Search Results

Search found 44874 results on 1795 pages for 'string format'.

Page 8/1795 | < Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15  | Next Page >

  • PHP String tokenizer not working correctly

    - by asdadas
    I have no clue why strtok decided to break on me. Here is my code. I am tokenizing a string by dollar symbol $. echo 'Tokenizing this by $: ',$aliases,PHP_EOL; if(strlen($aliases) > 0) { //aliases check $token = strtok($aliases, '$'); while($token != NULL) { echo 'Found a token: ',$token,PHP_EOL; if(!isGoodLookup($token)) { echo 'ERROR: Invalid alias found.',PHP_EOL; stop($db); } $goodAliasesList[] = $token; $token = strtok('$'); } if($token == NULL) echo 'Found null token, moving on',PHP_EOL; } And this is my output: Tokenizing this by $: getaways$aaa Found a token: getaways Found null token, moving on str tok is not supposed to do this!! where is my aaa token!!

    Read the article

  • Controller changes format on variables when publishing

    - by Christoffer
    I am a newbie to ROR but catching on quickly. I have been working on this problem for a couple of hours now and it seems like a bug. I does not make any sense. I have a database with the following migration: class CreateWebsites < ActiveRecord::Migration def self.up create_table :websites do |t| t.string :name t.integer :estimated_value t.string :webhost t.string :purpose t.string :description t.string :tagline t.string :url t.integer :adsense t.integer :tradedoubler t.integer :affiliator t.integer :adsense_cpm t.boolean :released t.string :empire_type t.string :oldid t.string :old_outlink_policy t.string :old_inlink_policy t.string :old_priority t.string :old_profitability t.integer :priority_id t.integer :project_id t.integer :outlink_policy_id t.integer :inlink_policy_id t.timestamps end end def self.down drop_table :websites end end I have verified that what is created in the database also is integers, strings etc according to this migration. I have not touched the controller after generating it through scaffold, i.e. it is the standard controller with show, index etc. Now. When I enter data into the database, either through the web form, in rails console or directly in the database - such as www.domain.com for url or 500 for adsense - it will be created in the db without problem. However, when it is being published on the website the variables go completely nuts. Adsense (integer) turns into date, url (string) turns into a float, and so on. This only happens to a few of the variables. This will also create a problem with "argument out of range" since I input 500 and Rails will try to output it as date = crash and "argument out of range". So, how do I fix/trouble shoot this? Why do the formats change? Could it be because of the respond_to in the controller? Cheers, Christoffer

    Read the article

  • Finding multiple values in a string Jquery / Javascript

    - by user257503
    I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

    Read the article

  • Utilize different region format for a single application on Mac OS X

    - by Jeff Hellman
    Is there a way to have a single Mac OS X application utilize a different region format than the system default? For example, I'd like to keep my system operating in English with US date formats but have my lesson planning software utilize French date formats. If I put my entire computer into French mode, I get the desired results, but I'd rather keep my entire system in US mode and have the Planbook application work with French region formats. I know about Language Switcher but that only allow per-app selections of localizations to be used, not which date format to use. I don't care about having the French localization of Planbook appear, I just want the date format to be French.

    Read the article

  • Format Excel cells to display as '##:##:##'

    - by David Gard
    I'm trying to format cells in Excel so that they display the total duration of phone calls as hh:mm:ss, but Excel is giving me errors. Sometimes durations are only mm:ss (49:10), or even just ss (35), and I need them by default to change to 00:49:10 and 00:00:35 respectivly. However, when I select 'Custom' on the 'Number' tab when formatting the cells and enter either 00:00:00 or ##:##:##, Excel tells me - Microsoft Office Excel cannot use the number format you typed. Also, hh:mm:ss will not work for me, as I'm dealing in durations, not times. Is anyone able to tell me how do format this? Thanks.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • command to format mount points in windows 2003

    - by user136104
    I need a command to format the mount point in windows 2003. Generally we use the following command to format a volume in windows type C:\sri.txt| FORMAT E: /v:volume /Q /fs:NTFS But by using the same command we can't format the mount points. So is there any command to format a mount point in windows

    Read the article

  • C# collection/string .Contains vs collection/string.IndexOf

    - by Daniel
    Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

    Read the article

  • Finding substring of a word found in joining a string from another string

    - by 2er0
    Given a list of words, L, that are all the same length, and a string, S, find the starting position of the substring of S that is a concatenation of each word in L exactly once and without any intervening characters. This substring will occur exactly once in S. Example: L: "fooo", "barr", "wing", "ding", "wing" S: "lingmindraboofooowingdingbarrwingmonkeypoundcake" Word found in joining L and also found in S: "fooowingdingbarrwing" Answer: 13 L: "mon", "key" S: "monkey Word found in joining L and also found in S: "monkey Answer: 0 L: "a", "b", "c", "d", "e" S: "abcdfecdba" Word found in joining L and also found in S: "ecdba Answer: 5

    Read the article

  • String to array or Array to string tips on formats, etc

    - by user316841
    hi, first of all thanks for taking your time! I'm a junior Dev, working with PHP + mysql. My issue: I'm saving data from a form to my database. From this form, there's only need to save the contacts: Name, phone number, address. But, it would be nice to have a small reference to the user answers. Let's say for each question we've got a value betwee 1 and 4. Since there's no need to create a table just for it, because what's needed is just the personal contacts. I'm thinking of recording each question/answer, as a letter and its correspondent value. Example (A2, B1, C5, D3, etc). My question is: Is there a format I could afterwards, handle easily ? Convert to array (string to array) in case the client change ideas, and ask this data, placed in table columns ? Just to prevent this situation! Example, From (A2, B1, C5 ) to array( "A" = "1", "B" = "1", "C" = "5" ) For now I guess, Regex is the answer, but it's allways hard to figure it out and I'm allways getting in troubles =) Thanks!

    Read the article

  • trying to format a sd card

    - by masfenix
    I recently found a SD card (1gb) lying around. Thought i might pop that into my card reader and see if anything is on it. nothing.. there isnt even a file system on it. so i try to right click and go "format" but nothing happens. so i try in command. i launch cmd and i go format f: it gave the following back:

    Read the article

  • Trying to format an SD card.

    - by masfenix
    I recently found a SD card (1gb) lying around. Thought I might pop that into my card reader and see if anything is on it. Nothing. There isn't even a file system on it. So I try to right click and go "format" but nothing happens. So I try in command. I launch cmd and I go format f: This is the result:

    Read the article

  • Remove characters after specific character in string, then remove substring?

    - by sah302
    I feel kind of dumb posting this when this seems kind of simple and there are tons of questions on strings/characters/regex, but I couldn't find quite what I needed (except in another language: http://stackoverflow.com/questions/2176544/remove-all-text-after-certain-point). I've got the following code: [Test] public void stringManipulation() { String filename = "testpage.aspx"; String currentFullUrl = "http://localhost:2000/somefolder/myrep/test.aspx?q=qvalue"; String fullUrlWithoutQueryString = currentFullUrl.Replace("?.*", ""); String urlWithoutPageName = fullUrlWithoutQueryString.Remove(fullUrlWithoutQueryString.Length - filename.Length); String expected = "http://localhost:2000/somefolder/myrep/"; String actual = urlWithoutPageName; Assert.AreEqual(expected, actual); } I tried the solution in the question above (hoping the syntax would be the same!) but nope. I want to first remove the queryString which could be any variable length, then remove the page name, which again could be any length. How can I get the remove the query string from the full URL such that this test passes?

    Read the article

  • How to extract specific variables from a string?

    - by David
    Hi, let's say i have the following: $vars="name=david&age=26&sport=soccer&birth=1984"; I want to turn this into real php variables but not everything. By example, the functions that i need : $thename=getvar($vars,"name"); $theage=getvar($vars,"age"); $newvars=cleanup($vars,"name,age"); // Output $vars="name=david&age=26" How can i get only the variables that i need . And how i clean up the $vars from the other variables if possible? Thanks

    Read the article

  • Free-as-in-beer binary file format inspector

    - by fbrereto
    I am looking for a utility that gives me the ability to specify a binary file format and then interpret a file of bytes according to that format. (Something along the lines of the 010 Editor, but infinitely more cost-effective). Something that runs on Mac OS X would be preferred, but I'm interested to see what all is out there in general (while more of a hassle I'd be willing to run a tool on Windows if it were superior.) What's your preference?

    Read the article

  • How to replace round bracket tag in javascript string

    - by tomaszs
    I have trouble with changing round bracket tag in Javascript. I try to do this: var K = 1; var Text = "This a value for letter K: {ValueOfLetterK}"; Text = Text.replace("{ValueOfLetterK}", K); and after that I get: Text = "This a value for letter K: {ValueOfLetterK}" What can be done to make this work? When I remove round brackets it works fine.

    Read the article

  • How to set default file format for MS Paint

    - by torbengb
    I'm using MS Paint on WinXP at work, for capturing simple screenshots. Problem: MS Paint always wants to save in BMP format. How can I set PNG to be Paint's default file-saving format? Note: Suggestions about other software are irrelevant. I know there are many other software tools available. But I'm asking specifically about MS Paint.

    Read the article

  • Problem with Replacing special characters in a string

    - by Hossein
    Hi, I am trying to feed some text to a special pupose parser. The problem with this parser is that it is sensitive to ()[] characters and in my sentence in the text have quite a lot of these characters. The manual for the parser suggests that all the ()[] get replaced with \( \) \[ \]. So using str.replace i am using to attach \ to all of those charcaters. I use the code below: a = 'abcdef(1234)' a.replace('(','\(') however i get this as my output: 'abcdef\\(1234)' What is wrong with my code? can anyone provide me a solution to solve this for these characters?

    Read the article

< Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15  | Next Page >