Search Results

Search found 21301 results on 853 pages for 'duplicate values'.

Page 802/853 | < Previous Page | 798 799 800 801 802 803 804 805 806 807 808 809  | Next Page >

  • Drill down rss reader iphone

    - by bing
    Hi everyone, I have made a simple rss reader. The app loads an xml atom file in an array. Now I have added categories to my atom feed, which are first loaded in the array What is the best way to add drill down functionality programmatically. Now only the categories are loaded into the array and displayed. This is the implementation code ..... loading xml file <snip> ..... - (void)parserDidStartDocument:(NSXMLParser *)parser { NSLog(@"found file and started parsing"); } - (void)parser:(NSXMLParser *)parser parseErrorOccurred:(NSError *)parseError { NSString * errorString = [NSString stringWithFormat:@"Unable to download story feed from web site (Error code %i )", [parseError code]]; NSLog(@"error parsing XML: %@", errorString); UIAlertView * errorAlert = [[UIAlertView alloc] initWithTitle:@"Error loading content" message:errorString delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; [errorAlert show]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName attributes:(NSDictionary *)attributeDict{ //NSLog(@"found this element: %@", elementName); currentElement = [elementName copy]; if ([elementName isEqualToString:@"entry"]) { // clear out our story item caches... Categoryentry = [[NSMutableDictionary alloc] init]; currentID = [[NSMutableString alloc] init]; currentTitle = [[NSMutableString alloc] init]; currentSummary = [[NSMutableString alloc] init]; currentContent = [[NSMutableString alloc] init]; } } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName{ //NSLog(@"ended element: %@", elementName); if ([elementName isEqualToString:@"entry"]) { // save values to an entry, then store that item into the array... [Categoryentry setObject:currentTitle forKey:@"title"]; [Categoryentry setObject:currentID forKey:@"id"]; [Categoryentry setObject:currentSummary forKey:@"summary"]; [Categoryentry setObject:currentContent forKey:@"content"]; [categories addObject:[Categoryentry copy]]; NSLog(@"adding category: %@", currentTitle); } } - (void)parser:(NSXMLParser *)parser foundCharacters:(NSString *)string{ //NSLog(@"found characters: %@", string); // save the characters for the current item... if ([currentElement isEqualToString:@"title"]) { [currentTitle appendString:string]; } else if ([currentElement isEqualToString:@"id"]) { [currentID appendString:string]; } else if ([currentElement isEqualToString:@"summary"]) { [currentSummary appendString:string]; } else if ([currentElement isEqualToString:@"content"]) { [currentContent appendString:string]; } } - (void)parserDidEndDocument:(NSXMLParser *)parser { [activityIndicator stopAnimating]; [activityIndicator removeFromSuperview]; NSLog(@"all done!"); NSLog(@"categories array has %d entries", [categories count]); [newsTable reloadData]; }

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Solving a cyclical dependency in Ninject (Compact Framework)

    - by Alex
    I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

    Read the article

  • C# Serialization Surrogate - Cannot access a disposed object

    - by crushhawk
    I have an image class (VisionImage) that is a black box to me. I'm attempting to serialize the image object to file using Serialization Surrogates as explained on this page. Below is my surrogate code. sealed class VisionImageSerializationSurrogate : ISerializationSurrogate { public void GetObjectData(Object obj, SerializationInfo info, StreamingContext context) { VisionImage image = (VisionImage)obj; byte[,] temp = image.ImageToArray().U8; info.AddValue("width", image.Width); info.AddValue("height", image.Height); info.AddValue("pixelvalues", temp, temp.GetType()); } public Object SetObjectData(Object obj, SerializationInfo info, StreamingContext context, ISurrogateSelector selector) { VisionImage image = (VisionImage)obj; Int32 width = info.GetInt32("width"); Int32 height = info.GetInt32("height"); byte[,] temp = new byte[height, width]; temp = (byte[,])info.GetValue("pixelvalues", temp.GetType()); PixelValue2D tempPixels = new PixelValue2D(temp); image.ArrayToImage(tempPixels); return image; } } I've stepped through it to write to binary. It seems to be working fine (file is getting bigger as the images are captured). I tried to test it read the file back in. The values read back in are correct as far as the "info" object is concerned. When I get to the line image.ArrayToImage(tempPixels); It throws the "Cannot access a disposed object" exception. Upon further inspection, the object and the resulting image are both marked as disposed. My code behind the form spawns an "acquisitionWorker" and runs the following code. void acquisitionWorker_LoadImages(object sender, DoWorkEventArgs e) { // This is the main function of the acquisition background worker thread. // Perform image processing here instead of the UI thread to avoid a // sluggish or unresponsive UI. BackgroundWorker worker = (BackgroundWorker)sender; try { uint bufferNumber = 0; // Loop until we tell the thread to cancel or we get an error. When this // function completes the acquisitionWorker_RunWorkerCompleted method will // be called. while (!worker.CancellationPending) { VisionImage savedImage = (VisionImage) formatter.Deserialize(fs); CommonAlgorithms.Copy(savedImage, imageViewer.Image); // Update the UI by calling ReportProgress on the background worker. // This will call the acquisition_ProgressChanged method in the UI // thread, where it is safe to update UI elements. Do not update UI // elements directly in this thread as doing so could result in a // deadlock. worker.ReportProgress(0, bufferNumber); bufferNumber++; } } catch (ImaqException ex) { // If an error occurs and the background worker thread is not being // cancelled, then pass the exception along in the result so that // it can be handled in the acquisition_RunWorkerCompleted method. if (!worker.CancellationPending) e.Result = ex; } } What am I missing here? Why would the object be immediately disposed?

    Read the article

  • UCA + Natural Sorting

    - by Alix Axel
    I recently learnt that PHP already supports the Unicode Collation Algorithm via the intl extension: $array = array ( 'al', 'be', 'Alpha', 'Beta', 'Álpha', 'Àlpha', 'Älpha', '????', 'img10.png', 'img12.png', 'img1.png', 'img2.png', ); if (extension_loaded('intl') === true) { collator_asort(collator_create('root'), $array); } Array ( [0] => al [2] => Alpha [4] => Álpha [5] => Àlpha [6] => Älpha [1] => be [3] => Beta [11] => img1.png [9] => img10.png [8] => img12.png [10] => img2.png [7] => ???? ) As you can see this seems to work perfectly, even with mixed case strings! The only drawback I've encountered so far is that there is no support for natural sorting and I'm wondering what would be the best way to work around that, so that I can merge the best of the two worlds. I've tried to specify the Collator::SORT_NUMERIC sort flag but the result is way messier: collator_asort(collator_create('root'), $array, Collator::SORT_NUMERIC); Array ( [8] => img12.png [7] => ???? [9] => img10.png [10] => img2.png [11] => img1.png [6] => Älpha [5] => Àlpha [1] => be [2] => Alpha [3] => Beta [4] => Álpha [0] => al ) However, if I run the same test with only the img*.png values I get the ideal output: Array ( [3] => img1.png [2] => img2.png [1] => img10.png [0] => img12.png ) Can anyone think of a way to preserve the Unicode sorting while adding natural sorting capabilities?

    Read the article

  • CTE Join query issues

    - by Lee_McIntosh
    Hi everyone, this problem has me head going round in circles at the moment and i wondering if anyone could give any pointers as to where im going wrong. Im trying to produce a SPROC that produces a dataset to be called by SSRS for graphs spanning the last 6 months. The data for example purposes uses three tables (theres more but the it wont change the issue at hand) and are as follows: tbl_ReportList: Report Site ---------------- North abc North def East bbb East ccc East ddd South poa South pob South poc South pod West xyz tbl_TicketsRaisedThisMonth: Date Site Type NoOfTickets --------------------------------------------------------- 2010-07-01 00:00:00.000 abc Support 101 2010-07-01 00:00:00.000 abc Complaint 21 2010-07-01 00:00:00.000 def Support 6 ... 2010-12-01 00:00:00.000 abc Support 93 2010-12-01 00:00:00.000 xyz Support 5 tbl_FeedBackRequests: Date Site NoOfFeedBackR ---------------------------------------------------------------- 2010-07-01 00:00:00.000 abc 101 2010-07-01 00:00:00.000 def 11 ... 2010-12-01 00:00:00.000 abc 63 2010-12-01 00:00:00.000 xyz 4 I'm using CTE's to simplify the code, which is as follows: DECLARE @ReportName VarChar(200) SET @ReportName = 'North'; WITH TicketsRaisedThisMonth AS ( SELECT [Date], Site, SUM(NoOfTickets) AS NoOfTickets FROM tbl_TicketsRaisedThisMonth WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), FeedBackRequests AS ( SELECT [Date], Site, SUM(NoOfFeedBackR) AS NoOfFeedBackR FROM tbl_FeedBackRequests WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), SELECT trtm.[Date] SUM(trtm.NoOfTickets) AS NoOfTickets, SUM(fbr.NoOfFeedBackR) AS NoOfFeedBackR, FROM Reports rpts LEFT OUTER JOIN TotalIncidentsDuringMonth trtm ON rpts.Site = trtm.Site LEFT OUTER JOIN LoggedComplaints fbr ON rpts.Site = fbr.Site WHERE rpts.report = @ReportName GROUP BY trtm.[Date] And the output when the sproc is pass a parameter such as 'North' to be as follows: Date NoOfTickets NoOfFeedBackR ----------------------------------------------------------------------------------- 2010-07-01 00:00:00.000 128 112 2010-08-01 00:00:00.000 <data for that month> <data for that month> 2010-09-01 00:00:00.000 <data for that month> <data for that month> 2010-10-01 00:00:00.000 <data for that month> <data for that month> 2010-11-01 00:00:00.000 <data for that month> <data for that month> 2010-12-01 00:00:00.000 122 63 The issue I'm having is that when i execute the query I'm given a repeated list of values of each month, such as 128 will repeat 6 times then another value for the next months value repeated 6 times, etc. argh!

    Read the article

  • Problem in suspending 2 threads at the same time in MFC!

    - by kiddo
    I am learning about threading and multithreading..so i just created a small application in which i will update the progressbar and a static text using threading.I vl get two inputs from the user, start and end values for how long the loop should rotate.I have 2threads in my application. Thread1- to update the progressbar(according to the loop) the static text which will show the count(loop count). Thread2 - to update the another static text which will just diplay a name Basically if the user clicks start, the progressbar steps up and at the same time filecount and the name are displayed parallely. There's is another operation where if the user clicks pause it(thread) has to suspend until the user clicks resume. The problem is,the above will not work(will not suspend and resume) for both thread..but works for a singlw thread. Please check the code to get an idea and reply me what can done! on button click start void CThreadingEx3Dlg::OnBnClickedStart() { m_ProgressBar.SetRange(start,end); myThread1 = AfxBeginThread((AFX_THREADPROC)MyThreadFunction1,this); myThread2 = AfxBeginThread((AFX_THREADPROC)MyThreadFunction2,this); } thread1 UINT MyThreadFunction1(LPARAM lparam) { CThreadingEx3Dlg* pthis = (CThreadingEx3Dlg*)lparam; for(int intvalue =pthis->start;intvalue<=pthis->end; ++intvalue) { pthis->SendMessage(WM_MY_THREAD_MESSAGE1,intvalue); } return 0; } thread1 function LRESULT CThreadingEx3Dlg::OnThreadMessage1(WPARAM wparam,LPARAM lparam) { int nProgress= (int)wparam; m_ProgressBar.SetPos(nProgress); CString strStatus; strStatus.Format(L"Thread1:Processing item: %d", nProgress); m_Static.SetWindowText(strStatus); Sleep(100); return 0; } thread2 UINT MyThreadFunction2(LPARAM lparam) { CThreadingEx3Dlg* pthis = (CThreadingEx3Dlg*)lparam; for(int i =pthis->start;i<=pthis->end;i++) { pthis->SendMessage(WM_MY_THREAD_MESSAGE2,i); } return 0; } thread2 function LRESULT CThreadingEx3Dlg::OnThreadMessage2(WPARAM wparam,LPARAM lparam) { m_Static1.GetDlgItem(IDC_STATIC6); m_Static1.SetWindowTextW(L"Thread2 Running"); Sleep(100); m_Static1.SetWindowTextW(L""); Sleep(100); return TRUE; } void CThreadingEx3Dlg::OnBnClickedPause() { // TODO: Add your control notification handler code here if(!m_Track) { m_Track = TRUE; GetDlgItem(IDCANCEL)->SetWindowTextW(L"Resume"); myThread1->SuspendThread(); WaitForSingleObject(myThread1->m_hThread,INFINITE); myThread2->SuspendThread(); m_Static.SetWindowTextW(L"Paused.."); } else { m_Track = FALSE; GetDlgItem(IDCANCEL)->SetWindowTextW(L"Pause"); myThread1->ResumeThread(); myThread2->ResumeThread(); /*myEventHandler.SetEvent(); WaitForSingleObject(myThread1->m_hThread,INFINITE);*/ } }

    Read the article

  • Using JavaScript to parse an XML file

    - by Chris Clouten
    I am new to Stack OverFlow and coding in general. I am trying to take an XML file and render it in the browser using JavaScript. I have looked around at some sample code of how to do this and came up with the following code: <!DOCTYPE html> <html> <body> <script> if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.open("GET","social.xml",false); xmlhttp.send(); xmlDoc=xmlhttp.responseXML; document.write("<table border='1'>"); var x=xmlDoc.getElementsByTagName("CD"); for (i=0;i<x.length;i++) { document.write("<tr><td>"); document.write(x[i].getElementsByTagName("c_id")[0].childNodes[0].nodeValue); document.write("</td><td>"); document.write(x[i].getElementsByTagName("facebook_id")[0].childNodes[0].nodeValue); document.write("</td></tr>"); } document.write("</table>"); </script> </body> </html> Anyway, when I run this on my local server none of the data that I am trying to display in the table appears. My .html file and .xml file are in the same folder, so I believe I have the correct file pathway. I could just be making a rookie mistake here, but I can't for the life of me figure out why a table listing the c_id and facebook_id values is not being created. I looked around for answers and haven't been able to find any. Any help would be greatly appreciated. Thanks!

    Read the article

  • Upgrading Entity Framework 1.0 to 4.0 to include foreign keys

    - by duthiega
    Currently I've been working with Entity Framework 1.0 which is located under a service façade. Below is one of the save methods I've created to either update or insert the device in question. This currently works but, I can't help feel that its a bit of a hack having to set the referenced properties to null then re-attach them just to get an insert to work. The changedDevice already holds these values, so why do I need to assign them again. So, I thought I'll update the model to EF4. That way I can just directly access the foreign keys. However, on doing this I've found that there doesn't seem to be an easy way to add the foreign keys except by removing the entity from the diagram and re-adding it. I don't want to do this as I've already been through all the entity properties renaming them from the DB column names. Can anyone help? /// <summary> /// Saves the non network device. /// </summary> /// <param name="nonNetworkDeviceDto">The non network device dto.</param> public void SaveNonNetworkDevice(NonNetworkDeviceDto nonNetworkDeviceDto) { using (var context = new AssetNetworkEntities2()) { var changedDevice = TransformationHelper.ConvertNonNetworkDeviceDtoToEntity(nonNetworkDeviceDto); if (!nonNetworkDeviceDto.DeviceId.Equals(-1)) { var originalDevice = context.NonNetworkDevices.Include("Status").Include("NonNetworkType").FirstOrDefault( d => d.DeviceId.Equals(nonNetworkDeviceDto.DeviceId)); context.ApplyAllReferencedPropertyChanges(originalDevice, changedDevice); context.ApplyCurrentValues(originalDevice.EntityKey.EntitySetName, changedDevice); } else { var maxNetworkDevice = context.NonNetworkDevices.OrderBy("it.DeviceId DESC").First(); changedDevice.DeviceId = maxNetworkDevice.DeviceId + 1; var status = changedDevice.Status; var nonNetworkType = changedDevice.NonNetworkType; changedDevice.Status = null; changedDevice.NonNetworkType = null; context.AttachTo("DeviceStatuses", status); if (nonNetworkType != null) { context.AttachTo("NonNetworkTypes", nonNetworkType); } changedDevice.Status = status; changedDevice.NonNetworkType = nonNetworkType; context.AddToNonNetworkDevices(changedDevice); } context.SaveChanges(); } }

    Read the article

  • Linking two models in a multi-model form

    - by Elliot
    Hey Guys, I have a nested multimodel form right now, using Users and Profiles. Users has_one profile, and Profile belongs_to Users. When the form is submitted, a new user is created, and a new profile is created, but they are not linked (this is the first obvious issue). The user's model has a profile_id row, and the profile's model has a user_id row. Here is the code for the form: <%= form_for(@user, :url => teams_path) do |f| %> <p><%= f.label :email %><br /> <%= f.text_field :email %></p> <p><%= f.label :password %><br /> <%= f.password_field :password %></p> <p><%= f.label :password_confirmation %><br /> <%= f.password_field :password_confirmation %></p> <%= f.hidden_field :role_id, :value => @role.id %></p> <%= f.hidden_field :company_id, :value => current_user.company_id %></p> <%= fields_for @user.profile do |profile_fields| %> <div class="field"> <%= profile_fields.label :first_name %><br /> <%= profile_fields.text_field :first_name %> </div> <div class="field"> <%= profile_fields.label :last_name %><br /> <%= profile_fields.text_field :last_name %> </div> <% end %> <p><%= f.submit "Sign up" %></p> <% end %> A second issue, is even though the username, and password are successfully created through the form for the user model, the hidden fields (role_id & company_id - which are also links to other models) are not created (even though they are part of the model) - the values are successfully shown in the HTML for those fields however. Any help would be great!

    Read the article

  • Having trouble doing an Update with a Linq to Sql object

    - by Pure.Krome
    Hi folks, i've got a simple linq to sql object. I grab it from the database and change a field then save. No rows have been updated. :( When I check the full Sql code that is sent over the wire, I notice that it does an update to the row, not via the primary key but on all the fields via the where clause. Is this normal? I would have thought that it would be easy to update the field(s) with the where clause linking on the Primary Key, instead of where'ing (is that a word :P) on each field. here's the code... using (MyDatabase db = new MyDatabase()) { var boardPost = (from bp in db.BoardPosts where bp.BoardPostId == boardPostId select bp).SingleOrDefault(); if (boardPost != null && boardPost.BoardPostId > 0) { boardPost.ListId = listId; // This changes the value from 0 to 'x' db.SubmitChanges(); } } and here's some sample sql.. exec sp_executesql N'UPDATE [dbo].[BoardPost] SET [ListId] = @p6 WHERE ([BoardPostId] = @p0) AND .... <snip the other fields>',N'@p0 int,@p1 int,@p2 nvarchar(9),@p3 nvarchar(10),@p4 int,@p5 datetime,@p6 int',@p0=1276,@p1=212787,@p2=N'ttreterte',@p3=N'ttreterte3',@p4=1,@p5='2009-09-25 12:32:12.7200000',@p6=72 Now, i know there's a datetime field in this update .. and when i checked the DB it's value was/is '2009-09-25 12:32:12.720' (less zero's, than above) .. so i'm not sure if that is messing up the where clause condition... but still! should it do a where clause on the PK's .. if anything .. for speed! Yes / no ? UPDATE After reading nitzmahone's reply, I then tried playing around with the optimistic concurrency on some values, and it still didn't work :( So then I started some new stuff ... with the optimistic concurrency happening, it includes a where clause on the field it's trying to update. When that happens, it doesn't work. so.. in the above sql, the where clause looks like this ... WHERE ([BoardPostId] = @p0) AND ([ListId] IS NULL) AND ... <rest snipped>) This doesn't sound right! the value in the DB is null, before i do the update. but when i add the ListId value to the where clause (or more to the point, when L2S add's it because of the optomistic concurrecy), it fails to find/match the row. wtf?

    Read the article

  • Can someone who understands C code help me understand this code?

    - by Benjamin
    INT GetTree (HWND hWnd, HTREEITEM hItem, HKEY *pRoot, TCHAR *pszKey, INT nMax) { TV_ITEM tvi; TCHAR szName[256]; HTREEITEM hParent; HWND hwndTV = GetDlgItem (hWnd, ID_TREEV); memset (&tvi, 0, sizeof (tvi)); hParent = TreeView_GetParent (hwndTV, hItem); if (hParent) { // Get the parent of the parent of the... GetTree (hWnd, hParent, pRoot, pszKey, nMax); // Get the name of the item. tvi.mask = TVIF_TEXT; tvi.hItem = hItem; tvi.pszText = szName; tvi.cchTextMax = dim(szName); TreeView_GetItem (hwndTV, &tvi); //send the TVM_GETITEM message? lstrcat (pszKey, TEXT ("\\")); lstrcat (pszKey, szName); } else { *pszKey = TEXT ('\0'); szName[0] = TEXT ('\0'); // Get the name of the item. tvi.mask = TVIF_TEXT | TVIF_PARAM; tvi.hItem = hItem; tvi.pszText = szName; tvi.cchTextMax = dim(szName); if (TreeView_GetItem (hwndTV, &tvi)) //*pRoot = (HTREEITEM)tvi.lParam; //original hItem = (HTREEITEM)tvi.lParam; else { INT rc = GetLastError(); } } return 0; } The block of code that begins with the comment "Get the name of the item" does not make sense to me. If you are getting the listview item why does the code set the parameters of the item being retrieved, because if you already had the values there would be no need to retrieve them. Secondly near the comment "original" is the original line of code which will compile with a varning under embedded visual c++, but if you copy the exact same code into visual studio 2008 it will not compile. Since I did not write any of this code and am trying to learn is it possible the original author made a mistake on this line, since the *pRoot should point to and HKEY type yet he is casting to an HTREEITEM type which should never work since the data types don't match? (Side note someone with a better reputation should add a windows ce tag to SO since windows mobile is not the same as windows ce.)

    Read the article

  • Effective Data Validation

    - by John Conde
    What's an effective way to handle data validation, say, from a form submission? Originally I had a bunch of if statements that checked each value and collected invalid values in an array for later retrieval (and listing). // Store errors here $errors = array(); // Hypothetical check if a string is alphanumeric if (!preg_match('/^[a-z\d]+$/i', $fieldvalue)) { $errors[$fieldname] = 'Please only use letters and numbers for your street address'; } // etc... What I did next was create a class that handles various data validation scenarios and store the results in an internal array. After data validation was complete I would check to see if any errors occurred and handle accordingly: class Validation { private $errorList = array(); public function isAlphaNumeric($string, $field, $msg = '') { if (!preg_match('/^[a-z\d]+$/i', $string)) { $this->errorList[$field] = $msg; } } // more methods here public function creditCard($cardNumber, $field, $msg = '') { // Validate credit card number } // more methods here public function hasErrors() { return count($this->errorList); } } /* Client code */ $validate = new Validation(); $validate->isAlphaNumeric($fieldvalue1, $fieldname1, 'Please only use letters and numbers for your street address'); $validate->creditCard($fieldvalue2, $fieldname2, 'Please enter a valid credit card number'); if ($validate->hasErrors()) { // Handle as appropriate } Naturally it didn't take long before this class became bloated with the virtually unlimited types of data to be validated. What I'm doing now is using decorators to separate the different types of data into their own classes and call them only when needed leaving generic validations (i.e. isAlphaNumeric()) in the base class: class Validation { private $errorList = array(); public function isAlphaNumeric($string, $field, $msg = '') { if (!preg_match('/^[a-z\d]+$/i', $string)) { $this->errorList[$field] = $msg; } } // more generic methods here public function setError($field, $msg = '') { $this->errorList[$field] = $msg; } public function hasErrors() { return count($this->errorList); } } class ValidationCreditCard { protected $validate; public function __construct(Validation $validate) { $this->validate = $validate; } public function creditCard($cardNumber, $field, $msg = '') { // Do validation // ... // if there is an error $this->validate->setError($field, $msg); } // more methods here } /* Client code */ $validate = new Validation(); $validate->isAlphaNumeric($fieldvalue, $fieldname, 'Please only use letters and numbers for your street address'); $validateCC = new ValidationCreditCard($validate); $validateCC->creditCard($fieldvalue2, $fieldname2, 'Please enter a valid credit card number'); if ($validate->hasErrors()) { // Handle as appropriate } Am I on the right track? Or did I just complicate data validation more then I needed to?

    Read the article

  • .NET Extension Objects with XSLT -- how to iterate over a collection?

    - by Pandincus
    Help me, Stackoverflow! I have a simple .NET 3.5 console app that reads some data and sends emails. I'm representing the email format in an XSLT stylesheet so that we can easily change the wording of the email without needing to recompile the app. We're using Extension Objects to pass data to the XSLT when we apply the transformation: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" xmlns:EmailNotification="ext:EmailNotification"> -- this way, we can have statements like: <p> Dear <xsl:value-of select="EmailNotification:get_FullName()" />: </p> The above works fine. I pass the object via code like this (some irrelevant code omitted for brevity): // purely an example structure public struct EmailNotification { public string FullName { get; set; } } // Somewhere in some method ... var notification = new Notification("John Smith"); // ... XsltArgumentList xslArgs = new XsltArgumentList(); xslArgs.AddExtensionObject("ext:EmailNotification", notification); // ... // The part where it breaks! (This is where we do the transformation) xslt.Transform(fakeXMLDocument.CreateNavigator(), xslArgs, XmlWriter.Create(transformedXMLString)); So, all of the above code works. However, I wanted to get a little fancy (always my downfall) and pass a collection, so that I could do something like this: <p>The following accounts need to be verified:</p> <xsl:for-each select="EmailNotification:get_SomeCollection()"> <ul> <li> <xsl:value-of select="@SomeAttribute" /> </li> </ul> <xsl:for-each> When I pass the collection in the extension object and attempt to transform, I get the following error: "Extension function parameters or return values which have Clr type 'String[]' are not supported." or List, or IEnumerable, or whatever I try to pass in. So, my questions are: How can I pass in a collection to my XSLT? What do I put for the xsl:value-of select="" inside the xsl:for-each ? Is what I am trying to do impossible?

    Read the article

  • How to pass operators as parameters

    - by Rodion Ingles
    I have to load an array of doubles from a file, multiply each element by a value in a table (different values for different elements), do some work on it, invert the multiplication (that is, divide) and then save the data back to file. Currently I implement the multiplication and division process in two separate methods. Now there is some extra work behind the scenes but apart from the specific statements where the multiplication/division occurs, the rest of the code is identical. As you can imagine, with this approach you have to be very careful making any changes. The surrounding code is not trivial, so its either a case of manually editing each method or copying changes from one method to the other and remembering to change the * and / operators. After too many close calls I am fed up of this and would like to make a common function which implements the common logic and two wrapper functions which pass which operator to use as a parameter. My initial approach was to use function pointers: MultiplyData(double data) { TransformData(data, &(operator *)); } DivideData(double data) { TransformData(data, &(operator /)); } TransformData(double data, double (*func)(double op1, double op2)) { /* Do stuff here... */ } However, I can't pass the operators as pointers (is this because it is an operator on a native type?), so I tried to use function objects. Initially I thought that multiplies and divides functors in <functional> would be ideal: MultiplyData(double data) { std::multiplies<double> multFunct; TransformData(data, &multFunct); } DivideData(double data) { std::divides<double> divFunct; TransformData(data, &divFunct); } TransformData(double data, std::binary_function<double, double, double> *funct) { /* Do stuff here... */ } As you can see I was trying to use a base class pointer to pass the functor polymorphically. The problem is that std::binary_function does not declare an operator() member for the child classes to implement. Is there something I am missing, or is the solution to implement my own functor heirarchy (which really seems more trouble than it is worth)?

    Read the article

  • PHP Parse Error unexpected '{'

    - by Laxmidi
    Hi, I'm getting a "Parse error: syntax error, unexpected '{' in line 2". And I don't see the problem. <?php class pointLocation {     var $pointOnVertex = true; // Check if the point sits exactly on one of the vertices     function pointLocation() {     }                   function pointInPolygon($point, $polygon, $pointOnVertex = true) {         $this->pointOnVertex = $pointOnVertex;                  // Transform string coordinates into arrays with x and y values         $point = $this->pointStringToCoordinates($point);         $vertices = array();          foreach ($polygon as $vertex) {             $vertices[] = $this->pointStringToCoordinates($vertex);          }                  // Check if the point sits exactly on a vertex         if ($this->pointOnVertex == true and $this->pointOnVertex($point, $vertices) == true) {             return "vertex";         }                  // Check if the point is inside the polygon or on the boundary         $intersections = 0;          $vertices_count = count($vertices);              for ($i=1; $i < $vertices_count; $i++) {             $vertex1 = $vertices[$i-1];              $vertex2 = $vertices[$i];             if ($vertex1['y'] == $vertex2['y'] and $vertex1['y'] == $point['y'] and $point['x'] > min($vertex1['x'], $vertex2['x']) and $point['x'] < max($vertex1['x'], $vertex2['x'])) { // Check if point is on an horizontal polygon boundary                 return "boundary";             }             if ($point['y'] > min($vertex1['y'], $vertex2['y']) and $point['y'] <= max($vertex1['y'], $vertex2['y']) and $point['x'] <= max($vertex1['x'], $vertex2['x']) and $vertex1['y'] != $vertex2['y']) {                  $xinters = ($point['y'] - $vertex1['y']) * ($vertex2['x'] - $vertex1['x']) / ($vertex2['y'] - $vertex1['y']) + $vertex1['x'];                  if ($xinters == $point['x']) { // Check if point is on the polygon boundary (other than horizontal)                     return "boundary";                 }                 if ($vertex1['x'] == $vertex2['x'] || $point['x'] <= $xinters) {                     $intersections++;                  }             }          }          // If the number of edges we passed through is even, then it's in the polygon.          if ($intersections % 2 != 0) {             return "inside";         } else {             return "outside";         }     }               function pointOnVertex($point, $vertices) {         foreach($vertices as $vertex) {             if ($point == $vertex) {                 return true;             }         }          }                   function pointStringToCoordinates($pointString) {         $coordinates = explode(" ", $pointString);         return array("x" => $coordinates[0], "y" => $coordinates[1]);     }           } $pointLocation = new pointLocation(); $points = array("30 19", "0 0", "10 0", "30 20", "11 0", "0 11", "0 10", "30 22", "20 20"); $polygon = array("10 0", "20 0", "30 10", "30 20", "20 30", "10 30", "0 20", "0 10", "10 0"); foreach($points as $key => $point) { echo "$key ($point) is " . $pointLocation->pointInPolygon($point, $polygon) . "<br>"; } ?> Does anyone see the problem? Thanks, -Laxmidi

    Read the article

  • How do I call a function name that is stored in a hash in Perl?

    - by Ether
    I'm sure this is covered in the documentation somewhere but I have been unable to find it... I'm looking for the syntactic sugar that will make it possible to call a method on a class whose name is stored in a hash (as opposed to a simple scalar): use strict; use warnings; package Foo; sub foo { print "in foo()\n" } package main; my %hash = (func => 'foo'); Foo->$hash{func}; If I copy $hash{func} into a scalar variable first, then I can call Foo->$func just fine... but what is missing to enable Foo->$hash{func} to work? (EDIT: I don't mean to do anything special by calling a method on class Foo -- this could just as easily be a blessed object (and in my actual code it is); it was just easier to write up a self-contained example using a class method.) EDIT 2: Just for completeness re the comments below, this is what I'm actually doing (this is in a library of Moose attribute sugar, created with Moose::Exporter): # adds an accessor to a sibling module sub foreignTable { my ($meta, $table, %args) = @_; my $class = 'MyApp::Dir1::Dir2::' . $table; my $dbAccessor = lcfirst $table; eval "require $class" or do { die "Can't load $class: $@" }; $meta->add_attribute( $table, is => 'ro', isa => $class, init_arg => undef, # don't allow in constructor lazy => 1, predicate => 'has_' . $table, default => sub { my $this = shift; $this->debug("in builder for $class"); ### here's the line that uses a hash value as the method name my @args = ($args{primaryKey} => $this->${\$args{primaryKey}}); push @args, ( _dbObject => $this->_dbObject->$dbAccessor ) if $args{fkRelationshipExists}; $this->debug("passing these values to $class -> new: @args"); $class->new(@args); }, ); } I've replaced the marked line above with this: my $pk_accessor = $this->meta->find_attribute_by_name($args{primaryKey})->get_read_method_ref; my @args = ($args{primaryKey} => $this->$pk_accessor); PS. I've just noticed that this same technique (using the Moose meta class to look up the coderef rather than assuming its naming convention) cannot also be used for predicates, as Class::MOP::Attribute does not have a similar get_predicate_method_ref accessor. :(

    Read the article

  • How to Fix my jQuery code in IE?? Works in Firefox..

    - by scott jarvis
    I am using jQuery to show/hide a div container (#pluginOptionsContainer), and load a page (./plugin_options.php) inside it with the required POST vars sent. What POST data is sent is based on the value of a select list (#pluginDD) and the click of a button (#pluginOptionsBtn)... It works fine in Firefox, but doesn't work in IE.. The '$("#pluginOptionsContainer").load()' request never seems to finish in IE - I only see the loading message forever... bind(), empty() and append() all seem to work fine in IE.. But not load().. Here is my code: // wait for the DOM to be loaded $(document).ready(function() { // hide the plugin options $('#pluginOptionsContainer').hide(); // This is the hack for IE if ($.browser.msie) { $("#pluginDD").click(function() { this.blur(); this.focus(); }); } // set the main function $(function() { // the button shows hides the plugin options page (and its container) $("#pluginOptionsBtn") .click(function() { // show the container of the plugin options page $('#pluginOptionsContainer').empty().append('<div style="text-align:center;width:99%;">Loading...</div>'); $('#pluginOptionsContainer').toggle(); }); // set the loading message if user changes selection with either the dropdown or button $("#pluginDD,#pluginOptionsBtn").bind('change', function() { $('#pluginOptionsContainer').empty().append('<div style="text-align:center;width:99%;">Loading...</div>'); }); // then update the page when the plugin is changed when EITHER the plugin button or dropdown or clicked or changed $("#pluginDD,#pluginOptionsBtn").bind('change click', function() { // set form fields as vars in js var pid = <?=$pid;?>; var cid = <?=$contentid;?>; var pDD = $("#pluginDD").val(); // add post vars (must use JSON) to be sent into the js var 'dataString' var dataString = {plugin_options: true, pageid: pid, contentid: cid, pluginDD: pDD }; // include the plugin option page inside the container, with the required values already added into the query string $("#pluginOptionsContainer").load("/admin/inc/edit/content/plugin_options.php#pluginTop", dataString); // add this to stop page refresh return false; }); // end submit function }); // end main function }); // on DOM load Any help would be GREATLY appreciated! I hate IE!

    Read the article

  • I'm having trouble traversing a newly appended DOM element with jQuery

    - by culov
    I have a form that I want to be used to add entries. Once an entry is added, the original form should be reset to prepare it for the next entry, and the saved form should be duplicated prior to resetting and appended onto a div for 'storedEntries.' This much is working (for the most part), but Im having trouble accessing the newly created form... I need to change the value attribute of the submit button from 'add' to 'edit' so properly communicate what clicking that button should do. heres my form: <div class="newTruck"> <form id="addNewTruck" class='updateschedule' action="javascript:sub(sTime.value, eTime.value, lat.value, lng.value, street.value);"> <b style="color:green;">Opening at: </b> <input id="sTime" name="sTime" title="Opening time" value="Click to set opening time" class="datetimepicker"/> <b style="color:red;">Closing at: </b> <input id="eTime" name= "eTime" title="Closing time" value="Click to set closing time" class="datetimepicker"/> <label for='street'>Address</label> <input type='text' name='street' id='street' class='text' autocomplete='off'/> <input id='submit' class='submit' style="cursor: pointer; cursor: hand;" type="submit" value='Add new stop'/> <div id='suggests' class='auto_complete' style='display:none'></div> <input type='hidden' name='lat' id='lat'/> <input type='hidden' name='lng' id='lng'/> ive tried using a hundred different selectors with jquery to no avail... heres my script as it stands: function cloneAndClear(){ var id = name+now; $j("#addNewTruck").clone(true).attr("id",id).appendTo(".scheduledTrucks"); $j('#'+id).filter('#submit').attr('value', 'Edit'); $j("#addNewTruck")[0].reset(); createPickers(); } the element is properly cloned and inserted into the div, but i cant find a way to access this element... the third line in the script never works. Another problem i am having is that the 'values' in the cloned form revert back to the value in the source of the html rather than what the user inputs. advice on how to solve either of these issues is greatly appreciated!

    Read the article

  • PHP - error when insert date into MySQL

    - by Michael Mao
    Hello everyone: I've got a typical problem when trying to insert a date into MySQL. The column defined in MySQL is of type DATE. My PHP version is 5.3.0 Apart from this date-related issue, the rest of my code works just fine. And this is my PHP script to do this: $tablename = BOOKS_TABLE; $insert = mysql_query("INSERT INTO $tablename (barcode, book_name, volume_num,". " author, publisher, item_type, buy_price, buy_date) VALUES ". "(". "'" . $barcode . "', ". "'" . $bookname . "', ". "'" . $volumenum . "', ". "'" . $author . "', ". "'" . $publisher . "', ". "'" . $itemtype . "', ". "'" . $buyprice . "', ". "'" . getMySQLDateString($buydate). //"'STR_TO_DATE('".$buydate ."', '%d/%m/%Y'))'". //nothing changes in MySQL ")"); And this is the faulty function : function getMySQLDateString($buydate) //typical buydate : 04/21/2009 { $mysqlDateString = date('Y-m-d H:i:s', $strtotime($buydate)); return $mysqlDateString; } The first commented out line wouldn't do anything, the script is executed with no error, however, there is nothing changed in datebase after this. The current approach will cause a Fatal error saying function name must be a string in this line. Actually I followed this thread on SO, but just cannot pass the date into MySQL... Can anyone help me figure out which part is not right? How would you do it, in this case, to get it right? Sorry about such a journeyman-like question, thanks a lot in advance.

    Read the article

  • Java replacement for C macros

    - by thkala
    Recently I refactored the code of a 3rd party hash function from C++ to C. The process was relatively painless, with only a few changes of note. Now I want to write the same function in Java and I came upon a slight issue. In the C/C++ code there is a C preprocessor macro that takes a few integer variables names as arguments and performs a bunch of bitwise operations with their contents and a few constants. That macro is used in several different places, therefore its presence avoids a fair bit of code duplication. In Java, however, there is no equivalent for the C preprocessor. There is also no way to affect any basic type passed as an argument to a method - even autoboxing produces immutable objects. Coupled with the fact that Java methods return a single value, I can't seem to find a simple way to rewrite the macro. Avenues that I considered: Expand the macro by hand everywhere: It would work, but the code duplication could make things interesting in the long run. Write a method that returns an array: This would also work, but it would repeatedly result into code like this: long tmp[] = bitops(k, l, m, x, y, z); k = tmp[0]; l = tmp[1]; m = tmp[2]; x = tmp[3]; y = tmp[4]; z = tmp[5]; Write a method that takes an array as an argument: This would mean that all variable names would be reduced to array element references - it would be rather hard to keep track of which index corresponds to which variable. Create a separate class e.g. State with public fields of the appropriate type and use that as an argument to a method: This is my current solution. It allows the method to alter the variables, while still keeping their names. It has the disadvantage, however, that the State class will get more and more complex, as more macros and variables are added, in order to avoid copying values back and forth among different State objects. How would you rewrite such a C macro in Java? Is there a more appropriate way to deal with this, using the facilities provided by the standard Java 6 Development Kit (i.e. without 3rd party libraries or a separate preprocessor)?

    Read the article

  • Remove never-run call to templated function, get allocation error on run-time

    - by Narfanator
    First off, I'm a bit at a loss as to how to ask this question. So I'm going to try throwing lots of information at the problem. Ok, so, I went to completely redesign my test project for my experimental core library thingy. I use a lot of template shenanigans in the library. When I removed the "user" code, the tests gave me a memory allocation error. After quite a bit of experimenting, I narrowed it down to this bit of code (out of a couple hundred lines): void VOODOO(components::switchBoard &board){ board.addComponent<using_allegro::keyInputs<'w'> >(); } Fundementally, what's weirding me out is that it appears that the act of compiling this function (and the template function it then uses, and the template functions those then use...), makes this bug not appear. This code is not being run. Similar code (the same, but for different key vals) occurs elsewhere, but is within Boost TDD code. I realize I certainly haven't given enough information for you to solve it for me; I tried, but it more-or-less spirals into most of the code base. I think I'm most looking for "here's what the problem could be", "here's where to look", etc. There's something that's happening during compile because of this line, but I don't know enough about that step to begin looking. Sooo, how can a (presumably) compilied, but never actually run, bit of templated code, when removed, cause another part of code to fail? Error: Unhandled exceptionat 0x6fe731ea (msvcr90d.dll) in Switchboard.exe: 0xC0000005: Access violation reading location 0xcdcdcdc1. Callstack: operator delete(void * pUser Data) allocator< class name related to key inputs callbacks ::deallocate vector< same class ::_Insert_n(...) vector< " " ::insert(...) vector<" "::push_back(...) It looks like maybe the vector isn't valid, because _MyFirst and similar data members are showing values of 0xcdcdcdcd in the debugger. But the vector is a member variable...

    Read the article

  • Retain a list of objects and pass it to the create/edit view when validation fails in ASP.NET MVC 2

    - by brainnovative
    I am binding a Foreign key property in my model. I am passing a list of possible values for that property in my model. The model looks something like this: public class UserModel { public bool Email { get; set; } public bool Name { get; set; } public RoleModel Role { get; set; } public IList<RoleModel> Roles { get; set; } } public class RoleModel { public string RoleName { get; set; } } This is what I have in the controller: public ActionResult Create() { IList<RoleModel> roles = RoleModel.FromArray(_userService.GetAllRoles()); UserModel model = new UserModel() { Roles = roles }; return View(model); } In the view I have: <div class="editor-label"> <%= Html.LabelFor(model => model.Role) %> </div> <div class="editor-field"> <%= Html.DropDownListFor(model => model.Role, new SelectList(Model.Roles, "RoleName", "RoleName", Model.Role))%> <%= Html.ValidationMessageFor(model => model.Role)%> </div> What do I need to do to get the list of roles back to my controller to pass it again to the view when validation fails. This is what I need: [HttpPost] public ActionResult Create(UserModel model) { if (ModelState.IsValid) { // insert logic here } //the validation fails so I pass the model again to the view for user to update data but model.Roles is null :( return View(model); } As written in the comments above I need to pass the model with the list of roles again to my view but model.Roles is null. Currently I ask the service again for the roles (model.Roles = RoleModel.FromArray(_userService.GetAllRoles());) but I don't want to add an extra overhead of getting the list from DB when I have already done that.. Anyone knows how to do it?

    Read the article

  • SQLException: incorrect syntax near '2'.

    - by Tobechukwu Ezenachukwu
    whenever I call the "ExecuteNonQuery" command on the following CommandText, I get the above SQLException myCommand.CommandText = "INSERT INTO fixtures (round_id, matchcode, date_utc, time_utc, date_london, time_london, team_A_id, team_A, team_A_country, team_B_id, team_B, team_B_country, status, gameweek, winner, fs_A, fs_B, hts_A, hts_B, ets_A, ets_B, ps_A, ps_B, last_updated) VALUES (" _ & round_id & "," & match_id & "," & date_utc & ",'" & time_utc & "'," & date_london & ",'" & time_london & "'," & team_A_id & ",'" & team_A_name & "','" & team_A_country & "'," & team_B_id & ",'" & team_B_name & "','" & _ team_B_country & "','" & status & "'," & gameweek & ",'" & winner & "'," & fs_A & "," & fs_B & "," & hts_A & "," & hts_B & "," & ets_A & "," & ets_B & "," & ps_A & "," & ps_B & "," & last_updated & ")" But whenever, i remove the last table item - "last_updated", the error disappears. Please help me resolve this issue. Is there any special treatment to be given to datetime fields??? Thanks for your help

    Read the article

  • go programming POST FormValue can't be printed

    - by poor_programmer
    Before I being a bit of background, I am very new to go programming language. I am running go on Win 7, latest go package installer for windows. I'm not good at coding but I do like some challenge of learning a new language. I wanted to start learn Erlang but found go very interesting based on the GO I/O videos in youtube. I'm having problem with capturing POST form values in GO. I spend three hours yesterday to get go to print a POST form value in the browser and failed miserably. I don't know what I'm doing wrong, can anyone point me to the right direction? I can easily do this in another language like C#, PHP, VB, ASP, Rails etc. I have search the entire interweb and haven't found a working sample. Below is my sample code. Here is Index.html page {{ define "title" }}Homepage{{ end }} {{ define "content" }} <h1>My Homepage</h1> <p>Hello, and welcome to my homepage!</p> <form method="POST" action="/"> <p> Enter your name : <input type="text" name="username"> </P> <p> <button>Go</button> </form> <br /><br /> {{ end }} Here is the base page <!DOCTYPE html> <html lang="en"> <head> <title>{{ template "title" . }}</title> </head> <body> <section id="contents"> {{ template "content" . }} </section> <footer id="footer"> My homepage 2012 copy </footer> </body> </html> now some go code package main import ( "fmt" "http" "strings" "html/template" ) var index = template.Must(template.ParseFiles( "templates/_base.html", "templates/index.html", )) func GeneralHandler(w http.ResponseWriter, r *http.Request) { index.Execute(w, nil) if r.Method == "POST" { a := r.FormValue("username") fmt.Fprintf(w, "hi %s!",a); //<-- this variable does not rendered in the browser!!! } } func helloHandler(w http.ResponseWriter, r *http.Request) { remPartOfURL := r.URL.Path[len("/hello/"):] fmt.Fprintf(w, "Hello %s!", remPartOfURL) } func main() { http.HandleFunc("/", GeneralHandler) http.HandleFunc("/hello/", helloHandler) http.ListenAndServe("localhost:81", nil) } Thanks! PS: Very tedious to add four space before every line of code in stackoverflow especially when you are copy pasting. Didn't find it very user friendly or is there an easier way?

    Read the article

< Previous Page | 798 799 800 801 802 803 804 805 806 807 808 809  | Next Page >