Search Results

Search found 10412 results on 417 pages for 'video splitting'.

Page 80/417 | < Previous Page | 76 77 78 79 80 81 82 83 84 85 86 87  | Next Page >

  • Effective way of String splitting

    - by openidsujoy
    I have a completed string like this N:Pay in Cash++RGI:40++R:200++T:Purchase++IP:N++IS:N++PD:PC++UCP:598.80++UPP:0.00++TCP:598.80++TPP:0.00++QE:1++QS:1++CPC:USD++PPC:Points++D:Y++E:Y++IFE:Y++AD:Y++IR:++MV:++CP:~ ~N:ERedemption++RGI:42++R:200++T:Purchase++IP:N++IS:N++PD:PC++UCP:598.80++UPP:0.00++TCP:598.80++TPP:0.00++QE:1++QS:1++CPC:USD++PPC:Points++D:Y++E:Y++IFE:Y++AD:Y++IR:++MV:++CP: this string is like this It's list of PO's(Payment Options) which are separated by ~~ this list may contains one or more PO contains only Key-Value Pairs which separated by : spaces are denoted by ++ I need to extract the values for Key "RGI" and "N". I can do it via for loop , I want a efficient way to do this. any help on this.

    Read the article

  • Toshiba Satellite A305-S6861 Display Problems

    - by brock029
    Well this is the first Laptop I have ever worked on with a dedicated video card. So, there is no video going to the laptops monitor or to an external. Ripped it apart found the gpu and now am stuck. I cant decide if its the gpu that has gone out or the motherboard. Any one have any suggestions? If it were a desktop I would throw in one of my spare video cards. Mainly I don't want to order the video card and eat the $50 if its the motherboard.

    Read the article

  • Splitting a file before upload?

    - by Yevgeniy Brikman
    On a webpage, is it possible to split large files into chunks before the file is uploaded to the server? For example, split a 10MB file into 1MB chunks, and upload one chunk at a time while showing a progress bar? It sounds like JavaScript doesn't have any file manipulation abilities, but what about Flash and Java applets? This would need to work in IE6+, Firefox and Chrome. Update: forgot to mention that (a) we are using Grails and (b) this needs to run over https.

    Read the article

  • Effective way of String splitting C#

    - by openidsujoy
    I have a completed string like this N:Pay in Cash++RGI:40++R:200++T:Purchase++IP:N++IS:N++PD:PC++UCP:598.80++UPP:0.00++TCP:598.80++TPP:0.00++QE:1++QS:1++CPC:USD++PPC:Points++D:Y++E:Y++IFE:Y++AD:Y++IR:++MV:++CP:~ ~N:ERedemption++RGI:42++R:200++T:Purchase++IP:N++IS:N++PD:PC++UCP:598.80++UPP:0.00++TCP:598.80++TPP:0.00++QE:1++QS:1++CPC:USD++PPC:Points++D:Y++E:Y++IFE:Y++AD:Y++IR:++MV:++CP: this string is like this It's list of PO's(Payment Options) which are separated by ~~ this list may contains one or more PO contains only Key-Value Pairs which separated by : spaces are denoted by ++ I need to extract the values for Key "RGI" and "N". I can do it via for loop , I want a efficient way to do this. any help on this.

    Read the article

  • Merging and splitting overlapping rectangles to produce non-overlapping ones

    - by uj
    I am looking for an algorithm as follows: Given a set of possibly overlapping rectangles (All of which are "not rotated", can be uniformly represented as (left,top,right,bottom) tuplets, etc...), it returns a minimal set of (non-rotated) non-overlapping rectangles, that occupy the same area. It seems simple enough at first glance, but prooves to be tricky (at least to be done efficiently). Are there some known methods for this/ideas/pointers? Methods for not necessarily minimal, but heuristicly small, sets, are interesting as well, so are methods that produce any valid output set at all.

    Read the article

  • ffdshow h.264 audio desync

    - by Core Xii
    When I encode video with ffdshow with h.264, the audio is out of sync. At the very beginning of the video, the picture freezes for about 1 second, while the audio plays fine, resulting in the audio being that 1 second ahead of the picture throughout the entire video. Any ideas on possible causes or, obviously, solutions?

    Read the article

  • Splitting a list based on another list values in Mathematica

    - by Max
    In Mathematica I have a list of point coordinates size = 50; points = Table[{RandomInteger[{0, size}], RandomInteger[{0, size}]}, {i, 1, n}]; and a list of cluster indices these points belong to clusterIndices = {1, 1, 1, 1, 1, 1, 1, 2, 2, 1, 2, 1, 2, 1, 1, 1, 1, 1, 1, 1}; what is the easiest way to split the points into two separate lists based on the clusterIndices values?

    Read the article

  • Java splitting string by custom regex match

    - by slikz
    I am completely new to regular expressions so I'm looking for a bit of help here. I am compiling under JDK 1.5 Take this line as an example that I read from standard input: ab:Some string po:bubblegum What I would like to do is split by the two characters and colon. That is, once the line is split and put into a string array, these should be the terms: ab:Some string po:bubblegum I have this regex right now: String[] split = input.split("[..:]"); This splits at the semicolon; what I would like is for it to match two characters and a semicolon, but split at the space before that starts. Is this even possible? Here is the output from the string array: ab Some String po bubblegum I've read about Pattern.compile() as well. Is this something I should be considering?

    Read the article

  • Uploading User Made Videos to iPhone (from Vista)

    - by Darren E.
    Once a user downloads a video created with the iPhone 3GS and then deletes it from the iPhone, that video cannot be uploaded back to the iPhone...according to Apple. The videos are not treated as Photos and are not allowed to sync to and from the iPhone freely. Has anyone discovered a program or tweek that allows one to upload video to the iPhone? Thanks.

    Read the article

  • Splitting string into array upon token

    - by Gnutt
    I'm writing a script to perform an offsite rsync backup, and whenever the rsyncline recieves some output it goes into a single variable. I then want to split that variable into an array upon the ^M token, so that I can send them to two different logger-sessions (so I get them on seperate lines in the log). My current line to perform the rsync result=rsync --del -az -e "ssh -i $cert" $source $destination 2>&1 Result in the log, when the server is unavailable ssh: connect to host offsite port 22: Connection timed out^M rsync: connection unexpectedly closed (0 bytes received so far) [sender] rsync error: unexplained error (code 255) at io.c(601) [sender=3.0.7]

    Read the article

  • Splitting list into a list of possible tuples

    - by user1742646
    I need to split a list into a list of all possible tuples, but I'm unsure of how to do so. For example pairs ["cat","dog","mouse"] should result in [("cat","dog"), ("cat","mouse"), ("dog","cat"), ("dog","mouse"), ("mouse","cat"), ("mouse","dog")] I was able to form the first two, but am unsure of how to get the rest. Here's what I have so far: pairs :: [a] -> [(a,a)] pairs (x:xs) = [(m,n) | m <- [x], n <- xs]

    Read the article

  • Splitting html string after so many words

    - by jimbo
    Hi all, I have a string that if it is longer than lets say 10 words, I want to split it into two parts. The second part will be included else-where after a 'more' link. The string will hold html tags too though. For an example the string could be: <p>This is just a test string with more words than the <strong>amount allow</strong> before split, blah blah blah</p> So in the case I would want: $string[0] // <p>This is just a test string with more words than</p>; $string[1] // <p>the <strong>amount allow</strong> before split, blah blah blah</p>; Thanks in advance

    Read the article

  • Splitting up input using regular expressions in Java

    - by Joe24
    I am making a program that lets a user input a chemical for example C9H11N02. When they enter that I want to split it up into pieces so I can have it like C9, H11, N, 02. When I have it like this I want to make changes to it so I can make it C10H12N203 and then put it back together. This is what I have done so far. using the regular expression I have used I can extract the integer value, but how would I go about get C10, H11 etc..? System.out.println("Enter Data"); Scanner k = new Scanner( System.in ); String input = k.nextLine(); String reg = "\\s\\s\\s"; String [] data; data = input.split( reg ); int m = Integer.parseInt( data[0] ); int n = Integer.parseInt( data[1] );

    Read the article

  • Splitting a double in two, C#

    - by Stacey
    I'm attempting to use a double to represent a bit of a dual-value type in a database that must sometimes accept two values, and sometimes accept only one (int). So the field is a float in the database, and in my C# code, it is a double (since mapping it via EF makes it a double for some reason... ) So basically what I want to do .. let's say 2.5 is the value. I want to separate that out into 2, and 5. Is there any implicit way to go about this?

    Read the article

  • Splitting values into groups evenly

    - by Paul Knopf
    Let me try to explain the situation the best I can. Lets say I have 3 values 1, 2, 3 I tell an algorithm to split this values into x columns. Lets say x = 2 for clarification. The algorithm determines that the group of values is best put into two columns the following way. 1st column 2nd column --------------------------- 1 3 2 Each column has an even number (totals, not literals) value. Now lets say I have the following values 7, 8, 3, 1, 4 I tell the algorithm that I want the values split into 3 columns. The algorithm now tells me that the following is the best fit. 1st column 2nd column 3rd column 8 7 3 1 4 Notice how the columns arent quiet even, but it is as close as it can get. A little over and a little under is considered ok, as long as the list is AS CLOSE TO EVEN AS IT CAN BE. Anybody got any suggestions? Know any good methods of doing this?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Splitting a UL into three even lists

    - by Andy
    I am printing a menu using UL, the trouble is the order that is generated by my script is ignored because im printing the LI one after the other and they're spanning three across. So the order is 1 , 2 , 3 as opposed to 1 2 3 To counteract this i wanted to split my single UL into three that way the order would be maintained. Here is my code currently which works perfectly to print a single UL. //Category Drop Down Menu $this->CategoryDropDownMenu = '<ul id="subcatmenu">'; foreach($sitemap->CategoryMenu as $val) $this->CategoryDropDownMenu .= '<li><a href="'.$val[host].$val[link].'"><span>'.htmlspecialchars($val[title]).'</span></a></li>'; $this->CategoryDropDownMenu .= '</ul>';

    Read the article

  • Video games, content strategy, and failure - oh my.

    - by Roger Hart
    Last night was the CS London group's event Content Strategy, Manhattan Style. Yes, it's a terrible title, feeling like a self-conscious grasp for chic, sadly commensurate with the venue. Fortunately, this was not commensurate with the event itself, which was lively, relevant, and engaging. Although mostly if you're a consultant. This is a strong strain in current content strategy discourse, and I think we're going to see it remedied quite soon. Not least in Paris on Friday. A lot of the bloggers, speakers, and commentators in the sphere are consultants, or part of agencies and other consulting organisations. A lot of the talk is about how you sell content strategy to your clients. This is completely acceptable. Of course it is. And it's actually useful if that's something you regularly have to do. To an extent, it's even portable to those of us who have to sell content strategy within an organisation. We're still competing for credibility and resource. What we're doing less is living in the beginning of a project. This was touched on by Jeffrey MacIntyre (albeit in a your-clients kind of a way) who described "the day two problem". Companies, he suggested, build websites for launch day, and forget about the need for them to be ongoing entities. Consultants, agencies, or even internal folks on short projects will live through Day Two quite often: the trainwreck moment where somebody realises that even if the content is right (which it often isn't), and on time (which it often isn't), it'll be redundant, outdated, or inaccurate by the end of the week/month/fickle social media attention cycle. The thing about living through a lot of Day Two is that you see a lot of failure. Nothing succeeds like failure? Failure is good. When it's structured right, it's an awesome tool for learning - that's kind of how video games work. I'm chewing over a whole blog post about this, but basically in game-like learning, you try, fail, go round the loop again. Success eventually yields joy. It's a relatively well-known phenomenon. It works best when that failing step is acutely felt, but extremely inexpensive. Dying in Portal is highly frustrating and surprisingly characterful, but the save-points are well designed and the reload unintrusive. The barrier to re-entry into the loop is very low, as is the cost of your failure out in meatspace. So it's easy (and fun) to learn. Yeah, spot the difference with business failure. As an external content strategist, you get to rock up with a big old folder full of other companies' Day Two (and ongoing day two hundred) failures. You can't send the client round the learning loop - although you may well be there because they've been round it once - but you can show other people's round trip. It's not as compelling, but it's not bad. What about internal content strategists? We can still point to things that are wrong, and there are some very compelling tools at our disposal - content inventories, user testing, and analytics, for instance. But if we're picking up big organically sprawling legacy content, Day Two may well be a distant memory, and the felt experience of web content failure is unlikely to be immediate to many people in the organisation. What to do? My hunch here is that the first task is to create something immediate and felt, but that it probably needs to be a success. Something quickly doable and visible - a content problem solved with a measurable business result. Now, that's a tall order; but scrape of the "quickly" and it's the whole reason we're here. At Red Gate, I've started with the text book fear and passion introduction to content strategy. In fact, I just typo'd that as "contempt strategy", and it isn't a bad description. Yelling "look at this, our website is rubbish!" gets you the initial attention, but it doesn't make you many friends. And if you don't produce something pretty sharp-ish, it's easy to lose the momentum you built up for change. The first thing I've done - after the visual content inventory - is to delete a bunch of stuff. About 70% of the SQL Compare web content has gone, in fact. This is a really, really cheap operation. It's visible, and it's powerful. It's cheap because you don't have to create any new content. It's not free, however, because you do have to validate your deletions. This means analytics, actually reading that content, and talking to people whose business purposes that content has to serve. If nobody outside the company uses it, and nobody inside the company thinks they ought to, that's a no-brainer for the delete list. The payoff here is twofold. There's the nebulous hard-to-illustrate "bad content does user experience and brand damage" argument; and there's the "nobody has to spend time (money) maintaining this now" argument. One or both are easily felt, and the second at least should be measurable. But that's just one approach, and I'd be interested to hear from any other internal content strategy folks about how they get buy-in, maintain momentum, and generally get things done.

    Read the article

  • SQL SERVER – Transcript of Learning SQL Server Performance: Indexing Basics – Interview of Vinod Kumar by Pinal Dave

    - by pinaldave
    Recently I just wrote a blog post on about Learning SQL Server Performance: Indexing Basics and I received lots of request that if we can share some insight into the course. Here is 200 seconds interview of Vinod Kumar I took right after completing the course. We have few free codes to watch the course, please your comment at http://facebook.com/SQLAuth and we will few of first ones, we will send the code. There are many people who said they would like to read the transcript of the video. Here I have generated the same. Pinal: Vinod, we recently released this course, SQL Server Indexing. It is about performance tuning. So tell me – how do indexes help performance? Vinod: I think what happens in the industry when it comes to performance is that developers and DBAs look at indexes first.  So that’s the first step for any performance tuning exercise, indexing is one of the most critical aspects and it is important to learn it the right way. Pinal: Correct. So what you mean to say is that if you know indexing you can pretty much tune any server and query. Vinod: So I might contradict my false statement now. Indexing is usually a stepping stone but it does not lead you to the end. But it’s good to start with indexing and there are lots of nuances to indexing that you need to understand, like how SQL uses indexing and how performance can improve because of the strategies that you have made. Pinal: But now I’m confused. First you said indexes are good, and then you said that indexes can degrade your performance.  So what is this course about?  I mean how does this course really make an impact? Vinod: Ok -so from the course perspective, what we are trying to do is give you a capsule which gives you a good start. Every journey needs a beginning, you need that first step.  This course is that first step in understanding. This is the most basic, fundamental course that we have tried to attack. This is the fundamentals of indexing, some of the key things that you must know about indexing.   Some of the basics of indexing are lesser known and so I think this course is geared towards each and every one of you out there who wants to understand little bit more about indexing. Pinal: So what I understand is that if I enrolled in this course I will have a minimum understanding about indexing when dealing with performance tuning.  Right? Vinod: Exactly. In this course is we have tried to give you a nice summary. We are talking about clustered indexing, non clustered indexing, too many indexes, too few indexes, over indexing, under indexing, duplicate indexing, columns tune indexing, with SQL Server 2012. There’s lot’s to learn. Pinal: You can see the URL [http://bit.ly/sql-index] of the course on the screen. Go ahead, attend, and let us know what you think about it. Thank you. Vinod: Thank you. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: PostADay, SQL, SQL Authority, SQL Index, SQL Performance, SQL Query, SQL Server, SQL Tips and Tricks, SQLServer, T SQL, Technology, Video

    Read the article

  • Watch Netflix Instant Movies in Boxee

    - by DigitalGeekery
    Boxee is multi-platform Media PC application with a host of media applications. One of which is the popular Movie service, Netflix. Today we’ll show you how to get setup to watch Netflix Instant streaming video in Boxee. Note: Nexflix requires Microsoft Silverlight which unfortunately means Boxee users running Linux out of luck. What You’ll Need A Netflix account Authorize your Netflix account with Boxee Install Microsoft Silverlight Authorize Your Netflix Account First, we need to authorize our Netflix account with Boxee. (See link below). Type in your Boxee username and password and click “Login.”  When prompted, click “Authorize.”   Click “Yes, Link This Account.”    Install Silverlight If you don’t already have Silverlight installed, you’ll need to do so. See the download link at the end of the article.   Log into Boxee Now we’re ready to log into Boxee. Once logged in, click on “Apps” on the Home screen.   From the My Apps screen click on Netflix. Then click “Start.” Click “Yes” to enable the cookie.   Now you’ll enter the Netflix App. From here, you can browse your Instant Queue, Recommendations, New Arrivals, Browse Genre, or Search for available titles.   Click on a selection you’d like to watch. From here, you can Play, Rate, or even add the title to your regular Netflix Queue.   With a remote or the on-screen controls you can pause, stop, play, and skip forward or back through the video.   Now you’re all set to enjoy the Netflix Instant library with Boxee. Netflix Instant is one of many great Apps included with Boxee. While the current available selection isn’t exactly overwhelming, most subscribers will likely find enough to keep themselves entertained in between DVD deliveries. Haven’t tried Boxee yet? Check out our article on getting started with Boxee. Links Authorize your Netflix account with Boxee Install Microsoft Silverlight Similar Articles Productive Geek Tips Using Netflix Watchnow in Windows Vista Media Center (Gmedia)Find Movies and TV Based on your Mood with JinniGetting Started with BoxeeQuickly Find Movies to Watch at Hello MoviesIntegrate Boxee with Media Center in Windows 7 TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 PCmover Professional Change DNS servers on the fly with DNS Jumper Live PDF Searches PDF Files and Ebooks Converting Mp4 to Mp3 Easily Use Quick Translator to Translate Text in 50 Languages (Firefox) Get Better Windows Search With UltraSearch Scan News With NY Times Article Skimmer

    Read the article

  • SQL SERVER – Learn SQL Server 2014 Online in a Day – My Latest Pluralsight Course

    - by Pinal Dave
    Click here watch SQL Server 2014 Administration New Features.  SQL Server 2014 was released earlier this year and it has been extremely popular in Microsoft world. Here is the announcement for everyone, who have been asking me to build a tutorial around SQL Server 2014. I have authored latest Pluralsight courses on the subject of SQL Server 2014. This course is 4 hours and 17 minutes long, but the best part is that this course contains all the latest features of SQL Server 2014. I have build this course with the assumption that DBA is familiar with earlier versions of SQL Server and wants to explore and learn new features of SQL Server 2014. The Challenge I Faced The biggest challenge I faced was how to come up with the outline for the course. The reason is that there are so many different features introduced in SQL Server 2014 that is will be difficult to cover each of the features in a single course. I wanted to cover the topics which are the most relevant and useful to developers, but in addition I also wanted to cover the topics which may be useful to develop if they know that they exists in the product. I finally decided to depend on blog readers and few of the SQL Experts. I reached out to selected 20 people via email and gave them a list of the topics which I should be covering in this course. They all work in different organizations and have a good understanding about the need of the DBA and Developers. Based on their feedback, I was able to come up with a very good outline which is currently very popular with Pluralsight library. Lots of people have asked me how was I able to come up with a course content outline so accurately. The credit for the same goes to the developers and DBA, who have voted in the topics and have helped me to build a very solid outline for the course. Outline of the Course Here is a quick outline for the course: Introduction Backup Enhancements Security Enhancements Columnstore Enhancements Online Data Operations Enhancements Enhancements with Microsoft Azure SSD Buffer Pool Extensions Resource Governor IO Miscellaneous Features Online Index Rebuilding Live Plans for Long Running Queries Transaction Durability Cardinality Estimation In Memory OLTP Optimization Well, I had a great fun working on the topics which I have mentioned in the outline. I am very confident that once you start with the course, you will indeed understand how each of the topics builds and presented. I have made sure that each of the topic has a vivid and clear story to begin with. I first explain the story and right after that I explain the concept. Who Should Attend This Course Everyone who has basic knowledge of SQL Server and wants to update themselves with SQL Server 2014. They should attend this course. One thing I have made sure that this course is easy to understand and I have decided complex subject into multiple parts. This way the learning is progressive and anyone with a poor knowledge of the subject can have enough time to understand the presented concept. Screenshot of the Course Here are few of the screenshot of the courses. How to Watch Video Course This course is available at Pluralsight, and you will need a valid login to Pluralsight. If you do not have Pluralsight login, you can quickly sign up for the FREE Trial. Click here watch SQL Server 2014 Administration New Features.  Reference: Pinal Dave (http://blog.SQLAuthority.com)Filed under: PostADay, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, SQL Training, SQLAuthority News, T SQL, Video

    Read the article

  • Stream Music and Video Over the Internet with Windows Media Player 12

    - by DigitalGeekery
    A new feature in Windows Media Player 12, which is included with Windows 7, is being able to stream media over the web to other Windows 7 computers.  Today we will take a look at how to set it up and what you need to begin. Note: You will need to perform this process on each computer that you want to use. What You’ll Need Two computers running Windows 7 Home Premium, Professional, or Ultimate. The host, or home computer that you will be streaming the media from, cannot be on a public network or part of domain. Windows Live ID UPnP or Port Forwarding enabled on your home router Media files added to your Windows Media Player library Windows Live ID Sign up online for a Windows Live ID if you do not already have one. See the link below for a link to Windows Live.   Configuring the Windows 7 Computers Open Windows Media Player and go to the library section. Click on Stream and then “Allow Internet access to home media.”   The Internet Home Media Access pop up window will prompt you to link your Windows Live ID to a user account. Click “Link an online ID.” If you haven’t already installed the Windows Live ID Sign-In Assistant, you will be taken to Microsoft’s website and prompted to download it. Once you have completed the Windows Live download assistant install, you will see Windows Live ID online provider appear in the “Link Online IDs” window. Click on “Link Online ID.” Next, you’ll be prompted for a Windows Live ID and password. Enter your Windows Live ID and password and click “Sign In.” A pop up window will notify you that you have successfully allowed Internet access to home media. Now, you will have to repeat the exact same configuration on the 2nd Windows 7 computer. Once you have completed the same configuration on your 2nd computer, you might also need to configure your home router for port forwarding. If your router supports UPnP, you may not need to manually forward any ports on your router. So, this would be a good time to test your connection. Go to a nearby hotspot, or perhaps a neighbor’s house, and test to see if you can stream your media. If not, you’ll need to manually forward the ports. You can always choose to forward the ports anyway, just in case. Note: We tested on a Linksys WRT54GL router, which supports UPnP, and found we still needed to manually forward the ports. Finding the ports to forward on the router Open Windows Media Player and make sure you are in Library view. Click on “Stream” on the top menu, and select “Allow Internet access to home media.”   On the “Internet Home Media Access” window, click on “Diagnose connections.” The “Internet Streaming Diagnostic Tool” will pop up. Click on “Port forwarding information” near the bottom.   On the “Port Forwarding Information” window you will find both the Internal and External Port numbers you will need to forward on your router. The Internal port number should always be 10245. The external number will be different depending on your computer. Microsoft also recommends forwarding port 443. Configuring the Router Next, you’ll need to configure Port Forwarding on your home router. We will show you the steps for a Linksys WRT54GL router, however, the steps for port forwarding will vary from router to router. On the Linksys configuration page, click on the Administration Tab along the top, click the “Applications & Gaming Tab, and then the “Port Range Forward” tab below it. Under “Application,” type in a name. It can be any name you choose. In both the “Start” and “End” boxes, type the port number. Enter the IP address of your home computer in the IP address column. Click the check box under “Enable.” Do this for both the internal and external port numbers and port 443. When finished, click the “Save Settings” button. Note: It’s highly recommended that you configure your home computer with a static IP address When you’re ready to play your media over the Internet, open up Windows Media Player and look for your host computer and username listed under “Other Libraries.” Click on it expand the list to see your media libraries. Choose a library and a file to play. Now you can enjoy your streaming media over the Internet. Conclusion We found media streaming over the Internet to work fairly well. However, we did see a loss of quality with streaming video. Also, Recorded TV .wtv and dvr-ms files did not play at all. Check out our previous article to see how to stream media share and stream media between Windows 7 computers on your home network. Similar Articles Productive Geek Tips Enable Media Streaming in Windows Home Server to Windows Media PlayerFixing When Windows Media Player Library Won’t Let You Add FilesShare Digital Media With Other Computers on a Home Network with Windows 7Share and Stream Digital Media Between Windows 7 Machines On Your Home NetworkLearning Windows 7: Manage Your Music with Windows Media Player TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 PCmover Professional Stormpulse provides slick, real time weather data Geek Parents – Did you try Parental Controls in Windows 7? Change DNS servers on the fly with DNS Jumper Live PDF Searches PDF Files and Ebooks Converting Mp4 to Mp3 Easily Use Quick Translator to Translate Text in 50 Languages (Firefox)

    Read the article

  • HDMI video connection cuts top and bottom borders of screen

    - by Luis Alvarado
    Ok this is an extension of another problem I had with a VGA connection and an Nvidia Geforce GT 440 card. Here is goes the explanation of this particular problem: I have a Soneview 32' TV. This TV has many connections including VGA (First reason I bought it), HDMI (Second reason but did not have a HDMI cable at that time) and DVI. I have had this TV for little over a month now, actually I had it to celebrate the release of Ubuntu 11.10 and started using it exactly on that date (I know too much fan there but hey, I like geek stuff). I started using it with the VGA cable. After 2 weeks I bought an Nvidia GT440 card. The previous 9500GT was working correctly with no problems whatsoever. I installed the GT440 and the first problem that I encountered using this latest card is mentioned here: Nvidia GT 440 black screen problem when loading lightdm greeter. The solution to this problem was to actually disconnect then connect again the VGA cable. This would result in the screen showing me the lightdm screen for my login. If I did not disconnect then connect the cable I could be there forever thinking that there is no video signal. I got tired of looking for answers that did not work and for solutions that made me literally have to install Ubuntu again. I just went and bought a HDMI cable and changed the VGA one for that one. It worked and I did not have to disconnect/connect the cable but now I have this problem when using any resolution. My normal resolution is 1920x1080 (This TV is 1080HD) so in VGA I could use this resolution with no problem, but on HDMI am getting the borders cut out. Here is a pic: As you can see from the PIC, the Launcher icons only show less than 50% of their witdh. Forget about the top and bottom parts, I can access them with the mouse but I can not visualize them in the screen. It is like it's outside of the TVs view. Basically there is like 20 to 30 pixels gone from all sides. I searched around and came to running xrand --verbose to see what it could detect from the TV. I got this: cyrex@cyrex:~$ xrandr --verbose xrandr: Failed to get size of gamma for output default Screen 0: minimum 320 x 175, current 1920 x 1080, maximum 1920 x 1080 default connected 1920x1080+0+0 (0x164) normal (normal) 0mm x 0mm Identifier: 0x163 Timestamp: 465485 Subpixel: unknown Clones: CRTC: 0 CRTCs: 0 Transform: 1.000000 0.000000 0.000000 0.000000 1.000000 0.000000 0.000000 0.000000 1.000000 filter: 1920x1080 (0x164) 103.7MHz *current h: width 1920 start 0 end 0 total 1920 skew 0 clock 54.0KHz v: height 1080 start 0 end 0 total 1080 clock 50.0Hz 1920x1080 (0x165) 105.8MHz h: width 1920 start 0 end 0 total 1920 skew 0 clock 55.1KHz v: height 1080 start 0 end 0 total 1080 clock 51.0Hz 1920x1080 (0x166) 107.8MHz h: width 1920 start 0 end 0 total 1920 skew 0 clock 56.2KHz v: height 1080 start 0 end 0 total 1080 clock 52.0Hz 1920x1080 (0x167) 109.9MHz h: width 1920 start 0 end 0 total 1920 skew 0 clock 57.2KHz v: height 1080 start 0 end 0 total 1080 clock 53.0Hz 1920x1080 (0x168) 112.0MHz h: width 1920 start 0 end 0 total 1920 skew 0 clock 58.3KHz v: height 1080 start 0 end 0 total 1080 clock 54.0Hz 1920x1080 (0x169) 114.0MHz h: width 1920 start 0 end 0 total 1920 skew 0 clock 59.4KHz v: height 1080 start 0 end 0 total 1080 clock 55.0Hz 1680x1050 (0x16a) 98.8MHz h: width 1680 start 0 end 0 total 1680 skew 0 clock 58.8KHz v: height 1050 start 0 end 0 total 1050 clock 56.0Hz 1680x1050 (0x16b) 100.5MHz h: width 1680 start 0 end 0 total 1680 skew 0 clock 59.9KHz v: height 1050 start 0 end 0 total 1050 clock 57.0Hz 1600x1024 (0x16c) 95.0MHz h: width 1600 start 0 end 0 total 1600 skew 0 clock 59.4KHz v: height 1024 start 0 end 0 total 1024 clock 58.0Hz 1440x900 (0x16d) 76.5MHz h: width 1440 start 0 end 0 total 1440 skew 0 clock 53.1KHz v: height 900 start 0 end 0 total 900 clock 59.0Hz 1360x768 (0x171) 65.8MHz h: width 1360 start 0 end 0 total 1360 skew 0 clock 48.4KHz v: height 768 start 0 end 0 total 768 clock 63.0Hz 1360x768 (0x172) 66.8MHz h: width 1360 start 0 end 0 total 1360 skew 0 clock 49.2KHz v: height 768 start 0 end 0 total 768 clock 64.0Hz 1280x1024 (0x173) 85.2MHz h: width 1280 start 0 end 0 total 1280 skew 0 clock 66.6KHz v: height 1024 start 0 end 0 total 1024 clock 65.0Hz 1280x960 (0x176) 83.6MHz h: width 1280 start 0 end 0 total 1280 skew 0 clock 65.3KHz v: height 960 start 0 end 0 total 960 clock 68.0Hz 1280x960 (0x177) 84.8MHz h: width 1280 start 0 end 0 total 1280 skew 0 clock 66.2KHz v: height 960 start 0 end 0 total 960 clock 69.0Hz 1280x720 (0x178) 64.5MHz h: width 1280 start 0 end 0 total 1280 skew 0 clock 50.4KHz v: height 720 start 0 end 0 total 720 clock 70.0Hz 1280x720 (0x179) 65.4MHz h: width 1280 start 0 end 0 total 1280 skew 0 clock 51.1KHz v: height 720 start 0 end 0 total 720 clock 71.0Hz 1280x720 (0x17a) 66.4MHz h: width 1280 start 0 end 0 total 1280 skew 0 clock 51.8KHz v: height 720 start 0 end 0 total 720 clock 72.0Hz 1152x864 (0x17b) 72.7MHz h: width 1152 start 0 end 0 total 1152 skew 0 clock 63.1KHz v: height 864 start 0 end 0 total 864 clock 73.0Hz 1152x864 (0x17c) 73.7MHz h: width 1152 start 0 end 0 total 1152 skew 0 clock 63.9KHz v: height 864 start 0 end 0 total 864 clock 74.0Hz ....Many Resolutions later... 320x200 (0x1d1) 10.2MHz h: width 320 start 0 end 0 total 320 skew 0 clock 31.8KHz v: height 200 start 0 end 0 total 200 clock 159.0Hz 320x175 (0x1d2) 9.0MHz h: width 320 start 0 end 0 total 320 skew 0 clock 28.0KHz v: height 175 start 0 end 0 total 175 clock 160.0Hz 1920x1080 (0x1dd) 333.8MHz h: width 1920 start 0 end 0 total 1920 skew 0 clock 173.9KHz v: height 1080 start 0 end 0 total 1080 clock 161.0Hz If it helps, the Refresh Rate at 1920x1080 is 60. There is a flickering effect at this resolution using HDMI but not VGA which I imagine is related to the borders cut off issue am asking here. I have also done the following but this will only solve the problem on lower resolutions than 1920x1080 or on others TV (My father has a Sony TV where this problem is also solved): NVIDIA WAY Go to Nvidia-Settings and there will be an option that will have more features if a HDMI cable is connected. In the next pic the option is DFP-1 (CNDLCD) but this name changes depending on what device the PC is connected to: Uncheck Force Full GPU Scaling What this will do for resolutions LOWER than 1920x1080 (At least in my case) is solve the flickering problem and fix the borders cut by the monitor. Save to Xorg.conf file the changes made after changing to a resolution acceptable to your eyes. TV WAY If you TV has OSD Menu and this menu has options for scanning the screen resolution or auto adjusting to it, disable them. Specifically the option about SCAN. If you have an option for AV Mode disable it. Basically disable any option that needs to scan and scale the resolution. Test one by one. In the case of my father's TV this did it. In my case, the Nvidia solved it for lower resolutions. NOTE: In the case this is not solved in the next couple of weeks I will add this as the answer but take into consideration that the issue is still active with 1920x1080 resolutions.

    Read the article

  • Reducing video mode switching during Linux boot

    - by Zack
    When I boot up my desktop computer, which only has Linux on it, the video mode and/or console font gets switched four times: When GRUB starts, it switches from 80x25 text to a graphical mode so it can draw a pretty background behind its menu; GRUB then goes back to 80x25 text after I pick something from the menu; When the KMS driver for my video card loads, it switches to a much higher-resolution text mode (I don't know if this is a hardware text mode or not); Finally X starts and it goes graphics and stays that way. I think this last switch does not change the resolution of the video mode, only the graphicalness. I'd like to get rid of as many of these mode switches as possible. Ideally, when GRUB takes over from the BIOS it would go directly to the same high-resolution text mode that the KMS driver selects, and the display would stay in that mode till X starts and brings up graphics. I am under the impression that this is possible by mucking with the kernel command line and/or the GRUB console module load parameters, but I don't know the details. GRUB 1.98+20100706, kernel 2.6.32.15 using Nouveau video drivers. Distro is Debian unstable. Please no answers that involve recompiling anything or cobbling together bleeding-edge kernel/driver combinations, I don't care enough about this to go to that much trouble. EDIT: Tobu suggests setting GRUB_GFXMODE to the full pixel resolution of the monitor, and GRUB_GFXPAYLOAD_LINUX=keep to avoid the mode switch after the menu goes away. This does part of what I want, but winds up being worse overall. There's no mode switch after the menu, but there's still a painfully-slow screen repaint (I should probably just give up on GRUB's gfxmode, it's waaaay too slow at 1920x1200). More seriously, there's now a double mode switch when nouveaufb loads, along with fun-looking error messages in dmesg [ 5.923798] [drm] nouveau 0000:02:00.0: allocated 1920x1200 fb: 0x40250000, bo ffff8801ba5f4600 [ 5.923802] fb: conflicting fb hw usage nouveaufb vs EFI VGA - removing generic driver [ 5.923821] [drm] nouveau 0000:02:00.0: PFIFO_INTR 0x00000010 - Ch 1 ("PFIFO_INTR" message repeats 400+ times) [ 5.925609] Console: switching to colour dummy device 80x25 [ 5.925802] Console: switching to colour frame buffer device 240x75

    Read the article

< Previous Page | 76 77 78 79 80 81 82 83 84 85 86 87  | Next Page >