option 3:  Managed Services Provider (MSP) Whether you are using the enterprise licensed model or the SaaS model, you may want to engage the services of sourcing, employment, payroll, and financial settlement professionals to administer your contingent workforce program. Firms that offer this expertise are often referred to as "MSPs," and they are typically staffing companies that also offer permanent and temporary hiring services. (In fact, many of the major MSPs are Oracle applications customers themselves, and they utilize the PeopleSoft Solution for the Staffing Industry to run their own business operations.) Usually, MSPs place their staff on-site at your facilities, and they can utilize either your enterprise licensed PeopleSoft sPro application or the Provade VMS SaaS software to administer the network of suppliers providing contingent workers. When you utilize an MSP, there is a separate fee for the MSP's service that is typically funded by the participating suppliers of the contingent labor. Also in this model, the suppliers of the contingent labor (not the MSP) usually pay the contingent labor force. With an MSP, you are intentionally turning over business process control for the advantages associated with having someone else manage the processes. The software option you choose will to a certain extent affect your process flexibility; however, the MSPs are often able to adapt their processes to the unique demands of your business. When you engage an MSP, you will want to give some thought to the level of engagement and "partnering" you need with your contingent workforce. Because the MSP acts as an intermediary, it can be very valuable in handling high volume, routine contracting for which there is a relatively low need for "partnering" with the contingent workforce. However, if your organization (or part of your organization) engages contingent workers for high-profile client projects that require diplomacy, intensive amounts of interaction, and personal trust, introducing an MSP into the process may prove less effective than handling the process with your own staff. In fact, in many organizations, it is common to enlist an MSP to handle contractors working on internal projects and to have permanent employees handle the contractor relationships that affect the portion of the services portfolio focused on customer-facing, billable projects. One of the key advantages of enlisting an MSP is that you do not have to maintain the expertise required for orchestrating the sourcing, hiring, and paying of contingent workers.  These are the domain of the MSPs. If your own staff members are not prepared to manage the essential "overhead" processes associated with contingent labor, working with an MSP can make solid business sense. Proper administration of a contingent workforce can make the difference between project success and failure, operating profit and loss, and legal compliance and fines. Concluding Thoughts There is little doubt that thoughtfully and purposefully constructing a service delivery strategy that leverages the strengths of contingent workers can lead to better projects, deliverables, and business results. What requires a bit more thinking is determining the platform (or platforms) that will enable each part of your organization to best deliver on its mission.

    Read the article

  • Changes to the LINQ-to-StreamInsight Dialect

    - by Roman Schindlauer
    In previous versions of StreamInsight (1.0 through 2.0), CepStream<> represents temporal streams of many varieties: Streams with ‘open’ inputs (e.g., those defined and composed over CepStream<T>.Create(string streamName) Streams with ‘partially bound’ inputs (e.g., those defined and composed over CepStream<T>.Create(Type adapterFactory, …)) Streams with fully bound inputs (e.g., those defined and composed over To*Stream – sequences or DQC) The stream may be embedded (where Server.Create is used) The stream may be remote (where Server.Connect is used) When adding support for new programming primitives in StreamInsight 2.1, we faced a choice: Add a fourth variety (use CepStream<> to represent streams that are bound the new programming model constructs), or introduce a separate type that represents temporal streams in the new user model. We opted for the latter. Introducing a new type has the effect of reducing the number of (confusing) runtime failures due to inappropriate uses of CepStream<> instances in the incorrect context. The new types are: IStreamable<>, which logically represents a temporal stream. IQStreamable<> : IStreamable<>, which represents a queryable temporal stream. Its relationship to IStreamable<> is analogous to the relationship of IQueryable<> to IEnumerable<>. The developer can compose temporal queries over remote stream sources using this type. The syntax of temporal queries composed over IQStreamable<> is mostly consistent with the syntax of our existing CepStream<>-based LINQ provider. However, we have taken the opportunity to refine certain aspects of the language surface. Differences are outlined below. Because 2.1 introduces new types to represent temporal queries, the changes outlined in this post do no impact existing StreamInsight applications using the existing types! SelectMany StreamInsight does not support the SelectMany operator in its usual form (which is analogous to SQL’s “CROSS APPLY” operator): static IEnumerable<R> SelectMany<T, R>(this IEnumerable<T> source, Func<T, IEnumerable<R>> collectionSelector) It instead uses SelectMany as a convenient syntactic representation of an inner join. The parameter to the selector function is thus unavailable. Because the parameter isn’t supported, its type in StreamInsight 1.0 – 2.0 wasn’t carefully scrutinized. Unfortunately, the type chosen for the parameter is nonsensical to LINQ programmers: static CepStream<R> SelectMany<T, R>(this CepStream<T> source, Expression<Func<CepStream<T>, CepStream<R>>> streamSelector) Using Unit as the type for the parameter accurately reflects the StreamInsight’s capabilities: static IQStreamable<R> SelectMany<T, R>(this IQStreamable<T> source, Expression<Func<Unit, IQStreamable<R>>> streamSelector) For queries that succeed – that is, queries that do not reference the stream selector parameter – there is no difference between the code written for the two overloads: from x in xs from y in ys select f(x, y) Top-K The Take operator used in StreamInsight causes confusion for LINQ programmers because it is applied to the (unbounded) stream rather than the (bounded) window, suggesting that the query as a whole will return k rows: (from win in xs.SnapshotWindow() from x in win orderby x.A select x.B).Take(k) The use of SelectMany is also unfortunate in this context because it implies the availability of the window parameter within the remainder of the comprehension. The following compiles but fails at runtime: (from win in xs.SnapshotWindow() from x in win orderby x.A select win).Take(k) The Take operator in 2.1 is applied to the window rather than the stream: Before After (from win in xs.SnapshotWindow() from x in win orderby x.A select x.B).Take(k) from win in xs.SnapshotWindow() from b in     (from x in win     orderby x.A     select x.B).Take(k) select b Multicast We are introducing an explicit multicast operator in order to preserve expression identity, which is important given the semantics about moving code to and from StreamInsight. This also better matches existing LINQ dialects, such as Reactive. This pattern enables expressing multicasting in two ways: Implicit Explicit var ys = from x in xs          where x.A > 1          select x; var zs = from y1 in ys          from y2 in ys.ShiftEventTime(_ => TimeSpan.FromSeconds(1))          select y1 + y2; var ys = from x in xs          where x.A > 1          select x; var zs = ys.Multicast(ys1 =>     from y1 in ys1     from y2 in ys1.ShiftEventTime(_ => TimeSpan.FromSeconds(1))     select y1 + y2; Notice the product translates an expression using implicit multicast into an expression using the explicit multicast operator. The user does not see this translation. Default window policies Only default window policies are supported in the new surface. Other policies can be simulated by using AlterEventLifetime. Before After xs.SnapshotWindow(     WindowInputPolicy.ClipToWindow,     SnapshotWindowInputPolicy.Clip) xs.SnapshotWindow() xs.TumblingWindow(     TimeSpan.FromSeconds(1),     HoppingWindowOutputPolicy.PointAlignToWindowEnd) xs.TumblingWindow(     TimeSpan.FromSeconds(1)) xs.TumblingWindow(     TimeSpan.FromSeconds(1),     HoppingWindowOutputPolicy.ClipToWindowEnd) Not supported … LeftAntiJoin Representation of LASJ as a correlated sub-query in the LINQ surface is problematic as the StreamInsight engine does not support correlated sub-queries (see discussion of SelectMany). The current syntax requires the introduction of an otherwise unsupported ‘IsEmpty()’ operator. As a result, the pattern is not discoverable and implies capabilities not present in the server. The direct representation of LASJ is used instead: Before After from x in xs where     (from y in ys     where x.A > y.B     select y).IsEmpty() select x xs.LeftAntiJoin(ys, (x, y) => x.A > y.B) from x in xs where     (from y in ys     where x.A == y.B     select y).IsEmpty() select x xs.LeftAntiJoin(ys, x => x.A, y => y.B) ApplyWithUnion The ApplyWithUnion methods have been deprecated since their signatures are redundant given the standard SelectMany overloads: Before After xs.GroupBy(x => x.A).ApplyWithUnion(gs => from win in gs.SnapshotWindow() select win.Count()) xs.GroupBy(x => x.A).SelectMany(     gs =>     from win in gs.SnapshotWindow()     select win.Count()) xs.GroupBy(x => x.A).ApplyWithUnion(gs => from win in gs.SnapshotWindow() select win.Count(), r => new { r.Key, Count = r.Payload }) from x in xs group x by x.A into gs from win in gs.SnapshotWindow() select new { gs.Key, Count = win.Count() } Alternate UDO syntax The representation of UDOs in the StreamInsight LINQ dialect confuses cardinalities. Based on the semantics of user-defined operators in StreamInsight, one would expect to construct queries in the following form: from win in xs.SnapshotWindow() from y in MyUdo(win) select y Instead, the UDO proxy method is referenced within a projection, and the (many) results returned by the user code are automatically flattened into a stream: from win in xs.SnapshotWindow() select MyUdo(win) The “many-or-one” confusion is exemplified by the following example that compiles but fails at runtime: from win in xs.SnapshotWindow() select MyUdo(win) + win.Count() The above query must fail because the UDO is in fact returning many values per window while the count aggregate is returning one. Original syntax New alternate syntax from win in xs.SnapshotWindow() select win.UdoProxy(1) from win in xs.SnapshotWindow() from y in win.UserDefinedOperator(() => new Udo(1)) select y -or- from win in xs.SnapshotWindow() from y in win.UdoMacro(1) select y Notice that this formulation also sidesteps the dynamic type pitfalls of the existing “proxy method” approach to UDOs, in which the type of the UDO implementation (TInput, TOuput) and the type of its constructor arguments (TConfig) need to align in a precise and non-obvious way with the argument and return types for the corresponding proxy method. UDSO syntax UDSO currently leverages the DataContractSerializer to clone initial state for logical instances of the user operator. Initial state will instead be described by an expression in the new LINQ surface. Before After xs.Scan(new Udso()) xs.Scan(() => new Udso()) Name changes ShiftEventTime => AlterEventStartTime: The alter event lifetime overload taking a new start time value has been renamed. CountByStartTimeWindow => CountWindow

    Read the article

  • Building Queries Systematically

    - by Jeremy Smyth
    The SQL language is a bit like a toolkit for data. It consists of lots of little fiddly bits of syntax that, taken together, allow you to build complex edifices and return powerful results. For the uninitiated, the many tools can be quite confusing, and it's sometimes difficult to decide how to go about the process of building non-trivial queries, that is, queries that are more than a simple SELECT a, b FROM c; A System for Building Queries When you're building queries, you could use a system like the following:  Decide which fields contain the values you want to use in our output, and how you wish to alias those fields Values you want to see in your output Values you want to use in calculations . For example, to calculate margin on a product, you could calculate price - cost and give it the alias margin. Values you want to filter with. For example, you might only want to see products that weigh more than 2Kg or that are blue. The weight or colour columns could contain that information. Values you want to order by. For example you might want the most expensive products first, and the least last. You could use the price column in descending order to achieve that. Assuming the fields you've picked in point 1 are in multiple tables, find the connections between those tables Look for relationships between tables and identify the columns that implement those relationships. For example, The Orders table could have a CustomerID field referencing the same column in the Customers table. Sometimes the problem doesn't use relationships but rests on a different field; sometimes the query is looking for a coincidence of fact rather than a foreign key constraint. For example you might have sales representatives who live in the same state as a customer; this information is normally not used in relationships, but if your query is for organizing events where sales representatives meet customers, it's useful in that query. In such a case you would record the names of columns at either end of such a connection. Sometimes relationships require a bridge, a junction table that wasn't identified in point 1 above but is needed to connect tables you need; these are used in "many-to-many relationships". In these cases you need to record the columns in each table that connect to similar columns in other tables. Construct a join or series of joins using the fields and tables identified in point 2 above. This becomes your FROM clause. Filter using some of the fields in point 1 above. This becomes your WHERE clause. Construct an ORDER BY clause using values from point 1 above that are relevant to the desired order of the output rows. Project the result using the remainder of the fields in point 1 above. This becomes your SELECT clause. A Worked Example   Let's say you want to query the world database to find a list of countries (with their capitals) and the change in GNP, using the difference between the GNP and GNPOld columns, and that you only want to see results for countries with a population greater than 100,000,000. Using the system described above, we could do the following:  The Country.Name and City.Name columns contain the name of the country and city respectively.  The change in GNP comes from the calculation GNP - GNPOld. Both those columns are in the Country table. This calculation is also used to order the output, in descending order To see only countries with a population greater than 100,000,000, you need the Population field of the Country table. There is also a Population field in the City table, so you'll need to specify the table name to disambiguate. You can also represent a number like 100 million as 100e6 instead of 100000000 to make it easier to read. Because the fields come from the Country and City tables, you'll need to join them. There are two relationships between these tables: Each city is hosted within a country, and the city's CountryCode column identifies that country. Also, each country has a capital city, whose ID is contained within the country's Capital column. This latter relationship is the one to use, so the relevant columns and the condition that uses them is represented by the following FROM clause:  FROM Country JOIN City ON Country.Capital = City.ID The statement should only return countries with a population greater than 100,000,000. Country.Population is the relevant column, so the WHERE clause becomes:  WHERE Country.Population > 100e6  To sort the result set in reverse order of difference in GNP, you could use either the calculation, or the position in the output (it's the third column): ORDER BY GNP - GNPOld or ORDER BY 3 Finally, project the columns you wish to see by constructing the SELECT clause: SELECT Country.Name AS Country, City.Name AS Capital,        GNP - GNPOld AS `Difference in GNP`  The whole statement ends up looking like this:  mysql> SELECT Country.Name AS Country, City.Name AS Capital, -> GNP - GNPOld AS `Difference in GNP` -> FROM Country JOIN City ON Country.Capital = City.ID -> WHERE Country.Population > 100e6 -> ORDER BY 3 DESC; +--------------------+------------+-------------------+ | Country            | Capital    | Difference in GNP | +--------------------+------------+-------------------+ | United States | Washington | 399800.00 | | China | Peking | 64549.00 | | India | New Delhi | 16542.00 | | Nigeria | Abuja | 7084.00 | | Pakistan | Islamabad | 2740.00 | | Bangladesh | Dhaka | 886.00 | | Brazil | Brasília | -27369.00 | | Indonesia | Jakarta | -130020.00 | | Russian Federation | Moscow | -166381.00 | | Japan | Tokyo | -405596.00 | +--------------------+------------+-------------------+ 10 rows in set (0.00 sec) Queries with Aggregates and GROUP BY While this system might work well for many queries, it doesn't cater for situations where you have complex summaries and aggregation. For aggregation, you'd start with choosing which columns to view in the output, but this time you'd construct them as aggregate expressions. For example, you could look at the average population, or the count of distinct regions.You could also perform more complex aggregations, such as the average of GNP per head of population calculated as AVG(GNP/Population). Having chosen the values to appear in the output, you must choose how to aggregate those values. A useful way to think about this is that every aggregate query is of the form X, Y per Z. The SELECT clause contains the expressions for X and Y, as already described, and Z becomes your GROUP BY clause. Ordinarily you would also include Z in the query so you see how you are grouping, so the output becomes Z, X, Y per Z.  As an example, consider the following, which shows a count of  countries and the average population per continent:  mysql> SELECT Continent, COUNT(Name), AVG(Population)     -> FROM Country     -> GROUP BY Continent; +---------------+-------------+-----------------+ | Continent     | COUNT(Name) | AVG(Population) | +---------------+-------------+-----------------+ | Asia          |          51 |   72647562.7451 | | Europe        |          46 |   15871186.9565 | | North America |          37 |   13053864.8649 | | Africa        |          58 |   13525431.0345 | | Oceania       |          28 |    1085755.3571 | | Antarctica    |           5 |          0.0000 | | South America |          14 |   24698571.4286 | +---------------+-------------+-----------------+ 7 rows in set (0.00 sec) In this case, X is the number of countries, Y is the average population, and Z is the continent. Of course, you could have more fields in the SELECT clause, and  more fields in the GROUP BY clause as you require. You would also normally alias columns to make the output more suited to your requirements. More Complex Queries  Queries can get considerably more interesting than this. You could also add joins and other expressions to your aggregate query, as in the earlier part of this post. You could have more complex conditions in the WHERE clause. Similarly, you could use queries such as these in subqueries of yet more complex super-queries. Each technique becomes another tool in your toolbox, until before you know it you're writing queries across 15 tables that take two pages to write out. But that's for another day...

    Read the article

< Previous Page | 4 5 6 7 8 9  | Next Page >