Search Results

Search found 21960 results on 879 pages for 'program termination'.

Page 831/879 | < Previous Page | 827 828 829 830 831 832 833 834 835 836 837 838  | Next Page >

• Catching error caused by InitialContext.lookup

  - by Martin Schröder

  I'm developing a command line client (Java SE6) that now needs to talk to a Glassfish 2.1 server. The code for setting up this connection is try { final InitialContext context = new InitialContext(); final String ejbName = GeneratorCancelledRemote.class.getName(); generatorCancelled = (GeneratorCancelledRemote) context.lookup(ejbName); } catch (Throwable t) { System.err.println("--> Could not call server:"); t.printStackTrace(System.err); runWithOutEJB = true; } I'm now testing it without a running server and the client (when run from Eclipse 4.2) just bombs with 31.10.2012 10:40:09 com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl WARNUNG: "IOP00410201: (COMM_FAILURE) Connection failure: socketType: IIOP_CLEAR_TEXT; hostname: localhost; port: 3700" org.omg.CORBA.COMM_FAILURE: vmcid: SUN minor code: 201 completed: No at com.sun.corba.ee.impl.logging.ORBUtilSystemException.connectFailure(ORBUtilSystemException.java:2783) at com.sun.corba.ee.impl.logging.ORBUtilSystemException.connectFailure(ORBUtilSystemException.java:2804) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:261) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:274) at com.sun.corba.ee.impl.transport.SocketOrChannelContactInfoImpl.createConnection(SocketOrChannelContactInfoImpl.java:130) at com.sun.corba.ee.impl.protocol.CorbaClientRequestDispatcherImpl.beginRequest(CorbaClientRequestDispatcherImpl.java:192) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.request(CorbaClientDelegateImpl.java:184) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.is_a(CorbaClientDelegateImpl.java:328) at org.omg.CORBA.portable.ObjectImpl._is_a(ObjectImpl.java:112) at org.omg.CosNaming.NamingContextHelper.narrow(NamingContextHelper.java:69) at com.sun.enterprise.naming.SerialContext.narrowProvider(SerialContext.java:134) at com.sun.enterprise.naming.SerialContext.getCachedProvider(SerialContext.java:259) at com.sun.enterprise.naming.SerialContext.getRemoteProvider(SerialContext.java:204) at com.sun.enterprise.naming.SerialContext.getProvider(SerialContext.java:159) at com.sun.enterprise.naming.SerialContext.lookup(SerialContext.java:409) at javax.naming.InitialContext.lookup(InitialContext.java:392) at com.werkii.latex.generator.Generator.main(Generator.java:344) Caused by: java.lang.RuntimeException: java.net.ConnectException: Connection refused: connect at com.sun.enterprise.iiop.IIOPSSLSocketFactory.createSocket(IIOPSSLSocketFactory.java:347) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:244) ... 14 more Caused by: java.net.ConnectException: Connection refused: connect at sun.nio.ch.Net.connect(Native Method) at sun.nio.ch.SocketChannelImpl.connect(SocketChannelImpl.java:532) at com.sun.corba.ee.impl.orbutil.ORBUtility.openSocketChannel(ORBUtility.java:105) at com.sun.enterprise.iiop.IIOPSSLSocketFactory.createSocket(IIOPSSLSocketFactory.java:332) ... 15 more It's o.k. for now (while I'm still in development) that it bombs, but it does this repeatedly and the catch clause is never reached (even though I'm catching Throwable) - the message is not printed. So how can I handle connection errors during lookup in my program?

  Read the article

• vb6 ADODB TSQL procedure call quit working after database migration

  - by phill

  This code was once working on sql server 2005. Now isolated in a visual basic 6 sub routine using ADODB to connect to a sql server 2008 database it throws an error saying: "Login failed for user 'admin' " I have since verified the connection string does work if i replace the body of this sub with the alternative code below this sub. When I run the small program with the button, it stops where it is marked below the asterisk line. Any ideas? thanks in advance. Private Sub Command1_Click() Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset Dim dStartDateIn As Date dStartDateIn = "2010/05/01" cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" 'On Error GoTo GetUnconvertedInvoices_Err With cmdGetInvoices .CommandType = adCmdStoredProc .CommandText = "_sp_cwm5_GetUnCvtdInv" .Name = "_sp_cwm5_GetUnCvtdInv" Set oParm1 = .CreateParameter("@StartDate", adDate, adParamInput) .Parameters.Append oParm1 oParm1.Value = dStartDateIn .ActiveConnection = cSQLConn End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic .CursorType = adOpenKeyset '.CursorType = adOpenStatic .CacheSize = 5000 '***************************Debug stops here .Open cmdGetInvoices End With If myRs.State = adStateOpen Then Set GetUnconvertedInvoices = myRs Else Set GetUnconvertedInvoices = Nothing End If End Sub Here is the code which validates the connection string is working. Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" With cmdGetInvoices .ActiveConnection = cSQLConn .CommandText = "SELECT top 5 * FROM tarInvoice;" .CommandType = adCmdText End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic '.CursorType = adOpenKeyset .CursorType = adOpenStatic '.CacheSize = 5000 .Open cmdGetInvoices End With If myRs.EOF = False Then myRs.MoveFirst Do MsgBox "Record " & myRs.AbsolutePosition & " " & _ myRs.Fields(0).Name & "=" & myRs.Fields(0) & " " & _ myRs.Fields(1).Name & "=" & myRs.Fields(1) myRs.MoveNext Loop Until myRs.EOF = True End If

  Read the article

• What makes a Winform position initially stale?

  - by msorens

  The code below demonstrates a very simple problem; I am hoping that I am just missing a setting that someone might be able to reveal. Goal (1) Launch main winform (MainForm). (2) Press button to display secondary winform (ShadowForm) that is semi-transparent and should exactly overlay MainForm. What Actually Happens Scenario 1: Launch main winform then press button: ShadowForm displays with correct size but incorrect location, lower and to the right (as if it was cascaded). Press button to close ShadowForm again. Press button once more to reopen ShadowForm and now it is in the correct position, covering MainForm. Scenario 2: Launch main winform, move it around, then press button: ShadowForm displays with correct size but incorrect location (where the MainForm was before moving it). Press button to close; press again to reopen and now ShadowForm is in the correct position. using System; using System.Windows.Forms; namespace LocationTest { static class Program { static void Main() { Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new MainForm()); } } public class MainForm : Form { ShadowForm shadowForm = new ShadowForm(); Button button1 = new Button(); System.ComponentModel.IContainer components = null; public MainForm() { this.SuspendLayout(); this.button1.Location = new System.Drawing.Point(102, 44); this.button1.Size = new System.Drawing.Size(75, 23); this.button1.Text = "button1"; this.button1.Click += new System.EventHandler(this.button1_Click); this.ClientSize = new System.Drawing.Size(292, 266); this.Controls.Add(this.button1); this.ResumeLayout(false); } private void button1_Click(object sender, EventArgs e) { if (shadowForm.Visible) { shadowForm.Hide(); } else { shadowForm.Size = Size; // this always works shadowForm.Location = Location; // this fails first time, but works second time! shadowForm.Show(); } } protected override void Dispose(bool disposing) { if (disposing && (components != null)) { components.Dispose(); } base.Dispose(disposing); } } public class ShadowForm : Form { private System.ComponentModel.IContainer components = null; public ShadowForm() { this.SuspendLayout(); this.BackColor = System.Drawing.Color.Black; this.FormBorderStyle = System.Windows.Forms.FormBorderStyle.None; this.Opacity = 0.5; this.Click += new System.EventHandler(this.ShadowForm_Click); this.ResumeLayout(false); } private void ShadowForm_Click(object sender, EventArgs e) { Hide(); } protected override void Dispose(bool disposing) { if (disposing && (components != null)) { components.Dispose(); } base.Dispose(disposing); } } }

  Read the article

• Solving a cyclical dependency in Ninject (Compact Framework)

  - by Alex

  I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

  Read the article

• Rewriting Live TCP/IP (Layer 4) (i.e. Socket Layer) Streams

  - by user213060

  I have a simple problem which I'm sure someone here has done before... I want to rewrite Layer 4 TCP/IP streams (Not lower layer individual packets or frames.) Ettercap's etterfilter command lets you perform simple live replacements of Layer 4 TCP/IP streams based on fixed strings or regexes. Example ettercap scripting code: if (ip.proto == TCP && tcp.dst == 80) { if (search(DATA.data, "gzip")) { replace("gzip", " "); msg("whited out gzip\n"); } } if (ip.proto == TCP && tcp.dst == 80) { if (search(DATA.data, "deflate")) { replace("deflate", " "); msg("whited out deflate\n"); } } http://ettercap.sourceforge.net/forum/viewtopic.php?t=2833 I would like to rewrite streams based on my own filter program instead of just simple string replacements. Anyone have an idea of how to do this? Is there anything other than Ettercap that can do live replacement like this, maybe as a plugin to a VPN software or something? I would like to have a configuration similar to ettercap's silent bridged sniffing configuration between two Ethernet interfaces. This way I can silently filter traffic coming from either direction with no NATing problems. Note that my filter is an application that acts as a pipe filter, similar to the design of unix command-line filters: >[eth0] <----------> [my filter] <----------> [eth1]< What I am already aware of, but are not suitable: Tun/Tap - Works at the lower packet layer, I need to work with the higher layer streams. Ettercap - I can't find any way to do replacements other than the restricted capabilities in the example above. Hooking into some VPN software? - I just can't figure out which or exactly how. libnetfilter_queue - Works with lower layer packets, not TCP/IP streams. Again, the rewriting should occur at the transport layer (Layer 4) as it does in this example, instead of a lower layer packet-based approach. Exact code will help immensely! Thanks!

  Read the article

• Is it Bad Practice to use C++ only for the STL containers?

  - by gmatt

  First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

  Read the article

• Help with bugs in a C code

  - by Yanki Twizzy

  This C code is giving me some unpredictable results. The program is meant to collect 6 nos and print out the max, position of the max no and the average. It's supposed to have only 3 functions - input, max_avr_pos and output for doing what the code is supposed to do but I am getting unpredictable results. Please what could be the problem #include <stdio.h> #include <stdlib.h> #include <conio.h> void input_vals(int arrnum[]); void max_ave_val(int arrnum1[],double *average,int *maxval,int *position); void print_output(double *average1,int *maxval1,int *position1); int main(void) { int arrnum[6],maxval2,position2; double average2; input_vals(arrnum); max_ave_val(arrnum,&average2,&maxval2,&position2); print_output(&average2,&maxval2,&position2); _getche(); return 0; } void input_vals(int arrnum[]) { int count; printf("\n Please enter six numbers\n"); for(count=0;count<6;count++) { scanf("%d",&arrnum[count]); } } void max_ave_val(int arrnum1[],double *average,int *maxval,int *position) { int total=0; int cnt,cnt1,cnt2,limit,maxval2,post; limit=6; /* finding the max value*/ for(cnt=0;cnt<limit-1;cnt++) for(cnt1=limit-1;cnt1>cnt;--cnt1) { if(arrnum1[cnt1-1]>arrnum1[cnt1]) { maxval2=arrnum1[cnt-1]; post=(cnt-1)+1; } else { maxval2=arrnum1[cnt1]; post=cnt1+1; } } *maxval=maxval2; *position=post; /* solving for total */ for(cnt2=0;cnt2<limit;cnt2++); { total=total+arrnum1[cnt2]; } *average=total/limit; } void print_output(double *average1,int *maxval1,int *position1) { printf("\n value of the highest of the numbers is %d\n",*maxval1); printf("\n the average of all the numbers is %g\n",*average1); printf("\n the postion of the highest number in the list is %d\n",*position1); }

  Read the article

• Delphi - Read File To StringList, then delete and write back to file.

  - by Jkraw90

  I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

  Read the article

• WPF multibound textblock not updating

  - by Superstringcheese

  I want to create a program which calculates how long it will take to repeat a process a certain number of times. I've scaled this down a lot for this example. So, I have some textboxes which are bound to properties in a class: Count: <TextBox x:Name="txtCount" Text="{Binding Count, Mode=TwoWay}" Width="50"/> Days: <TextBox x:Name="txtDays" Text="{Binding Days, Mode=TwoWay}" Width="50"/> and a textblock which is multibound like so: <TextBlock x:Name="tbkTotal"> <TextBlock.Text> <MultiBinding StringFormat="Days: {0}, Count: {1}"> <Binding Path="Days" /> /* This isn't updating */ <Binding Path="Count" /> </MultiBinding> </TextBlock.Text> </TextBlock> My DataContext is set in the Window1.xaml.cs file. public Window1() { InitializeComponent(); Sample sample = new Sample(); this.DataContext = sample; } I can update the multibound textblock with the Count property just fine, but the Days property always shows 0, even though the Days input accurately reflects changes. I believe that this is because my accessors are different for Days - namely, the Set method. This class is in a different file. public class Sample : INotifyPropertyChanged { private int _count; private TimeSpan _span; public int Count { get { return _count; } set { _count = value; NotifyPropertyChanged("Count"); /* Doesn't seem to be needed, actually */ } } public TimeSpan Span { get { return _span; } } /* The idea is to provide a property for Days, Hours, Minutes, etc. as conveniences to the inputter */ public double Days { get { return _span.Days; } set { TimeSpan ts = new TimeSpan(); double val = value > 0 ? value : 0; ts = TimeSpan.FromDays(val); _span.Add(ts); NotifyPropertyChanged("Span"); /* Here I can only get it to work if I notify that Span has changed - doesn't seem to be aware that the value behind Days has changed. */ } } private void NotifyPropertyChanged(string property) { if (null != this.PropertyChanged) { PropertyChanged(this, new PropertyChangedEventArgs(property)); } } public Sample() { _count = 0; _span = new TimeSpan(); } public event PropertyChangedEventHandler PropertyChanged; }

  Read the article

• TimeOuts with HttpWebRequest when running Selenium concurrently in .NET

  - by domsom

  I have a download worker that uses ThreadPool-threads to download files. After enhancing these to apply some Selenium tests to the downloaded files, I am constantly experiencing TimeOut-exceptions with the file downloaders and delays running the Selenium tests. More precisely: When the program starts, the download threads start downloading and a couple of pages are seamlessly processed via Selenium Shortly after, the first download threads start throwing TimeOut exceptions from HttpWebRequest. At the same time, commands stop flowing to Selenium (as observed in the SeleniumRC log), but the thread running Selenium is not getting any exception This situation holds as long as there are entries in the download list: new download threads are being started and terminate after receiving TimeOuts (without trying to lock Selenium) As soon as no more download threads are being started, Selenium starts receiving commands again and the threads waiting for the lock are processed sequentially as designed Now here's the download code: HttpWebRequest request = null; WebResponse response = null; Stream stream = null; StreamReader sr = null; try { request = (HttpWebRequest) WebRequest.Create(uri); request.ServicePoint.ConnectionLimit = MAX_CONNECTIONS_PER_HOST; response = request.GetResponse(); stream = response.GetResponseStream(); // Read the stream... } finally { if (request != null) request.Abort(); if (response != null) response.Close(); if (stream != null) { stream.Close(); stream.Dispose(); } if (sr != null) { sr.Close(); sr.Dispose(); } } And this is how Selenium is used afterwards in the same thread: lock(SeleniumLock) { selenium.Open(url); // Run some Selenium commands, but no selenium.stop() } Where selenium is a static variable that is initialized in the static constructor of the class (via selenium.start()). I assume I am running into the CLR connection limit, so I added these lines during initalization: ThreadPool.GetMaxThreads (out maxWorkerThreads, out maxCompletionPortThreads); HttpUtility.MAX_CONNECTIONS_PER_HOST = maxWorkerThreads; System.Net.ServicePointManager.DefaultConnectionLimit = maxWorkerThreads + 1; The + 1 is for the connection to the SeleniumRC, due to my guess that the Selenium client code also uses HttpWebRequest. It seems like I'm still running into some kind of deadlock - although the threads waiting for the Selenium lock do not hold any resources. Any ideas on how to get this working?

  Read the article

• Unable to read data from the transport connection: the connection was closed

  - by webdreamer

  The exception is Remoting Exception - Authentication Failure. The detailed message says "Unable to read data from the transport connection: the connection was closed." I'm having trouble with creating two simple servers that can comunicate as remote objects in C#. ServerInfo is just a class I created that holds the IP and Port and can give back the address. It works fine, as I used it before, and I've debugged it. Also the server is starting just fine, no exception is thrown, and the channel is registered without problems. I'm using Forms to do the interfaces, and call some of the methods on the server, but didn't find any problems in passing the parameters from the FormsApplication to the server when debugging. All seems fine in that chapter. public ChordServerProgram() { RemotingServices.Marshal(this, "PADIBook"); nodeInt = 0; } public void startServer() { try { serverChannel = new TcpChannel(serverInfo.Port); ChannelServices.RegisterChannel(serverChannel, true); } catch (Exception e) { Console.WriteLine(e.ToString()); } } I run two instances of this program. Then startNode is called on one of the instances of the application. The port is fine, the address generated is fine as well. As you can see, I'm using the IP for localhost, since this server is just for testing purposes. public void startNode(String portStr) { IPAddress address = IPAddress.Parse("127.0.0.1"); Int32 port = Int32.Parse(portStr); serverInfo = new ServerInfo(address, port); startServer(); //node = new ChordNode(serverInfo,this); } Then, in the other istance, through the interface again, I call another startNode method, giving it a seed server to get information from. This is where it goes wrong. When it calls the method on the seedServer proxy it just got, a RemotingException is thrown, due to an authentication failure. (The parameter I'll want to get is the node, I'm just using the int to make sure the ChordNode class has nothing to do with this error.) public void startNode(String portStr, String seedStr) { IPAddress address = IPAddress.Parse("127.0.0.1"); Int32 port = Int32.Parse(portStr); serverInfo = new ServerInfo(address, port); IPAddress addressSeed = IPAddress.Parse("127.0.0.1"); Int32 portSeed = Int32.Parse(seedStr); ServerInfo seedInfo = new ServerInfo(addressSeed, portSeed); startServer(); ChordServerProgram seedServer = (ChordServerProgram)Activator.GetObject(typeof(ChordServerProgram), seedInfo.GetFullAddress()); // node = new ChordNode(serverInfo,this); int seedNode = seedServer.nodeInt; // node.chordJoin(seedNode.self); }

  Read the article

• Ideas on implementing threads and cross process communication. - C

  - by Jamie Keeling

  Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occured. I have already implemented a thread on the first process which currently creates the data to send to the second process and makes it available to the second process. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. Following is a small snippet of what I have so far in the producer application; Rolling the dice and sending the data: case IDM_FILE_ROLLDICE: { hDiceRoll = CreateThread( NULL, // lpThreadAttributes (default) 0, // dwStackSize (default) ThreadFunc(hMainWindow), // lpStartAddress NULL, // lpParameter 0, // dwCreationFlags &hDiceID // lpThreadId (returned by function) ); } break; The data being sent to the other process: DWORD WINAPI ThreadFunc(LPVOID passedHandle) { HANDLE hMainHandle = *((HANDLE*)passedHandle); WCHAR buffer[256]; LPCTSTR pBuf; LPVOID lpMsgBuf; LPVOID lpDisplayBuf; struct diceData storage; HANDLE hMapFile; DWORD dw; //Roll dice and store results in variable storage = RollDice(); hMapFile = CreateFileMapping( (HANDLE)0xFFFFFFFF, // use paging file NULL, // default security PAGE_READWRITE, // read/write access 0, // maximum object size (high-order DWORD) BUF_SIZE, // maximum object size (low-order DWORD) szName); // name of mapping object if (hMapFile == NULL) { dw = GetLastError(); MessageBox(hMainHandle,L"Could not create file mapping object",L"Error",MB_OK); return 1; } pBuf = (LPTSTR) MapViewOfFile(hMapFile, // handle to map object FILE_MAP_ALL_ACCESS, // read/write permission 0, 0, BUF_SIZE); if (pBuf == NULL) { MessageBox(hMainHandle,L"Could not map view of file",L"Error",MB_OK); CloseHandle(hMapFile); return 1; } CopyMemory((PVOID)pBuf, &storage, (_tcslen(szMsg) * sizeof(TCHAR))); //_getch(); MessageBox(hMainHandle,L"Completed!",L"Success",MB_OK); UnmapViewOfFile(pBuf); return 0; } I'd like to think I am at least on the right lines, although for some reason when the application finishes creating the thread it hits the return DefWindowProc(hMainWindow, message, wParam, lParam); it crashes saying there's no more source code for the current location. I know there are certain ways to implement things but as I've mentioned I'm not sure if i'm doing this the right way, has anybody else tried to do the same thing? Thanks!

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Can sorting Japanese kanji words be done programatically?

  - by Mason

  I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

  Read the article

• Memory leaks getting sub-images from video (cvGetSubRect)

  - by dnul

  Hi, i'm trying to do video windowing that is: show all frames from a video and also some sub-image from each frame. This sub-image can change size and be taken from a different position of the original frame. So , the code i've written does basically this: cvQueryFrame to get a new image from the video Create a new IplImage (img) with sub-image dimensions ( window.height,window.width) Create a new Cvmat (mat) with sub-image dimensions ( window.height,window.width) CvGetSubRect(originalImage,mat,window) seizes the sub-image transform Mat (cvMat) to img (IplImage) using cvGetImage my problem is that for each frame i create new IplImage and cvMat which take a lot of memory and when i try to free the allocated memory I get a segmentation fault or in the case of the CvMat the allocated space does not get free (valgrind keeps telling me its definetly lost space). the following code does it: int main(void){ CvCapture* capture; CvRect window; CvMat * tmp; //window size window.x=0;window.y=0;window.height=100;window.width=100; IplImage * src=NULL,*bk=NULL,* sub=NULL; capture=cvCreateFileCapture( "somevideo.wmv"); while((src=cvQueryFrame(capture))!=NULL){ cvShowImage("common",src); //get sub-image sub=cvCreateImage(cvSize(window.height,window.width),8,3); tmp =cvCreateMat(window.height, window.width,CV_8UC1); cvGetSubRect(src, tmp , window); sub=cvGetImage(tmp, sub); cvShowImage("Window",sub); //free space if(bk!=NULL) cvReleaseImage(&bk); bk=sub; cvReleaseMat(&tmp); cvWaitKey(20); //window dimensions changes window.width++; window.height++; } } cvReleaseMat(&tmp); does not seem to have any effect on the total amount of lost memory, valgrind reports the same amount of "definetly lost" memory if i comment or uncomment this line. cvReleaseImage(&bk); produces a segmentation fault. notice i'm trying to free the previous sub-frame which i'm backing up in the bk variable. If i comment this line the program runs smoothly but with lots of memory leaks I really need to get rid of memory leaks, can anyone explain me how to correct this or even better how to correctly perform image windowing? Thank you

  Read the article

• Implementing Object Oriented: ansi-C approach

  - by No Money

  Hey there, I am an Intermediate programmer in Java and know some of the basics in C++. I recently started to scam over "C language" [please note that i emphasized on C language and want to stick with C as i found it to be a perfect tool, so no need for suggestions focusing on why should i move back to C++ or Java or any other crappy language (e.g: C#)]. Moving on, I code an Object Oriented approach in C but kindda scramble with the pointers part. Please understand that I am just a noob trying to extend my knowledge beyond what i learned in High School. Here is my code..... #include <stdio.h> typedef struct per{ int privateint; char *privateString; struct per (*New) (); void (*deleteperOBJ) (struct t_person *); void (*setperNumber) ((struct*) t_person,int); void (*setperString) ((struct*) t_person,char *); void (*dumpperState) ((struct*) t_person); }t_person; void setperNumber(t_person *const per,int num){ if(per==NULL) return; per->privateint=num; } void setperString(t_person *const per,char *string){ if(per==NULL) return; per->privateString=string; } void dumpperState(t_person *const per){ if(per==NULL) return; printf("value of private int==%d\n", per->privateint); printf("value of private string==%s\n", per->privateString); } void deleteperOBJ(struct t_person *const per){ free((void*)t_person->per); t_person ->per = NULL; } main(){ t_person *const per = (struct*) malloc(sizeof(t_person)); per = t_person -> struct per -> New(); per -> setperNumber (t_person *per, 123); per -> setperString(t_person *per, "No money"); dumpperState(t_person *per); deleteperOBJ(t_person *per); } Just to warn you, this program has several errors and since I am a beginner I couldn't help except to post this thread as a question. I am looking forward for assistance. Thanks in advance.

  Read the article

• how do i know how many clients are calling my WCF service function

  - by ZhengZhiren

  i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

  Read the article

• Remote Postgresql - extremely slow

  - by Muffinbubble

  Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

  Read the article

• How to get a physics engine like Nape working?

  - by Glacius

  Introduction: I think Nape is a relatively new engine so some of you may not know it. It's supposedly faster than box2d and I like that there is decent documentation. Here's the site: http://code.google.com/p/nape/ I'm relatively new to programming. I am decent at AS3's basic functionality, but every time I try to implement some kind of engine or framework I can't even seem to get it to work. With Nape I feel I got a little further than before but I still got stuck. My problem: I'm using Adobe CS5, I managed to import the SWC file like described here. Next I tried to copy the source of one of the demo's like this one and get it to work but I keep getting errors. I made a new class file, copied the demo source to it, and tried to add it to the stage. My stage code basically looks like this: import flash.Boot; // these 2 lines are as described in the tutorial new Boot(); var demo = new Main(); // these 2 are me guessing what I'm supposed to do addChild(demo); Well, it seems the source code is not even being recognized by flash as a valid class file. I tried editing it, but even if I get it recognized (give a package name and add curly brackets) but I still get a bunch of errors. Is it psuedo code or something? What is going on? My goal: I can imagine I'm going about this the wrong way. So let me explain what I'm trying to achieve. I basically want to learn how to use the engine by starting from a simple basic example that I can edit and mess around with. If I can't even get a working example then I'm unable to learn anything. Preferably I don't want to start using something like FlashDevelop (as I'd have to learn how to use the program) but if it can't be helped then I can give it a try. Thank you.

  Read the article

• urgent..haskell mini interpreter

  - by mohamed elshikh

  i'm asked to implement this project and i have problems in part b which is the eval function this is the full describtion of the project You are required to implement an interpreter for mini-Haskell language. An interpreter is dened in Wikipedia as a computer program that executes, i.e. performs, instructions written in a programming language. The interpreter should be able to evaluate functions written in a special notation, which you will dene. A function is dened by: Function name Input Parameters : dened as a list of variables. The body of the function. The body of the function can be any of the following statements: a) Variable: The function may return any of the input variables. b) Arithmetic Expressions: The arithmetic expressions include input variables and addition, sub- traction, multiplication, division and modulus operations on arithmetic expressions. c) Boolean Expressions: The Boolean expressions include the ordering of arithmetic expressions (applying the relationships: <, =<, , = or =) and the anding, oring and negation of Boolean expressions. d) If-then-else statements: where the if keyword is followed by a Boolean expression. The then and else parts may be followed by any of the statements described here. e) Guarded expressions: where each case consists of a boolean expression and any of the statements described here. The expression consists of any number of cases. The rst case whose condition is true, its body should be evaluated. The guarded expression has to terminate with an otherwise case. f) Function calls: the body of the function may have a call to another function. Note that all inputs passed to the function will be of type Int. The output of the function can be of type Int or Bool. To implement the interpreter, you are required to implement the following: a) Dene a datatype for the following expressions: Variables Arithmetic expressions Boolean expressions If-then-else statements Guarded expressions Functions b) Implement the function eval which evaluates a function. It takes 3 inputs: The name of a function to be evaluated represented as a string. A list of inputs to that function. The arguments will always be of datatype Int. A list of functions. Each function is represented as instance of the datatype that you have created for functions. c) Implement the function get_type that returns the type of the function (as a string). The input to this function is the same as in part b. here is what i've done data Variable = v(char) data Arth= va Variable | Add Arth Arth | Sub Arth Arth | Times Arth Arth | Divide Arth Arth data Bol= Great Arth Arth | Small Arth Arth | Geq Arth Arth | Seq Arth Arth | And Bol Bol | Or Bol Bol | Neg Bol data Cond = data Guard = data Fun =cons String [Variable] Body data Body= bodycons(String) |Bol |Cond |Guard |Arth

  Read the article

• Import? Initialize? what do to?

  - by Jeremy B

  I'm working on homework and I'm close but I am having an issue. I just learned how to work with packages in eclipse so I have a class that is importing another class from a package (I think I said that right) The main prompts the user to enter an integer between -100 and 100 and I am having an issue with validating it. I know the issue is where I'm importing I'm just unsure the direction I need to go to fix it. This is a section of my main code. (my issue starts with the last couple lines if you want to skip ahead) import myUtils.util.Console; public class ConsoleTestApp { public static void main(String args[]) { // create the Console object Console c = new Console(); // display a welcome message c.println("Welcome to the Console Tester application"); c.println(); // int c.println("Int Test"); int i = c.getIntWithinRange("Enter an integer between -100 and 100: ", -101, 101); c.println(); I have a class called Console that is located in another package that I believe I have properly imported. here is the code I am stuck on in my console class. public int getIntWithinRange(String prompt, int min, int max) { int i = 0; boolean isValid = false; while (isValid == false) { System.out.println(prompt); if (sc.hasNextInt()) { //if user chooses menu option less than 1 the program will print an error message i = sc.nextInt(); if (i < min) { System.out.println("Error! Please enter an int greater than -100"); } else if (i > max) { System.out.println("Error! Please enter an int less than 100"); } else isValid = true; } else System.out.println("Error! Invalid number value"); sc.nextLine(); } // return the int return i; } when I run this I keep getting my last print which is an invalid number value. am I not importing the code from the main method in the other console properly?

  Read the article

• grdb not working variables

  - by stupid_idiot

  hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

  Read the article

• C++ DLL creation for C# project - No functions exported

  - by Yeti

  I am working on a project that requires some image processing. The front end of the program is C# (cause the guys thought it is a lot simpler to make the UI in it). However, as the image processing part needs a lot of CPU juice I am making this part in C++. The idea is to link it to the C# project and just call a function from a DLL to make the image processing part and allow to the C# environment to process the data afterwards. Now the only problem is that it seems I am not able to make the DLL. Simply put the compiler refuses to put any function into the DLL that I compile. Because the project requires some development time testing I have created two projects into a C++ solution. One is for the Dll and another console application. The console project holds all the files and I just include the corresponding header into my DLL project file. I thought the compiler should take out the functions that I marked as to be exported and make the DLL from them. Nevertheless this does not happens. Here it is how I defined the function in the header: extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck); extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI, CvScalar &refHSVColorLow, CvScalar &refHSVColorHi ); Followed by the implementation in the cpp file: extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI,&refHSVColorLow, CvScalar &refHSVColorHi ) { \\... return cvPoint((int)( M10/M00) + imgROI.x, (int)( M01/M00 ) + imgROI.y) ;} extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck) { \\ ...}; And my main file for the DLL project looks like: #ifdef _MANAGED #pragma managed(push, off) #endif /// <summary> Include files. </summary> #include "..\ImageProcessingDebug\ImageProcessingTest.h" #include "..\ImageProcessingDebug\ImageProcessing.h" BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { return TRUE; } #ifdef _MANAGED #pragma managed(pop) #endif Needless to say it does not work. A quick look with DLL export viewer 1.36 reveals that no function is inside the library. I don't get it. What I am doing wrong ? As side not I am using the C++ objects (and here it is the C++ DLL part) such as the vector. However, only for internal usage. These will not appear in the headers of either function as you can observe from the previous code snippets. Any ideas? Thx, Bernat

  Read the article

• C# MultiThread Safe Class Design

  - by Robert

  I'm trying to designing a class and I'm having issues with accessing some of the nested fields and I have some concerns with how multithread safe the whole design is. I would like to know if anyone has a better idea of how this should be designed or if any changes that should be made? using System; using System.Collections; namespace SystemClass { public class Program { static void Main(string[] args) { System system = new System(); //Seems like an awkward way to access all the members dynamic deviceInstance = (((DeviceType)((DeviceGroup)system.deviceGroups[0]).deviceTypes[0]).deviceInstances[0]); Boolean checkLocked = deviceInstance.locked; //Seems like this method for accessing fields might have problems with multithreading foreach (DeviceGroup dg in system.deviceGroups) { foreach (DeviceType dt in dg.deviceTypes) { foreach (dynamic di in dt.deviceInstances) { checkLocked = di.locked; } } } } } public class System { public ArrayList deviceGroups = new ArrayList(); public System() { //API called to get names of all the DeviceGroups deviceGroups.Add(new DeviceGroup("Motherboard")); } } public class DeviceGroup { public ArrayList deviceTypes = new ArrayList(); public DeviceGroup() {} public DeviceGroup(string deviceGroupName) { //API called to get names of all the Devicetypes deviceTypes.Add(new DeviceType("Keyboard")); deviceTypes.Add(new DeviceType("Mouse")); } } public class DeviceType { public ArrayList deviceInstances = new ArrayList(); public bool deviceConnected; public DeviceType() {} public DeviceType(string DeviceType) { //API called to get hardwareIDs of all the device instances deviceInstances.Add(new Mouse("0001")); deviceInstances.Add(new Keyboard("0003")); deviceInstances.Add(new Keyboard("0004")); //Start thread CheckConnection that updates deviceConnected periodically } public void CheckConnection() { //API call to check connection and returns true this.deviceConnected = true; } } public class Keyboard { public string hardwareAddress; public bool keypress; public bool deviceConnected; public Keyboard() {} public Keyboard(string hardwareAddress) { this.hardwareAddress = hardwareAddress; //Start thread to update deviceConnected periodically } public void CheckKeyPress() { //if API returns true this.keypress = true; } } public class Mouse { public string hardwareAddress; public bool click; public Mouse() {} public Mouse(string hardwareAddress) { this.hardwareAddress = hardwareAddress; } public void CheckClick() { //if API returns true this.click = true; } } }

  Read the article

• Refactoring Singleton Overuse

  - by drharris

  Today I had an epiphany, and it was that I was doing everything wrong. Some history: I inherited a C# application, which was really just a collection of static methods, a completely procedural mess of C# code. I refactored this the best I knew at the time, bringing in lots of post-college OOP knowledge. To make a long story short, many of the entities in code have turned out to be Singletons. Today I realized I needed 3 new classes, which would each follow the same Singleton pattern to match the rest of the software. If I keep tumbling down this slippery slope, eventually every class in my application will be Singleton, which will really be no logically different from the original group of static methods. I need help on rethinking this. I know about Dependency Injection, and that would generally be the strategy to use in breaking the Singleton curse. However, I have a few specific questions related to this refactoring, and all about best practices for doing so. How acceptable is the use of static variables to encapsulate configuration information? I have a brain block on using static, and I think it is due to an early OO class in college where the professor said static was bad. But, should I have to reconfigure the class every time I access it? When accessing hardware, is it ok to leave a static pointer to the addresses and variables needed, or should I continually perform Open() and Close() operations? Right now I have a single method acting as the controller. Specifically, I continually poll several external instruments (via hardware drivers) for data. Should this type of controller be the way to go, or should I spawn separate threads for each instrument at the program's startup? If the latter, how do I make this object oriented? Should I create classes called InstrumentAListener and InstrumentBListener? Or is there some standard way to approach this? Is there a better way to do global configuration? Right now I simply have Configuration.Instance.Foo sprinkled liberally throughout the code. Almost every class uses it, so perhaps keeping it as a Singleton makes sense. Any thoughts? A lot of my classes are things like SerialPortWriter or DataFileWriter, which must sit around waiting for this data to stream in. Since they are active the entire time, how should I arrange these in order to listen for the events generated when data comes in? Any other resources, books, or comments about how to get away from Singletons and other pattern overuse would be helpful.

  Read the article

< Previous Page | 827 828 829 830 831 832 833 834 835 836 837 838  | Next Page >