Search Results

Search found 21960 results on 879 pages for 'program termination'.

Page 831/879 | < Previous Page | 827 828 829 830 831 832 833 834 835 836 837 838  | Next Page >

  • LINQ Except operator and object equality

    - by Abhijeet Patel
    Here is an interesting issue I noticed when using the Except Operator: I have list of users from which I want to exclude some users: The list of users is coming from an XML file: The code goes like this: interface IUser { int ID { get; set; } string Name { get; set; } } class User: IUser { #region IUser Members public int ID { get; set; } public string Name { get; set; } #endregion public override string ToString() { return ID + ":" +Name; } public static IEnumerable<IUser> GetMatchingUsers(IEnumerable<IUser> users) { IEnumerable<IUser> localList = new List<User> { new User{ ID=4, Name="James"}, new User{ ID=5, Name="Tom"} }.OfType<IUser>(); var matches = from u in users join lu in localList on u.ID equals lu.ID select u; return matches; } } class Program { static void Main(string[] args) { XDocument doc = XDocument.Load("Users.xml"); IEnumerable<IUser> users = doc.Element("Users").Elements("User").Select (u => new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType<IUser>(); //still a query, objects have not been materialized var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes should contain 6 users but here it contains 8 users } } When I call User.GetMatchingUsers(users) I get 2 matches as expected. The issue is that when I call users.Except(matches) The matching users are not being excluded at all! I am expecting 6 users ut "excludes" contains all 8 users instead. Since all I'm doing in GetMatchingUsers(IEnumerable users) is taking the IEnumerable and just returning the IUsers whose ID's match( 2 IUsers in this case), my understanding is that by default "Except" will use reference equality for comparing the objects to be excluded. Is this not how "Except" behaves? What is even more interesting is that if I materialize the objects using .ToList() and then get the matching users, and call "Except", everything works as expected! Like so: IEnumerable users = doc.Element("Users").Elements("User").Select (u = new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType().ToList(); //explicity materializing all objects by calling ToList() var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes now contains 6 users as expected I don't see why I should need to materialize objects for calling "Except" given that its defined on IEnumerable? Any suggesstions / insights would be much appreciated.

    Read the article

  • Trying to run multiple HTTP requests in parallel, but being limited by Windows (registry)

    - by Nailuj
    I'm developing an application (winforms C# .NET 4.0) where I access a lookup functionality from a 3rd party through a simple HTTP request. I call an url with a parameter, and in return I get a small string with the result of the lookup. Simple enough. The challenge is however, that I have to do lots of these lookups (a couple of thousands), and I would like to limit the time needed. Therefore I would like to run requests in parallel (say 10-20). I use a ThreadPool to do this, and the short version of my code looks like this: public void startAsyncLookup(Action<LookupResult> returnLookupResult) { this.returnLookupResult = returnLookupResult; foreach (string number in numbersToLookup) { ThreadPool.QueueUserWorkItem(lookupNumber, number); } } public void lookupNumber(Object threadContext) { string numberToLookup = (string)threadContext; string url = @"http://some.url.com/?number=" + numberToLookup; WebClient webClient = new WebClient(); Stream responseData = webClient.OpenRead(url); LookupResult lookupResult = parseLookupResult(responseData); returnLookupResult(lookupResult); } I fill up numbersToLookup (a List<String>) from another place, call startAsyncLookup and provide it with a call-back function returnLookupResult to return each result. This works, but I found that I'm not getting the throughput I want. Initially I thought it might be the 3rd party having a poor system on their end, but I excluded this by trying to run the same code from two different machines at the same time. Each of the two took as long as one did alone, so I could rule out that one. A colleague then tipped me that this might be a limitation in Windows. I googled a bit, and found amongst others this post saying that by default Windows limits the number of simultaneous request to the same web server to 4 for HTTP 1.0 and to 2 for HTTP 1.1 (for HTTP 1.1 this is actually according to the specification (RFC2068)). The same post referred to above also provided a way to increase these limits. By adding two registry values to [HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Internet Settings] (MaxConnectionsPerServer and MaxConnectionsPer1_0Server), I could control this myself. So, I tried this (sat both to 20), restarted my computer, and tried to run my program again. Sadly though, it didn't seem to help any. I also kept an eye on the Resource Monitor (see screen shot) while running my batch lookup, and I noticed that my application (the one with the title blacked out) still only was using two TCP connections. So, the question is, why isn't this working? Is the post I linked to using the wrong registry values? Is this perhaps not possible to "hack" in Windows any longer (I'm on Windows 7)? Any ideas would be highly appreciated :) And just in case anyone should wonder, I have also tried with different settings for MaxThreads on ThreadPool (everyting from 10 to 100), and this didn't seem to affect my throughput at all, so the problem shouldn't be there either.

    Read the article

  • bad file descriptor with close() socket (c++)

    - by user321246
    hi everybody! I'm running out of file descriptors when my program can't connect another host. The close() system call doesn't work, the number of open sockets increases. I can se it with cat /proc/sys/fs/file-nr Print from console: connect: No route to host close: Bad file descriptor connect: No route to host close: Bad file descriptor .. Code: #include <stdio.h> #include <stdlib.h> #include <sys/socket.h> #include <netinet/in.h> #include <netdb.h> #include <string.h> #include <iostream> using namespace std; #define PORT 1238 #define MESSAGE "Yow!!! Are we having fun yet?!?" #define SERVERHOST "192.168.9.101" void write_to_server (int filedes) { int nbytes; nbytes = write (filedes, MESSAGE, strlen (MESSAGE) + 1); if (nbytes < 0) { perror ("write"); } } void init_sockaddr (struct sockaddr_in *name, const char *hostname, uint16_t port) { struct hostent *hostinfo; name->sin_family = AF_INET; name->sin_port = htons (port); hostinfo = gethostbyname (hostname); if (hostinfo == NULL) { fprintf (stderr, "Unknown host %s.\n", hostname); } name->sin_addr = *(struct in_addr *) hostinfo->h_addr; } int main() { for (;;) { sleep(1); int sock; struct sockaddr_in servername; /* Create the socket. */ sock = socket (PF_INET, SOCK_STREAM, 0); if (sock < 0) { perror ("socket (client)"); } /* Connect to the server. */ init_sockaddr (&servername, SERVERHOST, PORT); if (0 > connect (sock, (struct sockaddr *) &servername, sizeof (servername))) { perror ("connect"); sock = -1; } /* Send data to the server. */ if (sock > -1) write_to_server (sock); if (close (sock) != 0) perror("close"); } return 0; }

    Read the article

  • TimeOuts with HttpWebRequest when running Selenium concurrently in .NET

    - by domsom
    I have a download worker that uses ThreadPool-threads to download files. After enhancing these to apply some Selenium tests to the downloaded files, I am constantly experiencing TimeOut-exceptions with the file downloaders and delays running the Selenium tests. More precisely: When the program starts, the download threads start downloading and a couple of pages are seamlessly processed via Selenium Shortly after, the first download threads start throwing TimeOut exceptions from HttpWebRequest. At the same time, commands stop flowing to Selenium (as observed in the SeleniumRC log), but the thread running Selenium is not getting any exception This situation holds as long as there are entries in the download list: new download threads are being started and terminate after receiving TimeOuts (without trying to lock Selenium) As soon as no more download threads are being started, Selenium starts receiving commands again and the threads waiting for the lock are processed sequentially as designed Now here's the download code: HttpWebRequest request = null; WebResponse response = null; Stream stream = null; StreamReader sr = null; try { request = (HttpWebRequest) WebRequest.Create(uri); request.ServicePoint.ConnectionLimit = MAX_CONNECTIONS_PER_HOST; response = request.GetResponse(); stream = response.GetResponseStream(); // Read the stream... } finally { if (request != null) request.Abort(); if (response != null) response.Close(); if (stream != null) { stream.Close(); stream.Dispose(); } if (sr != null) { sr.Close(); sr.Dispose(); } } And this is how Selenium is used afterwards in the same thread: lock(SeleniumLock) { selenium.Open(url); // Run some Selenium commands, but no selenium.stop() } Where selenium is a static variable that is initialized in the static constructor of the class (via selenium.start()). I assume I am running into the CLR connection limit, so I added these lines during initalization: ThreadPool.GetMaxThreads (out maxWorkerThreads, out maxCompletionPortThreads); HttpUtility.MAX_CONNECTIONS_PER_HOST = maxWorkerThreads; System.Net.ServicePointManager.DefaultConnectionLimit = maxWorkerThreads + 1; The + 1 is for the connection to the SeleniumRC, due to my guess that the Selenium client code also uses HttpWebRequest. It seems like I'm still running into some kind of deadlock - although the threads waiting for the Selenium lock do not hold any resources. Any ideas on how to get this working?

    Read the article

  • How to get a physics engine like Nape working?

    - by Glacius
    Introduction: I think Nape is a relatively new engine so some of you may not know it. It's supposedly faster than box2d and I like that there is decent documentation. Here's the site: http://code.google.com/p/nape/ I'm relatively new to programming. I am decent at AS3's basic functionality, but every time I try to implement some kind of engine or framework I can't even seem to get it to work. With Nape I feel I got a little further than before but I still got stuck. My problem: I'm using Adobe CS5, I managed to import the SWC file like described here. Next I tried to copy the source of one of the demo's like this one and get it to work but I keep getting errors. I made a new class file, copied the demo source to it, and tried to add it to the stage. My stage code basically looks like this: import flash.Boot; // these 2 lines are as described in the tutorial new Boot(); var demo = new Main(); // these 2 are me guessing what I'm supposed to do addChild(demo); Well, it seems the source code is not even being recognized by flash as a valid class file. I tried editing it, but even if I get it recognized (give a package name and add curly brackets) but I still get a bunch of errors. Is it psuedo code or something? What is going on? My goal: I can imagine I'm going about this the wrong way. So let me explain what I'm trying to achieve. I basically want to learn how to use the engine by starting from a simple basic example that I can edit and mess around with. If I can't even get a working example then I'm unable to learn anything. Preferably I don't want to start using something like FlashDevelop (as I'd have to learn how to use the program) but if it can't be helped then I can give it a try. Thank you.

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • WPF multibound textblock not updating

    - by Superstringcheese
    I want to create a program which calculates how long it will take to repeat a process a certain number of times. I've scaled this down a lot for this example. So, I have some textboxes which are bound to properties in a class: Count: <TextBox x:Name="txtCount" Text="{Binding Count, Mode=TwoWay}" Width="50"/> Days: <TextBox x:Name="txtDays" Text="{Binding Days, Mode=TwoWay}" Width="50"/> and a textblock which is multibound like so: <TextBlock x:Name="tbkTotal"> <TextBlock.Text> <MultiBinding StringFormat="Days: {0}, Count: {1}"> <Binding Path="Days" /> /* This isn't updating */ <Binding Path="Count" /> </MultiBinding> </TextBlock.Text> </TextBlock> My DataContext is set in the Window1.xaml.cs file. public Window1() { InitializeComponent(); Sample sample = new Sample(); this.DataContext = sample; } I can update the multibound textblock with the Count property just fine, but the Days property always shows 0, even though the Days input accurately reflects changes. I believe that this is because my accessors are different for Days - namely, the Set method. This class is in a different file. public class Sample : INotifyPropertyChanged { private int _count; private TimeSpan _span; public int Count { get { return _count; } set { _count = value; NotifyPropertyChanged("Count"); /* Doesn't seem to be needed, actually */ } } public TimeSpan Span { get { return _span; } } /* The idea is to provide a property for Days, Hours, Minutes, etc. as conveniences to the inputter */ public double Days { get { return _span.Days; } set { TimeSpan ts = new TimeSpan(); double val = value > 0 ? value : 0; ts = TimeSpan.FromDays(val); _span.Add(ts); NotifyPropertyChanged("Span"); /* Here I can only get it to work if I notify that Span has changed - doesn't seem to be aware that the value behind Days has changed. */ } } private void NotifyPropertyChanged(string property) { if (null != this.PropertyChanged) { PropertyChanged(this, new PropertyChangedEventArgs(property)); } } public Sample() { _count = 0; _span = new TimeSpan(); } public event PropertyChangedEventHandler PropertyChanged; }

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • Help with bugs in a C code

    - by Yanki Twizzy
    This C code is giving me some unpredictable results. The program is meant to collect 6 nos and print out the max, position of the max no and the average. It's supposed to have only 3 functions - input, max_avr_pos and output for doing what the code is supposed to do but I am getting unpredictable results. Please what could be the problem #include <stdio.h> #include <stdlib.h> #include <conio.h> void input_vals(int arrnum[]); void max_ave_val(int arrnum1[],double *average,int *maxval,int *position); void print_output(double *average1,int *maxval1,int *position1); int main(void) { int arrnum[6],maxval2,position2; double average2; input_vals(arrnum); max_ave_val(arrnum,&average2,&maxval2,&position2); print_output(&average2,&maxval2,&position2); _getche(); return 0; } void input_vals(int arrnum[]) { int count; printf("\n Please enter six numbers\n"); for(count=0;count<6;count++) { scanf("%d",&arrnum[count]); } } void max_ave_val(int arrnum1[],double *average,int *maxval,int *position) { int total=0; int cnt,cnt1,cnt2,limit,maxval2,post; limit=6; /* finding the max value*/ for(cnt=0;cnt<limit-1;cnt++) for(cnt1=limit-1;cnt1>cnt;--cnt1) { if(arrnum1[cnt1-1]>arrnum1[cnt1]) { maxval2=arrnum1[cnt-1]; post=(cnt-1)+1; } else { maxval2=arrnum1[cnt1]; post=cnt1+1; } } *maxval=maxval2; *position=post; /* solving for total */ for(cnt2=0;cnt2<limit;cnt2++); { total=total+arrnum1[cnt2]; } *average=total/limit; } void print_output(double *average1,int *maxval1,int *position1) { printf("\n value of the highest of the numbers is %d\n",*maxval1); printf("\n the average of all the numbers is %g\n",*average1); printf("\n the postion of the highest number in the list is %d\n",*position1); }

    Read the article

  • Correct usage of socket_select().

    - by Mark Tomlin
    What is the correct way to use socket_select within PHP to send and receive data? I have a connection to the server that allows for both TCP & UDP packet connections, I am utilizing both. Within these connections I'm both sending and receiving packets on the same port, but the TCP packet will be sent on one port (29999) and UDP will be sent on another port (30000). The transmission type will be that of AF_INET. The IP address will be loopback 127.0.0.1. I have many questions on how to create a socket connection within this scenario. For example, is it better to use socket_create_pair to make the connection, or use just socket_create followed by socket_connect, and then implement socket_select? There is a chance that no data will be sent from the server to the client, and it is up to the client to maintain the connection. This will be done by utilizing the time out function within the socket_select call. Should no data be sent within the time limit, the socket_select function will break and a keep alive packet can then be sent. The following script is of the client. // Create $TCP = socket_create(AF_INET, SOCK_STREAM, SOL_TCP); $UDP = socket_create(AF_INET, SOCK_DGRAM, SOL_UDP); // Misc $isAlive = TRUE; $UDPPort = 30000; define('ISP_ISI', 1); // Connect socket_connect($TCP, '127.0.0.1', 29999); socket_connect($UDP, '127.0.0.1', $UDPPort); // Construct Parameters $recv = array($TCP, $UDP); $null = NULL; // Make The Packet to Send. $packet = pack('CCCxSSxCSa16a16', 44, ISP_ISI, 1, $UDPPort, 0, '!', 0, 'AdminPass', 'SocketSelect'); // Send ISI (InSim Init) Packet socket_write($TCP, $packet); /* Main Program Loop */ while ($isAlive == TRUE) { // Socket Select $sock = socket_select($recv, $null, $null, 5); // Check Status if ($sock === FALSE) $isAlive = FALSE; # Error else if ($sock > 0) # How does one check to find what socket changed? else # Something else happed, don't know what as it's not in the documentation, Could this be our timeout getting tripped? }

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • Ideas on implementing threads and cross process communication. - C

    - by Jamie Keeling
    Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occured. I have already implemented a thread on the first process which currently creates the data to send to the second process and makes it available to the second process. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. Following is a small snippet of what I have so far in the producer application; Rolling the dice and sending the data: case IDM_FILE_ROLLDICE: { hDiceRoll = CreateThread( NULL, // lpThreadAttributes (default) 0, // dwStackSize (default) ThreadFunc(hMainWindow), // lpStartAddress NULL, // lpParameter 0, // dwCreationFlags &hDiceID // lpThreadId (returned by function) ); } break; The data being sent to the other process: DWORD WINAPI ThreadFunc(LPVOID passedHandle) { HANDLE hMainHandle = *((HANDLE*)passedHandle); WCHAR buffer[256]; LPCTSTR pBuf; LPVOID lpMsgBuf; LPVOID lpDisplayBuf; struct diceData storage; HANDLE hMapFile; DWORD dw; //Roll dice and store results in variable storage = RollDice(); hMapFile = CreateFileMapping( (HANDLE)0xFFFFFFFF, // use paging file NULL, // default security PAGE_READWRITE, // read/write access 0, // maximum object size (high-order DWORD) BUF_SIZE, // maximum object size (low-order DWORD) szName); // name of mapping object if (hMapFile == NULL) { dw = GetLastError(); MessageBox(hMainHandle,L"Could not create file mapping object",L"Error",MB_OK); return 1; } pBuf = (LPTSTR) MapViewOfFile(hMapFile, // handle to map object FILE_MAP_ALL_ACCESS, // read/write permission 0, 0, BUF_SIZE); if (pBuf == NULL) { MessageBox(hMainHandle,L"Could not map view of file",L"Error",MB_OK); CloseHandle(hMapFile); return 1; } CopyMemory((PVOID)pBuf, &storage, (_tcslen(szMsg) * sizeof(TCHAR))); //_getch(); MessageBox(hMainHandle,L"Completed!",L"Success",MB_OK); UnmapViewOfFile(pBuf); return 0; } I'd like to think I am at least on the right lines, although for some reason when the application finishes creating the thread it hits the return DefWindowProc(hMainWindow, message, wParam, lParam); it crashes saying there's no more source code for the current location. I know there are certain ways to implement things but as I've mentioned I'm not sure if i'm doing this the right way, has anybody else tried to do the same thing? Thanks!

    Read the article

  • C++ DLL creation for C# project - No functions exported

    - by Yeti
    I am working on a project that requires some image processing. The front end of the program is C# (cause the guys thought it is a lot simpler to make the UI in it). However, as the image processing part needs a lot of CPU juice I am making this part in C++. The idea is to link it to the C# project and just call a function from a DLL to make the image processing part and allow to the C# environment to process the data afterwards. Now the only problem is that it seems I am not able to make the DLL. Simply put the compiler refuses to put any function into the DLL that I compile. Because the project requires some development time testing I have created two projects into a C++ solution. One is for the Dll and another console application. The console project holds all the files and I just include the corresponding header into my DLL project file. I thought the compiler should take out the functions that I marked as to be exported and make the DLL from them. Nevertheless this does not happens. Here it is how I defined the function in the header: extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck); extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI, CvScalar &refHSVColorLow, CvScalar &refHSVColorHi ); Followed by the implementation in the cpp file: extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI,&refHSVColorLow, CvScalar &refHSVColorHi ) { \\... return cvPoint((int)( M10/M00) + imgROI.x, (int)( M01/M00 ) + imgROI.y) ;} extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck) { \\ ...}; And my main file for the DLL project looks like: #ifdef _MANAGED #pragma managed(push, off) #endif /// <summary> Include files. </summary> #include "..\ImageProcessingDebug\ImageProcessingTest.h" #include "..\ImageProcessingDebug\ImageProcessing.h" BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { return TRUE; } #ifdef _MANAGED #pragma managed(pop) #endif Needless to say it does not work. A quick look with DLL export viewer 1.36 reveals that no function is inside the library. I don't get it. What I am doing wrong ? As side not I am using the C++ objects (and here it is the C++ DLL part) such as the vector. However, only for internal usage. These will not appear in the headers of either function as you can observe from the previous code snippets. Any ideas? Thx, Bernat

    Read the article

  • Can sorting Japanese kanji words be done programatically?

    - by Mason
    I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Is it Bad Practice to use C++ only for the STL containers?

    - by gmatt
    First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

    Read the article

  • Read from file in eclipse

    - by Buzkie
    I'm trying to read from a text file to input data to my java program. However, eclipse continuosly gives me a Source not found error no matter where I put the file. I've made an additional sources folder in the project directory, the file in question is in both it and the bin file for the project and it still can't find it. I even put a copy of it on my desktop and tried pointing eclipse there when it asked me to browse for the source lookup path. No matter what I do it can't find the file. here's my code in case it's pertinent: System.out.println(System.getProperty("user.dir")); File file = new File("file.txt"); Scanner scanner = new Scanner(file); in addition, it says the user directory is the project directory and there is a copy there too. I have no clue what to do. Thanks, Alex after attempting the suggestion below and refreshing again, I was greeted by a host of errors. FileNotFoundException(Throwable).<init>(String) line: 195 FileNotFoundException(Exception).<init>(String) line: not available FileNotFoundException(IOException).<init>(String) line: not available FileNotFoundException.<init>(String) line: not available URLClassPath$JarLoader.getJarFile(URL) line: not available URLClassPath$JarLoader.access$600(URLClassPath$JarLoader, URL) line: not available URLClassPath$JarLoader$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath$JarLoader.ensureOpen() line: not available URLClassPath$JarLoader.<init>(URL, URLStreamHandler, HashMap) line: not available URLClassPath$3.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath.getLoader(URL) line: not available URLClassPath.getLoader(int) line: not available URLClassPath.access$000(URLClassPath, int) line: not available URLClassPath$2.next() line: not available URLClassPath$2.hasMoreElements() line: not available ClassLoader$2.hasMoreElements() line: not available CompoundEnumeration<E>.next() line: not available CompoundEnumeration<E>.hasMoreElements() line: not available ServiceLoader$LazyIterator.hasNext() line: not available ServiceLoader$1.hasNext() line: not available LocaleServiceProviderPool$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] LocaleServiceProviderPool.<init>(Class<LocaleServiceProvider>) line: not available LocaleServiceProviderPool.getPool(Class<LocaleServiceProvider>) line: not available NumberFormat.getInstance(Locale, int) line: not available NumberFormat.getNumberInstance(Locale) line: not available Scanner.useLocale(Locale) line: not available Scanner.<init>(Readable, Pattern) line: not available Scanner.<init>(ReadableByteChannel) line: not available Scanner.<init>(File) line: not available code used: System.out.println(System.getProperty("user.dir")); File file = new File(System.getProperty("user.dir") + "/file.txt"); Scanner scanner = new Scanner(file);

    Read the article

  • Solving a cyclical dependency in Ninject (Compact Framework)

    - by Alex
    I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

    Read the article

  • SQL Invalid Object Name 'AddressType'

    - by salvationishere
    I am getting the above error in my VS 2008 C# method when I try to invoke the SQL getColumnNames stored procedure from VS. This SP accepts one input parameter, the table name, and works successfully from SSMS. Currently I am selecting the AdventureWorks AddressType table for it to pull the column names from this table. I can see teh AdventureWorks table available in VS from my Server Explorer / Data Connection. And I see both the AddressType table and getColumnNames SP showing in Server Explorer. But I am still getting this error listed above. Here is the C# code snippet I use to execute this: public static DataTable DisplayTableColumns(string tt) { SqlDataReader dr = null; string TableName = tt; string connString = "Data Source=.;AttachDbFilename=\"C:\Program Files\Microsoft SQL Server\MSSQL10.MSSQLSERVER\MSSQL\DATA\AdventureWorks_Data.mdf\";Initial Catalog=AdventureWorks;Integrated Security=True;Connect Timeout=30;User Instance=False"; string errorMsg; SqlConnection conn2 = new SqlConnection(connString); SqlCommand cmd = conn2.CreateCommand(); try { cmd.CommandText = "dbo.getColumnNames"; cmd.CommandType = CommandType.StoredProcedure; cmd.Connection = conn2; SqlParameter parm = new SqlParameter("@TableName", SqlDbType.VarChar); parm.Value = TableName; parm.Direction = ParameterDirection.Input; cmd.Parameters.Add(parm); conn2.Open(); dr = cmd.ExecuteReader(); } catch (Exception ex) { errorMsg = ex.Message; } And when I examine the errorMsg it says the following: " at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.SqlDataReader.ConsumeMetaData()\r\n at System.Data.SqlClient.SqlDataReader.get_MetaData()\r\n at System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader(CommandBehavior behavior, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader()\r\n at ADONET_namespace.ADONET_methods.DisplayTableColumns(String tt) in C:\Documents and Settings\Admin\My Documents\Visual Studio 2008\Projects\AddFileToSQL\AddFileToSQL\ADONET methods.cs:line 35" Where line 35 is dr = cmd.ExecuteReader();

    Read the article

  • howto parse struct to C++ dll from C#

    - by Nerds Rule
    I am trying to call a function in a unmanaged C++ dll. It has this prototype: [DllImport("C:\\Program Files\\MySDK\\VSeries.dll", EntryPoint = "BII_Send_Index_Template_MT" )] internal unsafe static extern Int32 BII_Send_Index_Template_MT(IntPtr pUnitHandle, ref BII_Template template, Int32 option, Boolean async); BII_Template template = new BII_Template(); error_code = BII_Send_Index_Template_MT(pUnitHandle, ref template, option, false); I is how I define the BII_Template struct in C#: public unsafe struct BII_Template { public ulong id; public ulong employee_id; public ulong password; public byte sensor_version; public byte template_version; public fixed char name[16]; public byte finger; public byte admin_level; public byte schedule; public byte security_thresh; public fixed byte noise_level[18]; public byte corramb; public byte reference_x; public byte reference_y; public fixed byte ihcore[3]; public fixed byte ivcore[3]; public byte temp_xoffset; public byte temp_yoffset; public byte index; public fixed byte inphase[5500]; }; It build and when I run it the dll return error_code = "The record checksum is invalid." I assume that I am using the ref keyword in a wrong way or the size of some of the elements in the struct is wrong. ----- EDIT ------------ Here is the struct in C++: typedef struct { unsigned long id; unsigned long employee_id; unsigned long password; unsigned char sensor_version; unsigned char template_version; char name[16]; unsigned char finger; unsigned char admin_level; unsigned char schedule; unsigned char security_thresh; unsigned char noise_level[18]; unsigned char corramb ; unsigned char reference_x ; unsigned char reference_y ; unsigned char ihcore[NUM_CORE]; unsigned char ivcore[NUM_CORE]; unsigned char temp_xoffset; unsigned char temp_yoffset; unsigned char index; unsigned char inphase[PACKED_ARRAY_SIZE]; } BII_Template;

    Read the article

  • Unable to read data from the transport connection: the connection was closed

    - by webdreamer
    The exception is Remoting Exception - Authentication Failure. The detailed message says "Unable to read data from the transport connection: the connection was closed." I'm having trouble with creating two simple servers that can comunicate as remote objects in C#. ServerInfo is just a class I created that holds the IP and Port and can give back the address. It works fine, as I used it before, and I've debugged it. Also the server is starting just fine, no exception is thrown, and the channel is registered without problems. I'm using Forms to do the interfaces, and call some of the methods on the server, but didn't find any problems in passing the parameters from the FormsApplication to the server when debugging. All seems fine in that chapter. public ChordServerProgram() { RemotingServices.Marshal(this, "PADIBook"); nodeInt = 0; } public void startServer() { try { serverChannel = new TcpChannel(serverInfo.Port); ChannelServices.RegisterChannel(serverChannel, true); } catch (Exception e) { Console.WriteLine(e.ToString()); } } I run two instances of this program. Then startNode is called on one of the instances of the application. The port is fine, the address generated is fine as well. As you can see, I'm using the IP for localhost, since this server is just for testing purposes. public void startNode(String portStr) { IPAddress address = IPAddress.Parse("127.0.0.1"); Int32 port = Int32.Parse(portStr); serverInfo = new ServerInfo(address, port); startServer(); //node = new ChordNode(serverInfo,this); } Then, in the other istance, through the interface again, I call another startNode method, giving it a seed server to get information from. This is where it goes wrong. When it calls the method on the seedServer proxy it just got, a RemotingException is thrown, due to an authentication failure. (The parameter I'll want to get is the node, I'm just using the int to make sure the ChordNode class has nothing to do with this error.) public void startNode(String portStr, String seedStr) { IPAddress address = IPAddress.Parse("127.0.0.1"); Int32 port = Int32.Parse(portStr); serverInfo = new ServerInfo(address, port); IPAddress addressSeed = IPAddress.Parse("127.0.0.1"); Int32 portSeed = Int32.Parse(seedStr); ServerInfo seedInfo = new ServerInfo(addressSeed, portSeed); startServer(); ChordServerProgram seedServer = (ChordServerProgram)Activator.GetObject(typeof(ChordServerProgram), seedInfo.GetFullAddress()); // node = new ChordNode(serverInfo,this); int seedNode = seedServer.nodeInt; // node.chordJoin(seedNode.self); }

    Read the article

  • Rewriting Live TCP/IP (Layer 4) (i.e. Socket Layer) Streams

    - by user213060
    I have a simple problem which I'm sure someone here has done before... I want to rewrite Layer 4 TCP/IP streams (Not lower layer individual packets or frames.) Ettercap's etterfilter command lets you perform simple live replacements of Layer 4 TCP/IP streams based on fixed strings or regexes. Example ettercap scripting code: if (ip.proto == TCP && tcp.dst == 80) { if (search(DATA.data, "gzip")) { replace("gzip", " "); msg("whited out gzip\n"); } } if (ip.proto == TCP && tcp.dst == 80) { if (search(DATA.data, "deflate")) { replace("deflate", " "); msg("whited out deflate\n"); } } http://ettercap.sourceforge.net/forum/viewtopic.php?t=2833 I would like to rewrite streams based on my own filter program instead of just simple string replacements. Anyone have an idea of how to do this? Is there anything other than Ettercap that can do live replacement like this, maybe as a plugin to a VPN software or something? I would like to have a configuration similar to ettercap's silent bridged sniffing configuration between two Ethernet interfaces. This way I can silently filter traffic coming from either direction with no NATing problems. Note that my filter is an application that acts as a pipe filter, similar to the design of unix command-line filters: >[eth0] <----------> [my filter] <----------> [eth1]< What I am already aware of, but are not suitable: Tun/Tap - Works at the lower packet layer, I need to work with the higher layer streams. Ettercap - I can't find any way to do replacements other than the restricted capabilities in the example above. Hooking into some VPN software? - I just can't figure out which or exactly how. libnetfilter_queue - Works with lower layer packets, not TCP/IP streams. Again, the rewriting should occur at the transport layer (Layer 4) as it does in this example, instead of a lower layer packet-based approach. Exact code will help immensely! Thanks!

    Read the article

  • Two loops speeds drawing in a Jframe

    - by noahn567
    I have a program that requires two classes. The player-Names class, and the Player-Model class. I want the player-Names class to repaint every half second, and the Player-Model class to repaint 60 times per second because i want the movement to be smooth. The problem that i am having is that i want all of this to be done on one J-frame. How would i go about doing this? If you could lead me in the right direction or give me a little example that would be great! Thank you :). for some reason it wont let me post so i'm going to put in some random code import java.awt.Color; import java.awt.Font; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.RenderingHints; import javax.swing.JComponent; import javax.swing.JFrame; public class PlayerNames extends JFrame { static int connectionTimer = 0; static int connectionTimer2 = 0; static int reconnect = 0; static int reconnectValue = 1; static int x = 0; static int reconnectWait = connectionTimer + reconnectValue; private static final long serialVersionUID = 1L; public graph gg = new graph(); public graph g = new graph(); private static GameClient socketClient; private GameServer socketServer; public static void main(int width, int height) { PlayerNames tt = new PlayerNames(); // PlayerGraphics t = new PlayerGraphics(); tt.setSize(width, height); if (Game.ServerOwner == 1) { tt.setTitle("Server: " + Game.username); } else { tt.setTitle("Username: " + Game.username); } tt.setVisible(true); tt.getContentPane().add(tt.gg); tt.getContentPane().add(tt.g); tt.setDefaultCloseOperation(EXIT_ON_CLOSE); tt.setResizable(false); }

    Read the article

  • OpenGL Coordinate system confusion

    - by user146780
    Maybe I set up GLUT wrong. Basically I want verticies to be reletive to their size in pixels. Ex:right now if I create a hexagon, it hakes up the whole screen even though the units are 6. #include <iostream> #include <stdlib.h> //Needed for "exit" function #include <cmath> //Include OpenGL header files, so that we can use OpenGL #ifdef __APPLE__ #include <OpenGL/OpenGL.h> #include <GLUT/glut.h> #else #include <GL/glut.h> #endif using namespace std; //Called when a key is pressed void handleKeypress(unsigned char key, //The key that was pressed int x, int y) { //The current mouse coordinates switch (key) { case 27: //Escape key exit(0); //Exit the program } } //Initializes 3D rendering void initRendering() { //Makes 3D drawing work when something is in front of something else glEnable(GL_DEPTH_TEST); } //Called when the window is resized void handleResize(int w, int h) { //Tell OpenGL how to convert from coordinates to pixel values glViewport(0, 0, w, h); glMatrixMode(GL_PROJECTION); //Switch to setting the camera perspective //Set the camera perspective glLoadIdentity(); //Reset the camera gluPerspective(45.0, //The camera angle (double)w / (double)h, //The width-to-height ratio 1.0, //The near z clipping coordinate 200.0); //The far z clipping coordinate } //Draws the 3D scene void drawScene() { //Clear information from last draw glClear(GL_COLOR_BUFFER_BIT | GL_DEPTH_BUFFER_BIT); glLoadIdentity(); //Reset the drawing perspective glPolygonMode(GL_FRONT_AND_BACK, GL_FILL); glBegin(GL_POLYGON); //Begin quadrilateral coordinates //Trapezoid glColor3f(255,0,0); for(int i = 0; i < 6; ++i) { glVertex2d(sin(i/6.0*2* 3.1415), cos(i/6.0*2* 3.1415)); } glEnd(); //End quadrilateral coordinates glutSwapBuffers(); //Send the 3D scene to the screen } int main(int argc, char** argv) { //Initialize GLUT glutInit(&argc, argv); glutInitDisplayMode(GLUT_DOUBLE | GLUT_RGBA | GLUT_DEPTH); glutInitWindowSize(400, 400); //Set the window size //Create the window glutCreateWindow("Basic Shapes - videotutorialsrock.com"); initRendering(); //Initialize rendering //Set handler functions for drawing, keypresses, and window resizes glutDisplayFunc(drawScene); glutKeyboardFunc(handleKeypress); glutReshapeFunc(handleResize); glutMainLoop(); //Start the main loop. glutMainLoop doesn't return. return 0; //This line is never reached } How can I make it so that a polygon of 0,0 10,0 10,10 0,10 defines a polygon starting at the top left of the screen and is a width and height of 10 pixels? Thanks

    Read the article

  • What makes a Winform position initially stale?

    - by msorens
    The code below demonstrates a very simple problem; I am hoping that I am just missing a setting that someone might be able to reveal. Goal (1) Launch main winform (MainForm). (2) Press button to display secondary winform (ShadowForm) that is semi-transparent and should exactly overlay MainForm. What Actually Happens Scenario 1: Launch main winform then press button: ShadowForm displays with correct size but incorrect location, lower and to the right (as if it was cascaded). Press button to close ShadowForm again. Press button once more to reopen ShadowForm and now it is in the correct position, covering MainForm. Scenario 2: Launch main winform, move it around, then press button: ShadowForm displays with correct size but incorrect location (where the MainForm was before moving it). Press button to close; press again to reopen and now ShadowForm is in the correct position. using System; using System.Windows.Forms; namespace LocationTest { static class Program { static void Main() { Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new MainForm()); } } public class MainForm : Form { ShadowForm shadowForm = new ShadowForm(); Button button1 = new Button(); System.ComponentModel.IContainer components = null; public MainForm() { this.SuspendLayout(); this.button1.Location = new System.Drawing.Point(102, 44); this.button1.Size = new System.Drawing.Size(75, 23); this.button1.Text = "button1"; this.button1.Click += new System.EventHandler(this.button1_Click); this.ClientSize = new System.Drawing.Size(292, 266); this.Controls.Add(this.button1); this.ResumeLayout(false); } private void button1_Click(object sender, EventArgs e) { if (shadowForm.Visible) { shadowForm.Hide(); } else { shadowForm.Size = Size; // this always works shadowForm.Location = Location; // this fails first time, but works second time! shadowForm.Show(); } } protected override void Dispose(bool disposing) { if (disposing && (components != null)) { components.Dispose(); } base.Dispose(disposing); } } public class ShadowForm : Form { private System.ComponentModel.IContainer components = null; public ShadowForm() { this.SuspendLayout(); this.BackColor = System.Drawing.Color.Black; this.FormBorderStyle = System.Windows.Forms.FormBorderStyle.None; this.Opacity = 0.5; this.Click += new System.EventHandler(this.ShadowForm_Click); this.ResumeLayout(false); } private void ShadowForm_Click(object sender, EventArgs e) { Hide(); } protected override void Dispose(bool disposing) { if (disposing && (components != null)) { components.Dispose(); } base.Dispose(disposing); } } }

    Read the article

< Previous Page | 827 828 829 830 831 832 833 834 835 836 837 838  | Next Page >