Search Results

Search found 21960 results on 879 pages for 'program termination'.

Page 830/879 | < Previous Page | 826 827 828 829 830 831 832 833 834 835 836 837  | Next Page >

  • Multiplying matrices: error: expected primary-expression before 'struct'

    - by justin
    I am trying to write a program that is supposed to multiply matrices using threads. I am supposed to fill the matrices using random numbers in a thread. I am compiling in g++ and using PTHREADS. I have also created a struct to pass the data from my command line input to the thread so it can generate the matrix of random numbers. The sizes of the two matrices are also passed in the command line as well. I keep getting: main.cpp:7: error: expected primary-expression before 'struct' my code @ line 7 =: struct a{ int Arow; int Acol; int low; int high; }; My inpust are : Sizes of two matrices ( 4 arguments) high and low ranges in which o generate the random numbers between. Complete code: [headers] using namespace std; void *matrixACreate(struct *); void *status; int main(int argc, char * argv[]) { int Arow = atoi(argv[1]); // Matrix A int Acol = atoi(argv[2]); // WxX int Brow = atoi(argv[3]); // Matrix B int Bcol = atoi(argv[4]); // XxZ, int low = atoi(argv[5]); // Range low int high = atoi(argv[6]); struct a{ int Arow; // Matrix A int Acol; // WxX int low; // Range low int high; }; pthread_t matrixAthread; //pthread_t matrixBthread; pthread_t runner; int error, retValue; if (Acol != Brow) { cout << " This matrix cannot be multiplied. FAIL" << endl; return 0; } error = pthread_create(&matrixAthread, NULL, matrixACreate, struct *a); //error = pthread_create(&matrixAthread, NULL, matrixBCreate, sendB); retValue = pthread_join(matrixAthread, &status); //retValue = pthread_join(matrixBthread, &status); return 0; } void matrixACreate(struct * a) { struct a *data = (struct a *) malloc(sizeof(struct a)); data->Arow = Arow; data->Acol = Acol; data->low = low; data->high = high; int range = ((high - low) + 1); cout << Arow << endl<< Acol << endl; }// just trying to print to see if I am in the thread

    Read the article

  • .NET AES returns wrong Test Vectors

    - by ralu
    I need to implement some crypto protocol on C# and want to say that this is my first project in C#. After spending some time to get used on C# I found out that I am unable to get compliant AES vectors. using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Security.Cryptography; using System.IO; namespace ConsoleApplication1 { class Program { public static void Main() { try { //test vectors from "ecb_vk.txt" byte[] key = { 0x80, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00 }; byte[] data = { 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00 }; byte[] encTest = { 0x0e, 0xdd, 0x33, 0xd3, 0xc6, 0x21, 0xe5, 0x46, 0x45, 0x5b, 0xd8, 0xba, 0x14, 0x18, 0xbe, 0xc8 }; AesManaged aesAlg = new AesManaged(); aesAlg.BlockSize = 128; aesAlg.Key = key; aesAlg.Mode = CipherMode.ECB; ICryptoTransform encryptor = aesAlg.CreateEncryptor(); MemoryStream msEncrypt = new MemoryStream(); CryptoStream csEncrypt = new CryptoStream(msEncrypt, encryptor, CryptoStreamMode.Write); StreamWriter swEncrypt = new StreamWriter(csEncrypt); swEncrypt.Write(data); swEncrypt.Close(); csEncrypt.Close(); msEncrypt.Close(); aesAlg.Clear(); byte[] encr; encr = msEncrypt.ToArray(); string datastr = BitConverter.ToString(data); string encrstr = BitConverter.ToString(encr); string encTestStr = BitConverter.ToString(encTest); Console.WriteLine("data: {0}", datastr); Console.WriteLine("encr: {0}", encrstr); Console.WriteLine("should: {0}", encTestStr); Console.ReadKey(); } catch (Exception e) { Console.WriteLine("Error: {0}", e.Message); } } } } Output is wrong: data: 00-00-00-00-00-00-00-00-00-00-00-00-00-00-00-00 encr: A0-3C-C2-22-A4-32-F7-C9-BA-36-AE-73-66-BD-BB-A3 should: 0E-DD-33-D3-C6-21-E5-46-45-5B-D8-BA-14-18-BE-C8 I am sure that there is a correct AES implementation in .NET, so I need some advice from a .NET wizard to help with this.

    Read the article

  • LINQ Except operator and object equality

    - by Abhijeet Patel
    Here is an interesting issue I noticed when using the Except Operator: I have list of users from which I want to exclude some users: The list of users is coming from an XML file: The code goes like this: interface IUser { int ID { get; set; } string Name { get; set; } } class User: IUser { #region IUser Members public int ID { get; set; } public string Name { get; set; } #endregion public override string ToString() { return ID + ":" +Name; } public static IEnumerable<IUser> GetMatchingUsers(IEnumerable<IUser> users) { IEnumerable<IUser> localList = new List<User> { new User{ ID=4, Name="James"}, new User{ ID=5, Name="Tom"} }.OfType<IUser>(); var matches = from u in users join lu in localList on u.ID equals lu.ID select u; return matches; } } class Program { static void Main(string[] args) { XDocument doc = XDocument.Load("Users.xml"); IEnumerable<IUser> users = doc.Element("Users").Elements("User").Select (u => new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType<IUser>(); //still a query, objects have not been materialized var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes should contain 6 users but here it contains 8 users } } When I call User.GetMatchingUsers(users) I get 2 matches as expected. The issue is that when I call users.Except(matches) The matching users are not being excluded at all! I am expecting 6 users ut "excludes" contains all 8 users instead. Since all I'm doing in GetMatchingUsers(IEnumerable users) is taking the IEnumerable and just returning the IUsers whose ID's match( 2 IUsers in this case), my understanding is that by default "Except" will use reference equality for comparing the objects to be excluded. Is this not how "Except" behaves? What is even more interesting is that if I materialize the objects using .ToList() and then get the matching users, and call "Except", everything works as expected! Like so: IEnumerable users = doc.Element("Users").Elements("User").Select (u = new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType().ToList(); //explicity materializing all objects by calling ToList() var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes now contains 6 users as expected I don't see why I should need to materialize objects for calling "Except" given that its defined on IEnumerable? Any suggesstions / insights would be much appreciated.

    Read the article

  • Can sorting Japanese kanji words be done programatically?

    - by Mason
    I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

    Read the article

  • Need a fast programming language that can drive two printers

    - by Pete
    I have a rather unusual application that isn't working the way I need, and I hope someone here will have some suggestions or at least a direction to investigate. We have a museum exhibit that has a computer at the entrance driving two small receipt printers. There are two buttons on a console, wired to the left and right buttons of a disemboweled mouse. The two printers and associated buttons are for girls and boys, each button does a random selection from a database of names and prints a small ticket on the appropriate printer with a graphic image, a few words about the exhibit and the randomly chosen name. Conceptually all is well, but it hangs quite often. I got the project at the last minute, because the original designer got bogged down and couldn't deliver, so the exhibit's author asked me the day before opening, whether I could write something that would work. I did it in Word, since I am an experienced VBA programmer. Several other avenues I attempted first all lead to dead ends - one couldn't do graphics, another couldn't handle two printers, yet another couldn't change fonts and so on. The problem is that it simply isn't fast enough - Word can only drive one printer at a time and changing the active printer takes a long time. Not by office standards, where a second or two of delay before a printer starts working on your document is not an issue, but here I need more or less instant response. If kids press a button and nothing happens, they press it over and over until something does happen, resulting in maybe half a dozen commands being sent before the printer starts reacting. Sometimes it jams the program completely, since boys and girls will be pressing the two buttons simultaneously and Word locks up, and even when it doesn't jam, the printers then spit out a stream of tickets, making a mess. The kids start squabbling over which ticket is whose, pulling them out of the printers, snarling the paper tape, jamming the printer and generally making a mess of the whole affair, often necessitating the exhibit caretakers having to restart the computer and clear torn bits of paper out the printers. What I need is some sort of fast programming language that can drive two printers *-simultaneously-*, not the MSOffice claptrap of having to switch the active printer, that can react to both left and right mouse button click events, can print a small graphic image and can print in different font sizes and styles and. I don't need many, but it's not all in one typeface. Can anyone suggest what I might use for this? I don't even know if it's possible at all under Windows, whether the "single active printer" garbage is an Office artifact, or a Windows restriction. My little Commodore-64 twenty-five years ago had two printers attached to it and drove both simultaneously with no difficulties - it doesn't seem to me it should be such an impossible requirement today.

    Read the article

  • Change the size of the panel dynamically

    - by C. Karunarathne
    Hi! I am implementing an application that needs to drag and drop image boxes in a panel.Image boxes are added dynamically from the program and so I have set the autoscroll property to true in panel.But when I have drag out the boxes at bottom in the panel the panel size got reduced.I have put autosize property false in panel.The panel is docked in another panel.I want to set the size of panel at run time.How can I achieve this. public form1(int[,] dummy, int columnSize, int rowSize) { this.dummy= dummy; numOfColumns = columnSize; numOfRows = rowSize; getData(); addIds = addIdArray; data = mylist; InitializeComponent(); //panel1.MinimumSize = new Size(columnSize * 40, rowSize * 40); //panel1.Height = rowSize * 40; //panel1.Width = columnSize * 40; //panel4.Height = rowSize * 40; //panel4.Width = columnSize * 40; int x, y; Structures.EmptyRectSpace space = new Structures.EmptyRectSpace(); for (int i = 0; i < data.Count; i++)// set picture boxes { space = (Structures.EmptyRectSpace)data[i]; x = space.startingJ; y = space.startingI; int h, w; h = space.length; w = space.width; p = new PictureBox(); p.Width = w * 40; p.Height = h * 40; p.BackColor = Color.DarkGreen; p.Image = Properties.Resources.v; p.BorderStyle = BorderStyle.FixedSingle; p.Name = addIdArray[i].ToString(); p.Location = new Point((x + 1 - w) * 40, (y + 1 - h) * 40); this.panel1.Controls.Add(p); } foreach (Control c in this.panel1.Controls) { if (c is PictureBox) { c.MouseDown += new MouseEventHandler(pictureBox1_MouseDown); } } this.panel1.DragOver += new System.Windows.Forms.DragEventHandler(this.panel1_DragOver); panel1.DragOver += new DragEventHandler(panel1_DragOver); panel1.DragDrop += new DragEventHandler(panel1_DragDrop); panel1.AllowDrop = true; panel2.AllowDrop = true; foreach (Control c in this.panel2.Controls) { c.MouseDown += new MouseEventHandler(pictureBox1_MouseDown); } this.panel2.DragOver += new System.Windows.Forms.DragEventHandler(this.panel2_DragOver); panel2.DragOver += new DragEventHandler(panel2_DragOver); panel2.DragDrop += new DragEventHandler(panel2_DragDrop); } This is the constructor of the form that contained panel.When it loaded the picture boxes must be added to the panel and there drag drop events of panel are implemented. Please give me a helping hand..

    Read the article

  • GLKit Memory Leak copywithZone

    - by TommyT39
    Running the instruments utility against the game I'm writing shows a bunch of memory leaks related to copy with Zone when I cycle through an array and draw some simple cube objects. Im not sure the best way to track this down as I'm new to OpenGL programming. My program is using ARC and is set to build for IOS 5. I am initializing GLKit to use OPenGl 2.0 and using the BafeEffect so I don't have to write my own shaders etc.. This shouldn't be rocket science. Im guessing that I must be not releasing something within the draw function. Below is the code to my draw function. Could you guys take a look and see if anything stands out as the problem? One other thing to note is that I'm using 15 different textures, the cubes can be 1 of 15 different ones. I have a property set on the cube class for the texture and I set it as I create the cube in there array. But I do load all 15 when my programs view did load starts.They are small .jps files that are less than 75k each and each cube uses the same texture all the way around so shouldn't be too big of an issue. Here is the code to my draw function: - (void)draw { GLKMatrix4 xRotationMatrix = GLKMatrix4MakeXRotation(rotation.x); GLKMatrix4 yRotationMatrix = GLKMatrix4MakeYRotation(rotation.y); GLKMatrix4 zRotationMatrix = GLKMatrix4MakeZRotation(rotation.z); GLKMatrix4 scaleMatrix = GLKMatrix4MakeScale(scale.x, scale.y, scale.z); GLKMatrix4 translateMatrix = GLKMatrix4MakeTranslation(position.x, position.y, position.z); GLKMatrix4 modelMatrix = GLKMatrix4Multiply(translateMatrix,GLKMatrix4Multiply(scaleMatrix,GLKMatrix4Multiply(zRotationMatrix, GLKMatrix4Multiply(yRotationMatrix, xRotationMatrix)))); GLKMatrix4 viewMatrix = GLKMatrix4MakeLookAt(0, 0, 1, 0, 0, -5, 0, 1, 0); effect.transform.modelviewMatrix = GLKMatrix4Multiply(viewMatrix, modelMatrix); effect.transform.projectionMatrix = GLKMatrix4MakePerspective(0.125*M_TAU, 1.0, 2, 0); effect.texture2d0.name = wallTexture.name; [effect prepareToDraw]; glEnable(GL_DEPTH_TEST); glEnable(GL_CULL_FACE); glEnableVertexAttribArray(GLKVertexAttribPosition); glVertexAttribPointer(GLKVertexAttribPosition, 3, GL_FLOAT, GL_FALSE, 0, triangleVertices); glEnableVertexAttribArray(GLKVertexAttribTexCoord0); glVertexAttribPointer(GLKVertexAttribTexCoord0, 2, GL_FLOAT, GL_FALSE, 0, textureCoordinates); glDrawArrays(GL_TRIANGLES, 0, 18); glDisableVertexAttribArray(GLKVertexAttribPosition); glDisableVertexAttribArray(GLKVertexAttribTexCoord0); }

    Read the article

  • Remote Postgresql - extremely slow

    - by Muffinbubble
    Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

    Read the article

  • Looking for an Open Source Project in need of help

    - by hvidgaard
    Hi StackOverflow! I'm a CS student on well on my way to graduate. I have had a difficult time of finding relevant student jobs (they seems to be taken merely hours after the notice gets on the board) , so instead I'm looking for an open source project in need of help. I'm aware that I should choose one that I use, but I'm not aware of any OS-project that I use that needs help. That's why I'm asking you. I don't have any deep experience, but I here are some of my biggest projects so far: BitTorrent-ish client in Python (a subset of BitTorrent) HTTP 1.1 webserver in Java Compiler from a subset of Java to run on JRE Flash-framework project to model an iPad look and feel (not to run actual iPad programs) complete with an API for programs. Complete MySQL database for a booking system, with departure and arrival times, so you could only book valid tickets (with a Java frontend). I know, Java and languages like AS3 and C# feels natural per se, Python, and have done a fair bit of hacking around in C, but I don't feel very comfortable with it. Mostly I'm afraid to make a fuckup because I have such a high degree of control. I would like to think I'm well aware of good software design practices, but in reality what I do is ask myself "would I like to use/maintain this?", and I love to refactor my code because I see optimizations. I love algorithms and to make them run in the best possible time. I don't have any preferred domain to work in, but I wouldn't mind it to be graphics or math heavy. Ideally I'm looking for a project in C++ to learn the in's and out's of it, but I'm well aware that I don't know that language very well. I would like to have a mentor-like figure until I'm confident enough to stand on my own, not one to review all my code (I'm sure someone will to start with anyway), but to ask questions about the project and language in question. I do have a wife and two children, so don't expect me to put in 10+ hours every week. In return I can work on my own, I strive to program modular and maintainable code. Know how to read an API, use Google, StackOverflow and online resources in general. If you have any questions, shoot. I'm looking forward to your suggestions.

    Read the article

  • Import? Initialize? what do to?

    - by Jeremy B
    I'm working on homework and I'm close but I am having an issue. I just learned how to work with packages in eclipse so I have a class that is importing another class from a package (I think I said that right) The main prompts the user to enter an integer between -100 and 100 and I am having an issue with validating it. I know the issue is where I'm importing I'm just unsure the direction I need to go to fix it. This is a section of my main code. (my issue starts with the last couple lines if you want to skip ahead) import myUtils.util.Console; public class ConsoleTestApp { public static void main(String args[]) { // create the Console object Console c = new Console(); // display a welcome message c.println("Welcome to the Console Tester application"); c.println(); // int c.println("Int Test"); int i = c.getIntWithinRange("Enter an integer between -100 and 100: ", -101, 101); c.println(); I have a class called Console that is located in another package that I believe I have properly imported. here is the code I am stuck on in my console class. public int getIntWithinRange(String prompt, int min, int max) { int i = 0; boolean isValid = false; while (isValid == false) { System.out.println(prompt); if (sc.hasNextInt()) { //if user chooses menu option less than 1 the program will print an error message i = sc.nextInt(); if (i < min) { System.out.println("Error! Please enter an int greater than -100"); } else if (i > max) { System.out.println("Error! Please enter an int less than 100"); } else isValid = true; } else System.out.println("Error! Invalid number value"); sc.nextLine(); } // return the int return i; } when I run this I keep getting my last print which is an invalid number value. am I not importing the code from the main method in the other console properly?

    Read the article

  • Specializating a template function that takes a universal reference parameter

    - by David Stone
    How do I specialize a template function that takes a universal reference parameter? foo.hpp: template<typename T> void foo(T && t) // universal reference parameter foo.cpp template<> void foo<Class>(Class && class) { // do something complicated } Here, Class is no longer a deduced type and thus is Class exactly; it cannot possibly be Class &, so reference collapsing rules will not help me here. I could perhaps create another specialization that takes a Class & parameter (I'm not sure), but that implies duplicating all of the code contained within foo for every possible combination of rvalue / lvalue references for all parameters, which is what universal references are supposed to avoid. Is there some way to accomplish this? To be more specific about my problem in case there is a better way to solve it: I have a program that can connect to multiple game servers, and each server, for the most part, calls everything by the same name. However, they have slightly different versions for a few things. There are a few different categories that these things can be: a move, an item, etc. I have written a generic sort of "move string to move enum" set of functions for internal code to call, and my server interface code has similar functions. However, some servers have their own internal ID that they communicate with, some use strings, and some use both in different situations. Now what I want to do is make this a little more generic. I want to be able to call something like ServerNamespace::server_cast<Destination>(source). This would allow me to cast from a Move to a std::string or ServerMoveID. Internally, I may need to make a copy (or move from) because some servers require that I keep a history of messages sent. Universal references seem to be the obvious solution to this problem. The header file I'm thinking of right now would expose simply this: namespace ServerNamespace { template<typename Destination, typename Source> Destination server_cast(Source && source); } And the implementation file would define all legal conversions as template specializations.

    Read the article

  • ASP.NET MVC: How can I explain an invalid type violation to an end-user with Html.ValidationSummary?

    - by Terminal Frost
    Serious n00b warning here; please take mercy! So I finished the Nerd Dinner MVC Tutorial and I'm now in the process of converting a VB.NET application to ASP.NET MVC using the Nerd Dinner program as a sort of rough template. I am using the "IsValid / GetRuleViolations()" pattern to identify invalid user input or values that violate business rules. I am using LINQ to SQL and am taking advantage of the "OnValidate()" hook that allows me to run the validation and throw an application exception upon trying to save changes to the database via the CustomerRepository class. Anyway, everything works well, except that by the time the form values reach my validation method invalid types have already been converted to a default or existing value. (I have a "StreetNumber" property that is an integer, though I imagine this would be a problem for DateTime or any other non-strings as well.) Now, I am guessing that the UpdateModel() method throws an exception and then alters the value because the Html.ValidationMessage is displayed next to the StreetNumber field but my validation method never sees the original input. There are two problems with this: While the Html.ValidationMessage does signal that something is wrong, there is no corresponding entry in the Html.ValidationSummary. If I could even get the exception message to show up there indicating an invalid cast or something that would be better than nothing. My validation method which resides in my Customer partial class never sees the original user input so I do not know if the problem is a missing entry or an invalid type. I can't figure out how I can keep my validation logic nice and neat in one place and still get access to the form values. I could of course write some logic in the View that processes the user input, however that seems like the exact opposite of what I should be doing with MVC. Do I need a new validation pattern or is there some way to pass the original form values to my model class for processing? CustomerController Code // POST: /Customers/Edit/[id] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Edit(int id, FormCollection formValues) { Customer customer = customerRepository.GetCustomer(id); try { UpdateModel(customer); customerRepository.Save(); return RedirectToAction("Details", new { id = customer.AccountID }); } catch { foreach (var issue in customer.GetRuleViolations()) ModelState.AddModelError(issue.PropertyName, issue.ErrorMessage); } return View(customer); }

    Read the article

  • sending email in .NET

    - by VP
    I am getting the following error when I try to send an email in my C# program. I am using Visual Studio 2008 on windows 7. I would paste my code first and then the error: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.IO; using System.Net; using System.Net.Mail; using System.Net.Mime; using System.Net.Sockets; using System.Web; class email_log_files { private string login_username = "my_gmail_id"; private string login_password = "my_gmail_password"; public void send_email() { string src_address = "[email protected]"; string dest_address = "[email protected]"; try { MailMessage email_msg = new MailMessage(); SmtpClient email_client = new SmtpClient(); email_msg.From = new MailAddress(src_address); email_msg.Sender = new MailAddress(src_address); email_msg.ReplyTo = new MailAddress(src_address); email_msg.To.Add(dest_address); email_msg.Subject = "Test"; email_msg.Body = "Body of the message"; NetworkCredential credentials = new NetworkCredential(login_username, login_password); email_client.Credentials = credentials; email_client.Host = "smtp.gmail.com"; email_client.Port = 465; email_client.EnableSsl = true; email_client.Send(email_msg); Console.WriteLine("Message Sent Successfully!!"); Console.ReadLine(); } catch (Exception ex) { Console.WriteLine(ex.Message.ToString()); Console.WriteLine(ex.InnerException); Console.WriteLine(ex.Source); Console.WriteLine(ex.Data); Console.ReadLine(); } } } And the error message is as follows: The operation has timed out. System System.Collections.ListDictionaryInternal Why is it always timing out? I am sure that I have the correct smtp server address and port number for gmail as I have configured my outlook with the same. Any help or ideas?

    Read the article

  • Web SITE publishing, dynamic compilation, smoke & mirrors

    - by tbehunin
    When you publish a web SITE in Visual Studio, in the dialog box that follows, you are given an option to "Allow this precompiled site to be updatable". According to MSDN, checking this option "specifies that all program code is compiled into assemblies, but that .aspx files (including single-file ASP.NET Web pages) are copied as-is to the target folder". With this option checked, you can update existing .aspx files as well as add new ones without any issue. When a page, that has either been updated or newly created, is requested, the page gets dynamically compiled at run-time and is then processed and returned to the user. If, on the other hand, you didn't check that checkbox during the publish phase, the .aspx files get compiled, along with the code-behind and App_Code files in separate assemblies. The .aspx files are then completely overwritten with a line of text that says: This is a marker file generated by the precompilation tool, and should not be deleted! You obviously can't edit an existing page in this scenario. If you were to ADD a new .aspx file to this site, you would get a .Net run-time error saying that the file hasn't been precompiled. With that background, my questions are these: Something must be able to determine that this website was published to be updatable (allow dynamic compilation) or not. If it was published as updatable, it must also be able to determine whether a file was changed or added, so it can do a dynamic compile. Who makes those determinations? IIS? ASP.NET worker process? HOW does it make those determinations? If I had the same website published in both of those scenarios, could I make a visual determination that one is updatable and the other is not? Is there some bit I can look at in the assemblies using Reflector to make that determination myself? In addition to answering those questions, what also might be helpful would be information on the process flow from when a resource is requested to when it starts being processed, not necessarily the ASP.NET Page Lifecycle, but what happens BEFORE ASP.Net worker process starts processing the page and firing off events. The dynamic compilation appears to be smoke and mirrors. Can someone demystify this for me?

    Read the article

  • How to get a physics engine like Nape working?

    - by Glacius
    Introduction: I think Nape is a relatively new engine so some of you may not know it. It's supposedly faster than box2d and I like that there is decent documentation. Here's the site: http://code.google.com/p/nape/ I'm relatively new to programming. I am decent at AS3's basic functionality, but every time I try to implement some kind of engine or framework I can't even seem to get it to work. With Nape I feel I got a little further than before but I still got stuck. My problem: I'm using Adobe CS5, I managed to import the SWC file like described here. Next I tried to copy the source of one of the demo's like this one and get it to work but I keep getting errors. I made a new class file, copied the demo source to it, and tried to add it to the stage. My stage code basically looks like this: import flash.Boot; // these 2 lines are as described in the tutorial new Boot(); var demo = new Main(); // these 2 are me guessing what I'm supposed to do addChild(demo); Well, it seems the source code is not even being recognized by flash as a valid class file. I tried editing it, but even if I get it recognized (give a package name and add curly brackets) but I still get a bunch of errors. Is it psuedo code or something? What is going on? My goal: I can imagine I'm going about this the wrong way. So let me explain what I'm trying to achieve. I basically want to learn how to use the engine by starting from a simple basic example that I can edit and mess around with. If I can't even get a working example then I'm unable to learn anything. Preferably I don't want to start using something like FlashDevelop (as I'd have to learn how to use the program) but if it can't be helped then I can give it a try. Thank you.

    Read the article

  • How to handle environment-specific application configuration organization-wide?

    - by Stuart Lange
    Problem Your organization has many separate applications, some of which interact with each other (to form "systems"). You need to deploy these applications to separate environments to facilitate staged testing (for example, DEV, QA, UAT, PROD). A given application needs to be configured slightly differently in each environment (each environment has a separate database, for example). You want this re-configuration to be handled by some sort of automated mechanism so that your release managers don't have to manually configure each application every time it is deployed to a different environment. Desired Features I would like to design an organization-wide configuration solution with the following properties (ideally): Supports "one click" deployments (only the environment needs to be specified, and no manual re-configuration during/after deployment should be necessary). There should be a single "system of record" where a shared environment-dependent property is specified (such as a database connection string that is shared by many applications). Supports re-configuration of deployed applications (in the event that an environment-specific property needs to change), ideally without requiring a re-deployment of the application. Allows an application to be run on the same machine, but in different environments (run a PROD instance and a DEV instance simultaneously). Possible Solutions I see two basic directions in which a solution could go: Make all applications "environment aware". You would pass the environment name (DEV, QA, etc) at the command line to the app, and then the app is "smart" enough to figure out the environment-specific configuration values at run-time. The app could fetch the values from flat files deployed along with the app, or from a central configuration service. Applications are not "smart" as they are in #1, and simply fetch configuration by property name from config files deployed with the app. The values of these properties are injected into the config files at deploy-time by the install program/script. That install script takes the environment name and fetches all relevant configuration values from a central configuration service. Question How would/have you achieved a configuration solution that solves these problems and supports these desired features? Am I on target with the two possible solutions? Do you have a preference between those solutions? Also, please feel free to tell me that I'm thinking about the problem all wrong. Any feedback would be greatly appreciated.

    Read the article

  • C++ addition overload ambiguity

    - by Nate
    I am coming up against a vexing conundrum in my code base. I can't quite tell why my code generates this error, but (for example) std::string does not. class String { public: String(const char*str); friend String operator+ ( const String& lval, const char *rval ); friend String operator+ ( const char *lval, const String& rval ); String operator+ ( const String& rval ); }; The implementation of these is easy enough to imagine on your own. My driver program contains the following: String result, lval("left side "), rval("of string"); char lv[] = "right side ", rv[] = "of string"; result = lv + rval; printf(result); result = (lval + rv); printf(result); Which generates the following error in gcc 4.1.2: driver.cpp:25: error: ISO C++ says that these are ambiguous, even though the worst conversion for the first is better than the worst conversion for the second: String.h:22: note: candidate 1: String operator+(const String&, const char*) String.h:24: note: candidate 2: String String::operator+(const String&) So far so good, right? Sadly, my String(const char *str) constructor is so handy to have as an implicit constructor, that using the explicit keyword to solve this would just cause a different pile of problems. Moreover... std::string doesn't have to resort to this, and I can't figure out why. For example, in basic_string.h, they are declared as follows: template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT, _Traits, _Alloc> operator+(const basic_string<_CharT, _Traits, _Alloc>& __lhs, const basic_string<_CharT, _Traits, _Alloc>& __rhs) template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT,_Traits,_Alloc> operator+(const _CharT* __lhs, const basic_string<_CharT,_Traits,_Alloc>& __rhs); and so on. The basic_string constructor is not declared explicit. How does this not cause the same error I'm getting, and how can I achieve the same behavior??

    Read the article

  • StringBuffer wont read whole stream into a string (JAVA/Android)

    - by Levara
    Hi all! I'm making an android program that retrieves content of a webpage using HttpURLConnection. I'm new to both Java and Android. Problem is: Reader reads whole page source, but in the last while iteration it doesn't append to stringBuffer that last part. Using debbuger I have determined that, in the last loop iteration, string buff is created, but stringBuffer just doesnt append it. I need to parse retrieved content. Is there any better way to handle the content for parsing than using strings. I've read on numerous other sites that string size in Java is limited only by available heap size. I've tried with StringBuilder too. Anyone know what could be the problem. Btw feel free to suggest any improvements to the code. Thanks! URL u; try { u = new URL("http://feeds.timesonline.co.uk/c/32313/f/440134/index.rss"); HttpURLConnection c = (HttpURLConnection) u.openConnection(); c.setRequestProperty("User-agent","Mozilla/4.0 (compatible; MSIE 6.0; Windows NT 5.1; SV1; .NET CLR 1.1.4322; InfoPath.1; .NET CLR 2.0.50727)"); c.setRequestMethod("GET"); c.setDoOutput(true); c.setReadTimeout(3000); c.connect(); StringBuffer stringBuffer = new StringBuffer(""); InputStream in = c.getInputStream(); InputStreamReader inp = new InputStreamReader(in); BufferedReader reader = new BufferedReader(inp); char[] buffer = new char[3072]; int len1 = 0; while ( (len1 = reader.read(buffer)) != -1 ) { String buff = new String(buffer,0,len1); stringBuffer.append(buff); } String stranica = new String(stringBuffer); c.disconnect(); reader.close(); inp.close(); in.close();

    Read the article

  • Using events in threads between processes - C

    - by Jamie Keeling
    Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occurred and I have started to implement this already. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. Following is a small snippet of what I have so far in the producer application; Create thread: case IDM_FILE_ROLLDICE: { hDiceRoll = CreateThread( NULL, // lpThreadAttributes (default) 0, // dwStackSize (default) ThreadFunc(hMainWindow), // lpStartAddress NULL, // lpParameter 0, // dwCreationFlags &hDiceID // lpThreadId (returned by function) ); } break; The data being sent to the other process: DWORD WINAPI ThreadFunc(LPVOID passedHandle) { HANDLE hMainHandle = *((HANDLE*)passedHandle); WCHAR buffer[256]; LPCTSTR pBuf; LPVOID lpMsgBuf; LPVOID lpDisplayBuf; struct diceData storage; HANDLE hMapFile; DWORD dw; //Roll dice and store results in variable storage = RollDice(); hMapFile = CreateFileMapping( (HANDLE)0xFFFFFFFF, // use paging file NULL, // default security PAGE_READWRITE, // read/write access 0, // maximum object size (high-order DWORD) BUF_SIZE, // maximum object size (low-order DWORD) szName); // name of mapping object if (hMapFile == NULL) { dw = GetLastError(); MessageBox(hMainHandle,L"Could not create file mapping object",L"Error",MB_OK); return 1; } pBuf = (LPTSTR) MapViewOfFile(hMapFile, // handle to map object FILE_MAP_ALL_ACCESS, // read/write permission 0, 0, BUF_SIZE); if (pBuf == NULL) { MessageBox(hMainHandle,L"Could not map view of file",L"Error",MB_OK); CloseHandle(hMapFile); return 1; } CopyMemory((PVOID)pBuf, &storage, (_tcslen(szMsg) * sizeof(TCHAR))); //_getch(); MessageBox(hMainHandle,L"Completed!",L"Success",MB_OK); UnmapViewOfFile(pBuf); return 0; } I'm trying to find out how I would integrate an event with the threaded code to signify to the other process that something has happened, I've seen an MSDN article on using events but it's just confused me if anything, I'm coming up on empty whilst searching on the internet too. Thanks for any help Edit: I can only use the Create/Set/Open methods for events, sorry for not mentioning it earlier.

    Read the article

  • Hide/Show problems on a questionerre application

    - by T. Todd
    I am doing an assignment involving the creation of a simple Quiz type form application. However, whenever I run the program, only the first answer shows for a multiple question and I cannot for the life of me figure out why. This is the contstructor: MultipleChoice dlg = new MultipleChoice( new Question("What is the capital of Zimbabwe?", new Answer("Paris", false), new Answer("Washington D.C.", false), new Answer("Harare", true), new Answer("Cairo", false), new Answer("N'Djamena", false))); if (dlg.ShowDialog() == DialogResult.OK) { if (dlg.Correct) MessageBox.Show("You got something right!"); else MessageBox.Show("You couldn't be more wrong"); } And this is the Question Form Code: private Question Q; public MultipleChoice (Question q) { Q = q; InitializeComponent(); textPrompt.Text = Q.Prompt; if (Q.A != null) { radioA.Text = Q.A.Prompt; } else radioA.Hide(); if (Q.B != null) { radioB.Text = Q.B.Prompt; } radioB.Hide(); if (Q.C != null) { radioC.Text = Q.C.Prompt; } radioC.Hide(); if (Q.D != null) { radioD.Text = Q.D.Prompt; } radioD.Hide(); if (Q.E != null) { radioE.Text = Q.E.Prompt; } radioE.Hide(); } public bool Correct { get { if (Q == null) return false; if (Q.A != null && Q.A.Correct && radioA.Checked) return true; if (Q.B != null && Q.B.Correct && radioB.Checked) return true; if (Q.C != null && Q.C.Correct && radioC.Checked) return true; if (Q.D != null && Q.D.Correct && radioD.Checked) return true; if (Q.E != null && Q.E.Correct && radioE.Checked) return true; return false; } Where have I gone wrong? Thank you, Travis

    Read the article

  • HTTP Post requests using HttpClient take 2 seconds, why?

    - by pableu
    Update: You might better hold off this for a bit, I just noticed I could be my fault after all. Working on this all afternoon, and then I find a flaw ten minutes after posting here, ts. Hi, I'am currently coding an android app that submits stuff in the background using HTTP Post and AsyncTask. I use the org.apache.http.client Package for this. I based my code on this example. Basically, my code looks like this: public void postData() { // Create a new HttpClient and Post Header HttpClient httpclient = new DefaultHttpClient(); HttpPost httppost = new HttpPost("http://192.168.1.137:8880/form"); try { List<NameValuePair> nameValuePairs = new ArrayList<NameValuePair>(2); nameValuePairs.add(new BasicNameValuePair("id", "12345")); nameValuePairs.add(new BasicNameValuePair("stringdata", "AndDev is Cool!")); httppost.setEntity(new UrlEncodedFormEntity(nameValuePairs)); // Execute HTTP Post Request HttpResponse response = httpclient.execute(httppost); } catch (ClientProtocolException e) { Log.e(TAG,e.toString()); } catch (IOException e) { Log.e(TAG,e.toString()); } } The problem is that the httpclient.execute(..) line takes around 1.5 to 3 seconds, and I do not understand why. Just requesting a page with HTTP Get takes around 80 ms or so, so the problem doesn't seem to be the network latency itself. The problem doesn't seem to be on the server side either, I have also tried POSTing data to http://www.disney.com/ with similarly slow results. And Firebug shows 1 ms response time when POSTing data to my server locally. This happens on the Emulator and with my Nexus One (both with Android 2.2). If you want to look at the complete code, I've put it on GitHub. It's just a dummy program to do HTTP Post in the background using AsyncTask on the push of a button. It's my first Android app, and my first java code for a long time. And incidentially, also my first question on Stackoverflow ;-) Any ideas why httpclient.execute(httppost) takes so long?

    Read the article

  • Execute a jar file using Ant

    - by geetha
    I am trying to create a runnable jar file from java classes using ant. The java classes use external jars. When I execute the build.xml its showing class not found exception while running the java program. Its compiling fine. Part of My source code: <path id="project-libpath"> <fileset dir="${lib.dir}"> <include name="*.jar"/> </fileset> </path> <path id="project-classpath"> <fileset dir="C:/xmldecode/lib"> <include name="*.jar"/> </fileset> </path> <target name="compile" depends="prepare"> <javac srcdir="${src.dir}" destdir="${classes.dir}"> <classpath refid="project-classpath"/> </javac> </target> <target name="jar" depends="compile"> <copy todir="${classes.dir}"> <fileset dir="C:/xmldecode/lib"/> </copy> <pathconvert property="mf.classpath" pathsep=";"> <path refid="project-classpath" /> <flattenmapper /> </pathconvert> <jar destfile="${jar.dir}/${ant.project.name}.jar" basedir="${classes.dir}"> <manifest> <attribute name="Main-Class" value="${main-class}"/> <attribute name="Class-Path" value="${mf.classpath}"/> </manifest> </jar> </target> <target name="run" depends="jar"> <java jar="${jar.dir}/${ant.project.name}.jar" fork="true"> </java>

    Read the article

  • JButton Image Ignoring GridBagConstraints

    - by daemor
    I am working on an application and have a screen that needs to have elements (namely some custom JButtons) appear and disappear based on a user selection. However for some reason, when I add these buttons to their pane, the buttton image goes to the top corner, and leaves the text in the center, completely ignoring GridBagConstraints. I am completely stumped on this one as I have done this same exact thing dozens of times earlier in the program without any issues. Here is an image of the problem: The problem is in this method here, and occurs down towards the bottom. public void init(){ contentPane.removeAll(); // Setup jlabels JLabel countyLabel = new JLabel("County"); countyLabel.setFont(new Font("Times New Roman", Font.PLAIN, 18)); JLabel measureByLabel = new JLabel("Measure By: "); measureByLabel.setFont(new Font("Times New Roman", Font.PLAIN, 18)); String[] countyChoices = {"Washtenaw", "Oakland", "Livingston"}; // setup components JComboBox<String> countyCombo = new JComboBox<String>(countyChoices); // place baseComponents c.weightx = 0.5; c.weighty = 0.5; c.gridx = 0; c.gridy = 0; c.anchor = GridBagConstraints.NORTH; contentPane.add(countyLabel, c); c.gridx = 2; contentPane.add(countyCombo, c); c.gridy = 1; c.gridx = 0; contentPane.add(trenchButton, c); c.gridx = 2; contentPane.add(bedButton, c); c.gridy = 2; c.gridx = 1; contentPane.add(systemSelection, c); c.gridy = 3; c.gridx = 0; contentPane.add(lengthButton, c); c.fill = GridBagConstraints.BOTH; c.gridwidth = 4; c.gridy = 4; c.gridx = 0; contentPane.add(choicePane, c); GridBagConstraints con = new GridBagConstraints(); con.weightx = 0.5; con.weighty = 0.5; con.gridx = 0; con.gridy = 0; choicePane.add(lengthButton, c); // revalidate and repaint choicePane.revalidate(); choicePane.repaint(); contentPane.revalidate(); contentPane.repaint(); } I have tried doing this in separate methods, the button looks fine when added to the contentPane, the pane is for sure set to gridbagconstraints as I used the expression JPanel choicePane = new JPanel(new GridBagLayout()) to initialize it.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • vb6 ADODB TSQL procedure call quit working after database migration

    - by phill
    This code was once working on sql server 2005. Now isolated in a visual basic 6 sub routine using ADODB to connect to a sql server 2008 database it throws an error saying: "Login failed for user 'admin' " I have since verified the connection string does work if i replace the body of this sub with the alternative code below this sub. When I run the small program with the button, it stops where it is marked below the asterisk line. Any ideas? thanks in advance. Private Sub Command1_Click() Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset Dim dStartDateIn As Date dStartDateIn = "2010/05/01" cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" 'On Error GoTo GetUnconvertedInvoices_Err With cmdGetInvoices .CommandType = adCmdStoredProc .CommandText = "_sp_cwm5_GetUnCvtdInv" .Name = "_sp_cwm5_GetUnCvtdInv" Set oParm1 = .CreateParameter("@StartDate", adDate, adParamInput) .Parameters.Append oParm1 oParm1.Value = dStartDateIn .ActiveConnection = cSQLConn End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic .CursorType = adOpenKeyset '.CursorType = adOpenStatic .CacheSize = 5000 '***************************Debug stops here .Open cmdGetInvoices End With If myRs.State = adStateOpen Then Set GetUnconvertedInvoices = myRs Else Set GetUnconvertedInvoices = Nothing End If End Sub Here is the code which validates the connection string is working. Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" With cmdGetInvoices .ActiveConnection = cSQLConn .CommandText = "SELECT top 5 * FROM tarInvoice;" .CommandType = adCmdText End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic '.CursorType = adOpenKeyset .CursorType = adOpenStatic '.CacheSize = 5000 .Open cmdGetInvoices End With If myRs.EOF = False Then myRs.MoveFirst Do MsgBox "Record " & myRs.AbsolutePosition & " " & _ myRs.Fields(0).Name & "=" & myRs.Fields(0) & " " & _ myRs.Fields(1).Name & "=" & myRs.Fields(1) myRs.MoveNext Loop Until myRs.EOF = True End If

    Read the article

< Previous Page | 826 827 828 829 830 831 832 833 834 835 836 837  | Next Page >