Search Results

Search found 30778 results on 1232 pages for 'private key'.

Page 82/1232 | < Previous Page | 78 79 80 81 82 83 84 85 86 87 88 89  | Next Page >

  • jQuery AJAX Loading Page Content Only After I Press Shift Key

    - by Cosmin
    My ajax + jquery loading page only after holding shift key and duplicate new empty window. If I press the loading button nothing hapen, only after I press shift key I get to load the page correctly... this is my ajax script: $(document).ready(function () { $(".getUsersA").click(function () { $.ajax({ beforeSend: function () { $(".gridD").html(spinner) }, url: 'lib/some_url.php', type: 'POST', data: ({ data1:'2013-09-01' }), success: function (results) {$(".gridD").html(results);} }); }); }); I have a second js file with just this line of code for spinner var spinner = "<img src='images/spinner.gif' border='0'>"; html code: <html> <head> <title>Title</title> <script type="text/javascript" src="js/jquery-1.10.2.js"></script> <script type="text/javascript" src="js/ajax.js"></script> <script type="text/javascript" src="js/general.js"></script> </head> <body> <h1>Putting it all tugether ... with jQuery</h1> <div class="thedivD"><a href="" class="buttonA getUsersA">Get Users</a></div> <h3>jQuery results</h3> <div class="gridD"></div> </body> </html>

    Read the article

  • How are declared private ivars different from synthesized ivars?

    - by lemnar
    I know that the modern Objective-C runtime can synthesize ivars. I thought that synthesized ivars behaved exactly like declared ivars that are marked @private, but they don't. As a result, come code compiles only under the modern runtime that I expected would work on either. For example, a superclass: @interface A : NSObject { #if !__OBJC2__ @private NSString *_c; #endif } @property (nonatomic, copy) NSString *d; @end @implementation A @synthesize d=_c; - (void)dealloc { [_c release]; [super dealloc]; } @end and a subclass: @interface B : A { #if !__OBJC2__ @private NSString *_c; #endif } @property (nonatomic, copy) NSString *e; @end @implementation B @synthesize e=_c; - (void)dealloc { [_c release]; [super dealloc]; } @end A subclass can't have a declared ivar with the same name as one of its superclass's declared ivars, even if the superclass's ivar is private. This seems to me like a violation of the meaning of @private, since the subclass is affected by the superclass's choice of something private. What I'm more concerned about, however, is how should I think about synthesized ivars. I thought they acted like declared private ivars, but without the fragile base class problem. Maybe that's right, and I just don't understand the fragile base class problem. Why does the above code compile only in the modern runtime? Does the fragile base class problem exist when all superclass instance variables are private?

    Read the article

  • implementing cryptographic algorithms, specifically the key expansion part

    - by masseyc
    Hey, recently I picked up a copy of Applied Cryptography by Bruce Schneier and it's been a good read. I now understand how several algorithms outlined in the book work, and I'd like to start implementing a few of them in C. One thing that many of the algorithms have in common is dividing an x-bit key, into several smaller y-bit keys. For example, blowfish's key, X, is 64-bits, but you are required to break it up into two 32-bit halves; Xl and Xr. This is where I'm getting stuck. I'm fairly decent with C, but I'm not the strongest when it comes to bitwise operators and the like. After some help on IRC, I managed to come up with these two macros: #define splitup(a, b, c) {b = a >> 32; c = a & 0xffffffff; } #define combine(a, b, c) {a = (c << 32) | a;} Where a is 64 bits and b and c are 32 bits. However, the compiler warns me about the fact that I'm shifting a 32 bit variable by 32 bits. My questions are these: what's bad about shifting a 32-bit variable 32 bits? I'm guessing it's undefined, but these macros do seem to be working. Also, would you suggest I go about this another way? As I said, I'm fairly familiar with C, but bitwise operators and the like still give me a headache.

    Read the article

  • How to test if a doctrine records has any relations that are used

    - by murze
    Hi, I'm using a doctrine table that has several optional relations (of types Doctrine_Relation_Association and Doctrine_Relation_ForeignKey) with other tables. How can I test if a record from that table has connections with records from the related table. Here is an example to make my question more clear. Assume that you have a User and a user has a many to many relation with Usergroups and a User can have one Userrole How can I test if a give user is part of any Usergroups or has a role. The solution starts I believe with $relations = Doctrine_Core::getTable('User')->getRelations(); $user = Doctrine_Core::getTable('User')->findOne(1); foreach($relations as $relation) { //here should go a test if the user has a related record for this relation if ($relation instanceof Doctrine_Relation_Association) { //here the related table probably has more then one foreign key (ex. user_id and group_id) } if ($relation instanceof Doctrine_Relation_ForeignKey) { //here the related table probably has the primary key of this table (id) as a foreign key (user_id) } } //true or false echo $result I'm looking for a general solution that will work no matter how many relations there are between user and other tables. Thanks!

    Read the article

  • "Special case" records for foreign key constraints

    - by keithjgrant
    Let's say I have a mysql table, called foo with a foreign key option_id constrained to the option table. When I create a foo record, the user may or may not have selected an option, and 'no option' is a viable selection. What is the best way to differentiate between 'null' (i.e. the user hasn't made a selection yet) and 'no option' (i.e. the user selected 'no option')? Right now, my plan is to insert a special record into the option table. Let's say that winds up with an id of 227 (this table already has a number of records at this point, so '1' isn't available). I have no need to access this record at a database level, and it would act as nothing more than a placeholder that the foreign key in the foo table can reference. So do I just hard-code '227' in my codebase when I'm creating 'foo' records where the user has selected 'no option'? The hard-coded id seems sloppy, and leaves room for error as the code is maintained down the road, but I'm not really sure of another approach.

    Read the article

  • NHibernate query against the key field of a dictionary (map)

    - by Carl Raymond
    I have an object model where a Calendar object has an IDictionary<MembershipUser, Perms> called UserPermissions, where MembershipUser is an object, and Perms is a simple enumeration. This is in the mapping file for Calendar as <map name="UserPermissions" table="CalendarUserPermissions" lazy="true" cascade="all"> <key column="CalendarID"/> <index-many-to-many class="MembershipUser" column="UserGUID" /> <element column="Permissions" type="CalendarPermission" not-null="true" /> </map> Now I want to execute a query to find all calendars for which a given user has some permission defined. The permission is irrelevant; I just want a list of the calendars where a given user is present as a key in the UserPermissions dictionary. I have the username property, not a MembershipUser object. How do I build that using QBC (or HQL)? Here's what I've tried: ISession session = SessionManager.CurrentSession; ICriteria calCrit = session.CreateCriteria<Calendar>(); ICriteria userCrit = calCrit.CreateCriteria("UserPermissions.indices"); userCrit.Add(Expression.Eq("Username", username)); return calCrit.List<Calendar>(); This constructed invalid SQL -- the WHERE clause contained WHERE membership1_.Username = @p0 as expected, but the FROM clause didn't include the MemberhipUsers table. Also, I really had to struggle to learn about the .indices notation. I found it by digging through the NHibernate source code, and saw that there's also .elements and some other dotted notations. Where's a reference to the allowed syntax of an association path? I feel like what's above is very close, and just missing something simple.

    Read the article

  • Reverse alphabetic sort multidimensional PHP array maintain key

    - by useyourillusiontoo
    I'm dying here, any help would be great. I've got an array that I can sort a-z on the value of a specific key but cannot sort in reverse z-a. sample of my array which i'd like to sort by ProjectName (z-a): Array ( [0] => Array ( [count] => 1 [ProjectName] => bbcjob [Postcode] => 53.471922,-2.2996078 [Sector] => Public ) [1] => Array ( [count] => 1 [ProjectName] => commercial enterprise zone [Postcode] => 53.3742081,-1.4926439 [Sector] => Public ) [2] => Array ( [count] => 1 [ProjectName] => Monkeys eat chips [Postcode] => 51.5141492,-0.2271227 [Sector] => Private the desired results would be to maintain the entire array key - value structure but with the order: Monkeys eat chips Commericial enterprise zone bbcjob I hope this makes sense

    Read the article

  • How to load an RSA key from binary data to an RSA structure using the OpenSSL C Library?

    - by Andreas Bonini
    Currently I have my private key saved in a file, private.key, and I use the following function to load it: RSA *r = PEM_read_RSAPrivateKey("private.key", NULL, NULL, NULL); This works perfectly but I'm not happy with the file-based format; I want to save my key in pure binary form (ie, no base64 or similar) in a char* variable and load/save the key from/to it. This way I have much more freedom: I'll be able to store the key directly into the application const char key[] { 0x01, 0x02, ... };, send it over a network socket, etc. Unfortunately though I haven't found a way to do that. The only way to save and load a key I know of reads/saves it to a file directly.

    Read the article

  • Is There a Better Way to Feed Different Parameters into Functions with If-Statements?

    - by FlowofSoul
    I've been teaching myself Python for a little while now, and I've never programmed before. I just wrote a basic backup program that writes out the progress of each individual file while it is copying. I wrote a function that determines buffer size so that smaller files are copied with a smaller buffer, and bigger files are copied with a bigger buffer. The way I have the code set up now doesn't seem very efficient, as there is an if loop that then leads to another if loops, creating four options, and they all just call the same function with different parameters. import os import sys def smartcopy(filestocopy, dest_path, show_progress = False): """Determines what buffer size to use with copy() Setting show_progress to True calls back display_progress()""" #filestocopy is a list of dictionaries for the files needed to be copied #dictionaries are used as the fullpath, st_mtime, and size are needed if len(filestocopy.keys()) == 0: return None #Determines average file size for which buffer to use average_size = 0 for key in filestocopy.keys(): average_size += int(filestocopy[key]['size']) average_size = average_size/len(filestocopy.keys()) #Smaller buffer for smaller files if average_size < 1024*10000: #Buffer sizes determined by informal tests on my laptop if show_progress: for key in filestocopy.keys(): #dest_path+key is the destination path, as the key is the relative path #and the dest_path is the top level folder copy(filestocopy[key]['fullpath'], dest_path+key, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, callback = None) #Bigger buffer for bigger files else: if show_progress: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600) def display_progress(pos, total, filename): percent = round(float(pos)/float(total)*100,2) if percent <= 100: sys.stdout.write(filename + ' - ' + str(percent)+'% \r') else: percent = 100 sys.stdout.write(filename + ' - Completed \n') Is there a better way to accomplish what I'm doing? Sorry if the code is commented poorly or hard to follow. I didn't want to ask someone to read through all 120 lines of my poorly written code, so I just isolated the two functions. Thanks for any help.

    Read the article

  • Compound Primary Key in Hibernate using Annotations

    - by Rich
    Hi, I have a table which uses two columns to represent its primary key, a transaction id and then the sequence number. I tried what was recommended http://docs.jboss.org/hibernate/stable/annotations/reference/en/html_single/#entity-mapping in section 2.2.3.2.2, but when I used the Hibernate session to commit this Entity object, it leaves out the TXN_ID field in the insert statement and only includes the BA_SEQ field! What's going wrong? Here's the related code excerpt: @Id @Column(name="TXN_ID") private long txn_id; public long getTxnId(){return txn_id;} public void setTxnId(long t){this.txn_id=t;} @Id @Column(name="BA_SEQ") private int seq; public int getSeq(){return seq;} public void setSeq(int s){this.seq=s;} And here are some log statements to show what exactly happens to fail: In createKeepTxnId of DAO base class: about to commit Transaction :: txn_id->90625 seq->0 ...<Snip>... Hibernate: insert into TBL (BA_ACCT_TXN_ID, BA_AUTH_SRVC_TXN_ID, BILL_SRVC_ID, BA_BILL_SRVC_TXN_ID, BA_CAUSE_TXN_ID, BA_CHANNEL, CUSTOMER_ID, BA_MERCHANT_FREETEXT, MERCHANT_ID, MERCHANT_PARENT_ID, MERCHANT_ROOT_ID, BA_MERCHANT_TXN_ID, BA_PRICE, BA_PRICE_CRNCY, BA_PROP_REQS, BA_PROP_VALS, BA_REFERENCE, RESERVED_1, RESERVED_2, RESERVED_3, SRVC_PROD_ID, BA_STATUS, BA_TAX_NAME, BA_TAX_RATE, BA_TIMESTAMP, BA_SEQ) values (?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?) [WARN] util.JDBCExceptionReporter SQL Error: 1400, SQLState: 23000 [ERROR] util.JDBCExceptionReporter ORA-01400: cannot insert NULL into ("SCHEMA"."TBL"."TXN_ID") The important thing to note is I print out the entity object which has a txn_id set, and then the following insert into statement does not include TXN_ID in the listing and thus the NOT NULL table constraint rejects the query.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Use MySQL trigger to update another table when duplicate key found

    - by Jason
    Been scratching my head on this one, hoping one of you kind people and direct me towards solving this problem. I have a mysql table of customers, it contains a lot of data, but for the purpose of this question, we only need to worry about 4 columns 'ID', 'Firstname', 'Lastname', 'Postcode' Problem is, the table contains a lot of duplicated customers. A new table is being created where each customer is unique and for us, we decide a unique customer is based on 'Firstname', 'Lastname' and 'Postcode' However, (this is the important bit) we need to ensure each new "unique" customer record also can be matched to the original multiple entries of that customer in the original table. I believe the best way to do this is to have a third table, that has 'NewUniqueID', 'OldCustomerID'. So we can search this table for 'NewUniqueID' = '123' and it would return multiple 'OldCustomerID' values where appropriate. I am hoping to make this work using a trigger and the on duplicate key syntax. So what would happen is as follows: An query is run taking the old customer table and inserting it in to the new unique table. (A standard Insert Select query) On duplicate key continue adding records, but add one entry in to the third table noting the 'NewUniqueID' that duped along with the 'OldCustomerID' of the record we were trying to insert. Hope this makes sense, my apologies if it isn't clear. I welcome and appreciate any thoughts on this one! Many thanks Jason

    Read the article

  • Invoke Command When "ENTER" Key Is Pressed In XAML

    - by bitxwise
    I want to invoke a command when ENTER is pressed in a TextBox. Consider the following XAML: <UserControl ... xmlns:i="clr-namespace:System.Windows.Interactivity;assembly=System.Windows.Interactivity" ...> ... <TextBox> <i:Interaction.Triggers> <i:EventTrigger EventName="KeyUp"> <i:InvokeCommandAction Command="{Binding MyCommand}" CommandParameter="{Binding Text}" /> </i:EventTrigger> </i:Interaction.Triggers> </TextBox> ... </UserControl> and that MyCommand is as follows: public ICommand MyCommand { get { return new DelegateCommand<string>(MyCommandExecute); } } private void MyCommandExecute(string s) { ... } With the above, my command is invoked for every key press. How can I restrict the command to only invoke when the ENTER key is pressed? I understand that with Expression Blend I can use Conditions but those seem to be restricted to elements and can't consider event arguments. I have also come across SLEX which offers its own InvokeCommandAction implementation that is built on top of the Systems.Windows.Interactivity implementation and can do what I need. Another consideration is to write my own trigger, but I'm hoping there's a way to do it without using external toolkits.

    Read the article

  • Handle BACK key event in child view

    - by Mick Byrne
    In my app, users can tap on image thumbnails to see a full size version. When the thumbnail is tapped a bunch of new views are created in code (i.e. no XML), appended at the end of the view hierarchy and some scaling and rotating transitions happen, then the full size, high res version of the image is displayed. Tapping on the full size image reverses the transitions and removes the new views from the view hierarchy. I want users to also be able to press the BACK key to reverse the image transitions. However, I can't seem to catch the KeyEvent. This is what I'm trying at the moment: // Set a click listener on the image to reverse everything frameView.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { zoomOut(); // This works fine } }); // Set the focus onto the frame and then set a key listener to catch the back buttons frameView.setFocusable(true); frameView.setFocusableInTouchMode(true); frameView.requestFocus(); frameView.setOnKeyListener(new OnKeyListener() { @Override public boolean onKey(View v, int keyCode, KeyEvent event) { // The code never even gets here !!! if(keyCode == KeyEvent.KEYCODE_BACK && event.getRepeatCount() == 0) { zoomOut(); return true; } return false; } });

    Read the article

  • Displaying cookies as key=value for all domains?

    - by OverTheRainbow
    Hello, This question pertains to the use of the cookie-capable WebClient derived class presented in the How can I get the WebClient to use Cookies? question. I'd like to use a ListBox to... 1) display each cookie individually as "key=value" (the For Each loop displays all of them as one string), and 2) be able to display all cookies, regardless of the domain from which they came ("www.google.com", here): Imports System.IO Imports System.Net Public Class Form1 Private Sub Button1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles Button1.Click Dim webClient As New CookieAwareWebClient Const URL = "http://www.google.com" Dim response As String response = webClient.DownloadString(URL) RichTextBox1.Text = response 'How to display cookies as key/value in ListBox? 'PREF=ID=5e770c1a9f279d5f:TM=1274032511:LM=1274032511:S=1RDPaKJKpoMT9T54 For Each mycc In webClient.cc.GetCookies(New Uri(URL)) ListBox1.Items.Add(mycc.ToString) Next End Sub End Class Public Class CookieAwareWebClient Inherits WebClient Public cc As New CookieContainer() Private lastPage As String Protected Overrides Function GetWebRequest(ByVal address As System.Uri) As System.Net.WebRequest Dim R = MyBase.GetWebRequest(address) If TypeOf R Is HttpWebRequest Then With DirectCast(R, HttpWebRequest) .CookieContainer = cc If Not lastPage Is Nothing Then .Referer = lastPage End If End With End If lastPage = address.ToString() Return R End Function End Class Thank you.

    Read the article

  • Java RSA Encrypt using .NET XML Key File - need help

    - by badMonkey
    In .net I have generated the following public key file: <RSAKeyValue> <Modulus>xTSiS4+I/x9awUXcF66Ffw7tracsQfGCn6g6k/hGkLquHYMFTCYk4mOB5NwLwqczwvl8HkQfDShGcvrm47XHKUzA8iadWdA5n4toBECzRxiCWCHm1KEg59LUD3fxTG5ogGiNxDj9wSguCIzFdUxBYq5ot2J4iLgGu0qShml5vwk=</Modulus> <Exponent>AQAB</Exponent> .NET is happy to encrypt using it's normal methods. I am trying to use this key to encode a string in Java and am running into an Arithmetic problem (exception) when I attempt to encrypt the string. The following is the code I am using to encrypt: byte[] modulusBytes = Base64.decode(this.getString(R.string.public_key_modulus)); byte[] exponentBytes = Base64.decode(this.getString(R.string.public_key_exponent)); BigInteger modulus = new BigInteger( modulusBytes ); BigInteger exponent = new BigInteger( exponentBytes); RSAPublicKeySpec rsaPubKey = new RSAPublicKeySpec(modulus, exponent); KeyFactory fact = KeyFactory.getInstance("RSA"); PublicKey pubKey = fact.generatePublic(rsaPubKey); Cipher cipher = Cipher.getInstance("RSA"); cipher.init(Cipher.ENCRYPT_MODE, pubKey); byte[] cipherData = cipher.doFinal( new String("big kitty dancing").getBytes() ); It is the final line in the code block that fails. I have looked at numerous examples and this is the best I could come up with. If it is not obvious, the R.string.public_key_modulus is a copy/paste of the text in the Modulus element, same applies for exponent.

    Read the article

  • Fluent NHibernate - Set reference key columns to null

    - by Matt
    Hi, I have a table of Appointments and a table of AppointmentOutcomes. On my Appointments table I have an OutcomeID field which has a foreign key to AppointmentOutcomes. My Fluent NHibernate mappings look as follows; Table("Appointments"); Not.LazyLoad(); Id(c => c.ID).GeneratedBy.Assigned(); Map(c => c.Subject); Map(c => c.StartTime); References(c => c.Outcome, "OutcomeID"); Table("AppointmentOutcomes"); Not.LazyLoad(); Id(c => c.ID).GeneratedBy.Assigned(); Map(c => c.Description); Using NHibernate, if I delete an AppointmentOutcome an exception is thrown because the foreign key is invalid. What I would like to happen is that deleting an AppointmentOutcome would automatically set the OutcomeID of any Appointments that reference the AppointmentOutcome to NULL. Is this possible using Fluent NHibernate?

    Read the article

  • Need to sort 3 arrays by one key array

    - by jeff6461
    I am trying to get 3 arrays sorted by one key array in objective c for the iphone, here is a example to help out... Array 1 Array 2 Array 3 Array 4 1 15 21 7 3 12 8 9 6 7 8 0 2 3 4 8 When sorted i want this to look like Array 1 Array 2 Array 3 Array 4 1 15 21 7 2 3 4 8 3 12 8 9 6 7 8 0 So array 2,3,4 are moving with Array 1 when sorted. Currently i am using a bubble sort to do this but it lags so bad that it crashes by app. The code i am using to do this is int flag = 0; int i = 0; int temp = 0; do { flag=1; for(i = 0; i < distancenumber; i++) { if(distance[i] > distance[i+1]) { temp = distance[i]; distance[i]=distance[i + 1]; distance[i + 1]=temp; temp = FlowerarrayNumber[i]; FlowerarrayNumber[i] = FlowerarrayNumber[i+1]; FlowerarrayNumber[i + 1] = temp; temp = BeearrayNumber[i]; BeearrayNumber[i] = BeearrayNumber[i + 1]; BeearrayNumber[i + 1] = temp; flag=0; } } }while (flag==0); where distance number is the amount of elements in all of the arrays, distance is array 1 or my key array. and the other 2 are getting sorted. If anyone can help me get a merge sort(or something faster, it is running on a iPhone so it needs to be quick and light) to do this that would be great i cannot figure out how the recursion works in this method and so having a hard time to get the code to work. Any help would be greatly appreciated

    Read the article

  • List all foreign key constraints that refer to a particular column in a specific table

    - by Sid
    I would like to see a list of all the tables and columns that refer (either directly or indirectly) a specific column in the 'main' table via a foreign key constraint that has the ON DELETE=CASCADE setting missing. The tricky part is that there would be an indirect relationships buried across up to 5 levels deep. (example: ... great-grandchild- FK3 = grandchild = FK2 = child = FK1 = main table). We need to dig up the leaf tables-columns, not just the very 1st level. The 'good' part about this is that execution speed isn't of concern, it'll be run on a backup copy of the production db to fix any relational issues for the future. I did SELECT * FROM sys.foreign_keys but that gives me the name of the constraint - not the names of the child-parent tables and the columns in the relationship (the juicy bits). Plus the previous designer used short, non-descriptive/random names for the FK constraints, unlike our practice below The way we're adding constraints into SQL Server: ALTER TABLE [dbo].[UserEmailPrefs] WITH CHECK ADD CONSTRAINT [FK_UserEmailPrefs_UserMasterTable_UserId] FOREIGN KEY([UserId]) REFERENCES [dbo].[UserMasterTable] ([UserId]) ON DELETE CASCADE GO ALTER TABLE [dbo].[UserEmailPrefs] CHECK CONSTRAINT [FK_UserEmailPrefs_UserMasterTable_UserId] GO The comments in this SO question inpire this question.

    Read the article

  • Python - Access a class from a list using a key

    - by Fake Name
    Is there any way to make a list of classes behave like a set in python? Basically, I'm working on a piece of software that does some involved string comparison, and I have a custom class for handling the strings. Therefore, there is an instance of the class for each string. As a result, I have a large list containing all these classes. I would like to be able to access them like list[key], where in this case, the key is a string the class is based off of. It seems to me that I sould be able to do this somewhat easily, by adding something like __cmp__ to the class, but either I'm being obtuse (likely), or Im missing someting in the docs. Basically, I want to be able to do something like this (Python prompt example): >>class a: ... def __init__(self, x): ... self.var = x ... >>> from test import a >>> cl = set([a("Hello"), a("World"), a("Pie")]) >>> print cl set([<test.a instance at 0x00C866C0>, <test.a instance at 0x00C866E8>, <test.a instance at 0x00C86710>]) >>> cl["World"] <test.a instance at 0x00C866E8> Thanks!

    Read the article

  • JSON can't read, key reading fail maybe

    - by Abdullah Al Mubarok
    I wonder why I can't read the JSON Object like this : { "1":{"bulan":"Januari","tahun":"2012","tagihan":"205000","status":"Lunas"}, "2":{"bulan":"Februari","tahun":"2012","tagihan":"180000","status":"Lunas"}, "3":{"bulan":"Maret","tahun":"2012","tagihan":"120000","status":"Lunas"}, "4":{"bulan":"April","tahun":"2012","tagihan":"230000","status":"Lunas"}, "5":{"bulan":"Mei","tahun":"2012","tagihan":"160000","status":"Lunas"}, "6":{"bulan":"Juni","tahun":"2012","tagihan":"150000","status":"Belum Lunas"}, "panjang":6 } with my android code like this : try { int length = jobj.getInt("panjang"); for(int n = 0; n < length; n++){ String m = Integer.toString(n) JSONObject row = jobj.getJSONObject(m); String bulan = row.getString("bulan"); String tahun = row.getString("tahun"); String tagihan = row.getString("tagihan"); String status = row.getString("status"); HashMap<String, String> map = new HashMap<String, String>(); map.put("bulan", bulan); map.put("tahun", tahun); map.put("tagihan", tagihan); map.put("status", status); list.add(map); } } catch (JSONException e) { e.printStackTrace(); } It always return nothing, but it works fine if I change the key m to specific key like if String m = "1"; and I can't use JSONObject row = jobj.getJSONObject(n); because getJSONObject() just accept string, not int. is there something wrong with my code?

    Read the article

  • split a string into a key => value array in php

    - by andy-score
    +2-1+18*+7-21+3*-4-5+6x29 The above string is an example of the kind of string I'm trying to split into either a key = value array or something similar. The numbers represent the id of a class and -,+ and x represent the state of the class (minimised, expanded or hidden), the * represents a column break. I can split this into the columns easily using explode which gives and array with 3 $key = $value associations. eg. $column_layout = array( [0] => '+2-1+18' , [1] => '+7-21+3' , [2] => '-4-5+6x29' ) I then need to split this into the various classes from there, keeping the status and id together. eg. $column1 = array( '+' => 2 , '-' => 1 , '+' => 18 ) ... or $column1 = array( array( '+' , 2 ) , array( '-' , 1 ) , array( '+' , 18 ) ) ... I can't quite get my head round this and what the best way to do it is, so any help would be much appreciated.

    Read the article

  • Sort Dictionary<> on value, lookup index from key

    - by paulio
    Hi, I have a Dictionary< which I want to sort based on value so I've done this by putting the dictionary into a List< then using the .Sort method. I've then added this back into a Dictionary<. Is it possible to lookup the new index/order by using the Dictionary key?? Dictionary<int, MyObject> toCompare = new Dictionary<int, MyObject>(); toCompare.Add(0, new MyObject()); toCompare.Add(1, new MyObject()); toCompare.Add(2, new MyObject()); Dictionary<int, MyObject> items = new Dictionary<int, MyObject>(); List<KeyValuePair<int, MyObject>> values = new List<KeyValuePair<int, MyObject>> (toCompare); // Sort. values.Sort(new MyComparer()); // Convert back into a dictionary. foreach(KeyValuePair<int, PropertyAppraisal> item in values) { // Add to collection. items.Add(item.Key, item.Value); } // THIS IS THE PART I CAN'T DO... int sortedIndex = items.GetItemIndexByKey(0);

    Read the article

  • Loop through Array with conditional output based on key/value pair

    - by Daniel C
    I have an array with the following columns: Task Status I would like to print out a table that shows a list of the Tasks, but not the Status column. Instead, for Tasks where the Status = 0, I want to add a tag <del> to make the completed task be crossed out. Here's my current code: foreach ($row as $key => $val){ if ($key != 'Status') print "<td>$val</td>"; else if ($val == '0') print "<td><del>$val</del></td>"; } This seems to be correct, but when I print it out, it prints all the tasks with the <del> tag. So basically the "else" clause is being run every time. Here is the var_dump($row): array 'Task' => string 'Task A' (length=6) 'Status' => string '3' (length=1) array 'Task' => string 'Task B' (length=6) 'Status' => string '0' (length=1)

    Read the article

  • SortList duplicated key, but it shouldn't

    - by Luca
    I have a class which implements IList interface. I requires a "sorted view" of this list, but without modifying it (I cannot sort directly the IList class). These view shall be updated when the original list is modified, keeping items sorted. So, I've introduced a SortList creation method which create a SortList which has a comparer for the specific object contained in the original list. Here is the snippet of code: public class MyList<T> : ICollection, IList<T> { ... public SortedList CreateSortView(string property) { try { Lock(); SortListView sortView; if (mSortListViews.ContainsKey(property) == false) { // Create sorted view sortView = new SortListView(property, Count); mSortListViews.Add(property, sortView); foreach (T item in Items) sortView.Add(item); } else sortView = mSortListViews[property]; sortView.ReferenceCount++; return (sortView); } finally { Unlock(); } } public void DeleteSortView(string property) { try { Lock(); // Unreference sorted view mSortListViews[property].ReferenceCount--; // Remove sorted view if (mSortListViews[property].ReferenceCount == 0) mSortListViews.Remove(property); } finally { Unlock(); } } protected class SortListView : SortedList { /// <summary> /// /// </summary> /// <param name="property"></param> /// <param name="capacity"></param> public SortListView(string property, int capacity) : base(new GenericPropertyComparer(typeof(T).GetProperty(property, BindingFlags.Instance | BindingFlags.Public)), capacity) { } /// <summary> /// Reference count. /// </summary> public int ReferenceCount = 0; /// <summary> /// /// </summary> /// <param name="item"></param> public void Add(T item) { Add(item, item); } /// <summary> /// /// </summary> /// <param name="item"></param> public void Remove(T item) { // Base implementation base.Remove(item); } /// <summary> /// Compare object on a generic property. /// </summary> class GenericPropertyComparer : IComparer { #region Constructors /// <summary> /// Construct a GenericPropertyComparer specifying the property to compare. /// </summary> /// <param name="property"> /// A <see cref="PropertyInfo"/> which specify the property to be compared. /// </param> /// <remarks> /// The <paramref name="property"/> parameter imply that the compared objects have the specified property. The property /// must be readable, and its type must implement the IComparable interface. /// </remarks> public GenericPropertyComparer(PropertyInfo property) { if (property == null) throw new ArgumentException("property doesn't specify a valid property"); if (property.CanRead == false) throw new ArgumentException("property specify a write-only property"); if (property.PropertyType.GetInterface("IComparable") == null) throw new ArgumentException("property type doesn't IComparable"); mSortingProperty = property; } #endregion #region IComparer Implementation public int Compare(object x, object y) { IComparable propX = (IComparable)mSortingProperty.GetValue(x, null); IComparable propY = (IComparable)mSortingProperty.GetValue(y, null); return (propX.CompareTo(propY)); } /// <summary> /// Sorting property. /// </summary> private PropertyInfo mSortingProperty = null; #endregion } } /// <summary> /// Sorted views of this ReactList. /// </summary> private Dictionary<string, SortListView> mSortListViews = new Dictionary<string, SortListView>(); } Practically, class users request to create a SortListView specifying the name of property which determine the sorting, and using the reflection each SortListView defined a IComparer which keep sorted the items. Whenever an item is added or removed from the original list, every created SortListView will be updated with the same operation. This seems good at first chance, but it creates me problems since it give me the following exception when adding items to the SortList: System.ArgumentException: Item has already been added. Key in dictionary: 'PowerShell_ISE [C:\Windows\sysWOW64\WindowsPowerShell\v1.0\PowerShell_ISE.exe]' Key being added: 'PowerShell_ISE [C:\Windows\system32\WindowsPowerShell\v1.0\PowerShell_ISE.exe]' As you can see from the exception message, thrown by SortedListView.Add(object), the string representation of the key (the list item object) is different (note the path of the executable). Why SortList give me that exception? To solve this I tried to implement a GetHashCode implementation for the underlying object, but without success: public override int GetHashCode() { return ( base.GetHashCode() ^ mApplicationName.GetHashCode() ^ mApplicationPath.GetHashCode() ^ mCommandLine.GetHashCode() ^ mWorkingDirectory.GetHashCode() ); }

    Read the article

< Previous Page | 78 79 80 81 82 83 84 85 86 87 88 89  | Next Page >