Search Results

Search found 25660 results on 1027 pages for 'booting issue'.

Page 837/1027 | < Previous Page | 833 834 835 836 837 838 839 840 841 842 843 844  | Next Page >

• vestal_versions : problem with column named changes

  - by arkannia

  Hi, I am working with vestal version for 2 months. Everything was fine until this afternoon. I didn't done anything special(or i don't remembered...) but the code works fine on others computers... The problem is that i'm not able to save my model anymore: rails give me this error : ActiveRecord::DangerousAttributeError: changes is defined by ActiveRecord changes field is by default an activerecord method. With the console, the message is the next : ActiveRecord::DangerousAttributeError: changes is defined by ActiveRecord Here are my local gem files: abstract (1.0.0) actionmailer (3.0.0.beta3) actionpack (3.0.0.beta3) activemodel (3.0.0.beta3) activerecord (3.0.0.beta3) activeresource (3.0.0.beta3) activesupport (3.0.0.beta3) arel (0.3.3) builder (2.1.2) bundler (0.9.25, 0.9.24) crack (0.1.7) erubis (2.6.5) god (0.9.0) haml (3.0.1, 2.2.23) i18n (0.3.7) mail (2.2.0) memcache-client (1.8.3) memcached (0.17.7) mime-types (1.16) polyglot (0.3.1) rack (1.1.0) rack-mount (0.6.3) rack-test (0.5.3) rails (3.0.0.beta3) railties (3.0.0.beta3) rake (0.8.7) savon (0.7.8, 0.7.6) text-format (1.0.0) text-hyphen (1.0.0) thor (0.13.6, 0.13.4) treetop (1.4.5) tzinfo (0.3.20) And here my Gemfile source 'http://gemcutter.org' gem "rails", "3.0.0.beta3" gem "will_paginate", "3.0.pre" #gem 'nokogiri' #gem 'curb' #gem 'handsoap' gem 'savon' gem 'mysql' gem 'haml', '2.2.23' #gem 'haml', '3.0.1' gem 'hpricot' gem 'i18n', '> 0.3.5' gem 'i18n_routing' gem 'i18n_auto_scoping' gem 'handler301', :git => 'http://github.com/kwi/handler301.git' gem 'seo_meta_builder' gem 'vestal_versions' #gem 'paperclip', :git => 'git://github.com/thoughtbot/paperclip.git', :branch => 'rails3' ## Bundle edge rails: gem "rails", :git => "git://github.com/rails/rails.git" ## Bundle the gems you use: # gem "bj" # gem "hpricot", "0.6" # gem "sqlite3-ruby", :require => "sqlite3" # gem "aws-s3", :require => "aws/s3" ## Bundle gems used only in certain environments: # gem "rspec", :group => :test # group :test do # gem "webrat" # end If you have any suggestions to solve this issue, i'll be glad to hear them ! Thanks

  Read the article

• Problems with jQuery load and getJSON only when using Chrome

  - by leftend

  I'm having an issue with two jQuery calls. The first is a "load" that retrieves HTML and displays it on the page (it does include some Javascript and CSS in the code that is returned). The second is a "getJSON" that returns JSON - the JSON returned is valid. Everything works fine in every other browser I've tried - except Chrome for either Windows or Mac. The page in question is here: http://urbanistguide.com/category/Contemporary.aspx When you click on a Restaurant name in IE/FF, you should see that item expand with more info - and a map displayed to the right. However, if you do this in Chrome all you get is the JSON data printed to the screen. The first problem spot is when the "load" function is called here: var fulllisting = top.find(".listingfull"); fulllisting.load(href2, function() { fulllisting.append("<div style=\"width:99%;margin-top:10px;text-align:right;\"><a href=\"#\" class=\"" + obj.attr("id") + "\">X</a>"); itemId = fulllisting.find("a.listinglink").attr("id"); ... In the above code, the callback function doesn't seem to get invoked. The second problem spot is when the "getJSON" function is called: $.getJSON(href, function(data) { if (data.error.length > 0) { //display error message } else { ... } In this case - it just seems to follow the link instead of performing the callback... and yes, I am doing a "return false;" at the end of all of this to prevent the link from executing. All of the rest of the code is inline on that page if you want to view the source code. Any ideas?? Thanks

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• How to effectively use WorkbookBeforeClose event correctly?

  - by Ahmad

  On a daily basis, a person needs to check that specific workbooks have been correctly updated with Bloomberg and Reuters market data ie. all data has pulled through and that the 'numbers look correct'. In the past, people were not checking the 'numbers' which led to inaccurate uploads to other systems etc. The idea is that 'something' needs to be developed to prevent the use from closing/saving the workbook unless he/she has checked that the updates are correct/accurate. The numbers look correct action is purely an intuitive exercise, thus will not be coded in any way. The simple solution was to prompt users prior to closing the specific workbook to verify that the data has been checked. Using VSTO SE for Excel 2007, an Add-in was created which hooks into the WorkbookBeforeClose event which is initialised in the add-in ThisAddIn_Startup private void wb_BeforeClose(Xl.Workbook wb, ref bool cancel) { //.... snip ... if (list.Contains(wb.Name)) { DailogResult result = MessageBox.Show("some message", "sometitle", MessageBoxButtons.YesNo); if (result != DialogResult.Yes) { cancel = true; // i think this prevents the whole application from closing } } } I have found the following ThisApplication.WorkbookBeforeSave vs ThisWorkbook.Application.WorkbookBeforeSave which recommends that one should use the ThisApplication.WorkbookBeforeClose event which I think is what I am doing since will span all files opened. The issue I have with the approach is that assuming that I have several files open, some of which are in my list, the event prevents Excel from closing all files sequentially. It now requires each file to be closed individually. Am I using the event correctly and is this effective & efficient use of the event? Should I use the Application level event or document level event? Is there a way to prevent the above behaviour? Any other suggestions are welcomed VS 2005 with VSTO SE

  Read the article

• Broken flash movie player! allowFullScreen does not work with anything other than a wmode value of "

  - by lhnz

  I have a flash player on a page which plays videos. I also have modal popups which need to be able to display over the top of the flash player when they are opened, etc... I can't change either of these requirements since they are part of the spec I have been given. Flash seems to ignore z-indexes I set on it with css, and the modal popups will therefore only appear above the video player if I set the video player's wmode to opaque or transparent. However, if I do this then the full screen functionality stops working correctly: when I un-fullscreen the video it stays zoomed in. In short If you open a popup on an item page or another page containing flash the popup should be displayed above this. Flash ignores z-index values. You can stop flash ignoring z-index values by setting wmode to opaque or transparent rather than the default: window. This stops full screen from working correctly. Has anybody else faced this issue before? What can I do to fix it? I was thinking of recreating the video player with wmode=opaque whenever I opened a modal popup and then switching it back to wmode=window when the modal popup is closed, since this would mean that the popup should display above it (as wmode=opaque) and the fullscreen should work correct (as wmode=window). However, this is not ideal at all: as well as being a hack it would also mean that the video would stop playing if somebody clicked a button which opened a popup. Cheers!

  Read the article

• ASP Classic, SQL 2008, XML Output, and DSN vs DSN-Less Produces Chinese Letters

  - by RoLYroLLs

  I've been having a problem for the past month and can't seem to figure out what is wrong. Here's the setup and a little background. Background: I have a web-host who was running my website on Windows Server 2003 and SQL Server 2000. One of my webpages returned a result set from a stored procedure from the SQL server as xml. Below is the code: Stored Procedure: select top 10 1 as tag , null as parent , column1 as [item!1!column1!element] , column2 as [item!1!column2!element] from table1 for XML EXPLICIT ASP Page: index.asp Call OpenConn Set cmd = Server.CreateObject("ADODB.Command") With cmd .ActiveConnection = dbc .CommandText = "name of proc" .CommandType = adCmdStoredProc .Parameters.Append .CreateParameter("@RetVal", adInteger, adParamReturnValue, 4) .Parameters.Append .CreateParameter("@Level", adInteger, adParamInput, 4, Level) End With Set rsItems = Server.CreateObject("ADODB.Recordset") With rsItems .CursorLocation = adUseClient .CursorType = adOpenStatic .LockType = adLockBatchOptimistic Set .Source = cmd .Open Set .ActiveConnection = Nothing End With If NOT rsItems.BOF AND NOT rsItems.EOF Then OutputXMLQueryResults rsItems,"items" End If Set rsItems = Nothing Set cmd = Nothing Call CloseConn Sub OpenConn() strConn = "Provider=SQLOLEDB;Data Source=[hidden];User Id=[hidden];Password=[hidden];Initial Catalog=[hidden];" Set dbc = Server.CreateObject("ADODB.Connection") dbc.open strConn End Sub Sub CloseConn() If IsObject(dbc) Then If dbc.State = adStateOpen Then dbc.Close End If Set dbc = Nothing End If End Sub Sub OutputXMLQueryResults(RS,RootElementName) Response.Clear Response.ContentType = "text/xml" Response.Codepage = 65001 Response.Charset = "utf-8" Response.Write "" Response.Write "" While Not RS.EOF Response.Write RS(0).Value RS.MoveNext WEnd Response.Write "" Response.End End Sub Present: All was working great, until my host upgraded to Windows Server 2008 and SQL Server 2008. All of the sudden I was getting results like this: From Browser: From View Source: However, I found that if I use a DSN connection strConn = "DSN=[my DSN Name];User Id=[hidden];Password=[hidden];Initial Catalog=[hidden];" it works perfectly fine! My current host is not going to support DSN any longer, but that's out of scope for this issue. Someone told me to use an ADO.Stream object instead of a Recordset object, but I'm unsure how to implement that. Question: Has anyone run into this and found a way to fix it? What about that ADO.Stream object, can someone help me with a sample that would fit my code?

  Read the article

• Run ajax scripts on page when navigating with ajax?

  - by Oskar Kjellin

  I got a bit of an issue in my ASP.NET MVC project. I have a chat div in the bottom right corner (like facebook), and of course I do not want this to reload when navigating to all my navigation is ajax. The problem I am facing is that I use the following code on the top of the view page: <script type="text/javascript"> $(document).ready(function() { $('#divTS').hide(); $('a#showTS').click(function() { $('#divTS').slideToggle(400); return false; }); }); </script> The problem is that this code is only loaded with ajax and does not seem to fire? I would like to run all scripts in the newly loaded view, just as if I hadn't navigated with ajax. I cannot put this in the site.master as it only loads once and then probably the divs I am trying to hide doesn't exist. Is there a good way to run scripts in the ajax-loaded div?

  Read the article

• iPhone:Tabbar hides when pushing from TableView to UIViewController

  - by user187532

  Hello all, I have four Tab bar items in a Tab bar which is being bottom of the view where i have the TableView. I am adding Tab bar and items programmatically (Refer below code) not through I.B. Click on first three Tab bar items, will show the data in the same TableView itself. But clicking on last Tab bar items will push to another UIViewcontroller and show the data there. The problem here is, when i push to the viewController when clicking on last Tab bar item, main "Tab bar" is getting removed. Tab bar code: UITabBar *tabBar = [[UITabBar alloc] initWithFrame:CGRectMake(0, 376, 320, 44)]; item1 = [[UITabBarItem alloc] initWithTitle:@"First Tab" image:[UIImage imageNamed:@"first.png"] tag:0]; item2 = [[UITabBarItem alloc] initWithTitle:@"Second Tab" image:[UIImage imageNamed:@"second.png"] tag:1]; item3 = [[UITabBarItem alloc] initWithTitle:@"Third Tab" image:[UIImage imageNamed:@"third.png"] tag:2]; item4 = [[UITabBarItem alloc] initWithTitle:@"Fourth Tab" image:[UIImage imageNamed:@"fourth.png"] tag:3]; item5 = [[UITabBarItem alloc] initWithTitle:@"Fifth Tab" image:[UIImage imageNamed:@"fifth.png"] tag:4]; NSArray *items = [NSArray arrayWithObjects: item1,item2,item3,item4, item5, nil]; [tabBar setItems:items animated:NO]; [tabBar setSelectedItem:item1]; tabBar.delegate=self; [self.view addSubview:tabBar]; Push controller code clicking from last Tab bar item: myViewController = [ [MyViewController alloc] initWithNibName:@"MyView" bundle:nil]; myViewController.hidesBottomBarWhenPushed=NO; [[self navigationController] pushViewController:myViewController animated:NO]; I am not seeing bottom Tab bar when i push my current TableView to myViewController. I am seeing full screen view there. I want to see bottom Tab bar always when every tab item clicked. What might be the problem here? Could someone who come across this issue, please share your suggestion to me? Thank you.

  Read the article

• Devise not allowing active resource to access the services

  - by Saurabh Pandit

  In my application there are two folders one for a rails application and another for a ruby application. In the ruby folder I have created a ruby file in which I have written code to access some model which is present in the rails application using active resource. Sample code is shown below : active_resource_example.rb require 'rubygems' require 'active_resource' class Website < ActiveResource::Base self.site = "http://localhost:3000/admin/" self.user = "user" self.password = "password" end websites = Website.find(:all) puts websites.inspect In my rails application I have used ActiveAdmin gem which uses devise for authentication. On rails Server I get the following result : Started GET "/admin/websites.json" for 192.168.1.37 at 2011-11-12 14:41:06 +0530 Processing by Admin::WebsitesController#index as JSON Completed in 43ms And on my terminal where I executed active_resource_example.rb, I got following error : user@user:~/Desktop$ ruby active_resource_example.rb /home/user/.rvm/gems/ruby-1.9.2-p180/gems/activeresource-3.1.1/lib/active_resource/connection.rb:132:in `handle_response': Failed. Response code = 401. Response message = Unauthorized . (ActiveResource::UnauthorizedAccess) from /home/user/.rvm/gems/ruby-1.9.2-p180/gems/activeresource-3.1.1/lib/active_resource/connection.rb:115:in `request' from /home/user/.rvm/gems/ruby-1.9.2-p180/gems/activeresource-3.1.1/lib/active_resource/connection.rb:80:in `block in get' from /home/user/.rvm/gems/ruby-1.9.2-p180/gems/activeresource-3.1.1/lib/active_resource/connection.rb:218:in `with_auth' from /home/user/.rvm/gems/ruby-1.9.2-p180/gems/activeresource-3.1.1/lib/active_resource/connection.rb:80:in `get' from /home/user/.rvm/gems/ruby-1.9.2-p180/gems/activeresource-3.1.1/lib/active_resource/base.rb:894:in `find_every' from /home/user/.rvm/gems/ruby-1.9.2-p180/gems/activeresource-3.1.1/lib/active_resource/base.rb:806:in `find' from active_resource_example.rb:12:in `<main>' user@user:~/Desktop$ I tried this with another application in which Devise authentication is not used with the same configuration I used in active_resource_example.rb, there I got the result. Desperately need some solution to this issue.

  Read the article

• problem getting info from a cookie with javascript

  - by Jason

  I am having an issue with my cookies and I can't figure it out. Basically I have it set up so it checks for the cookie to see if the user is logged in, and then displays either a welcome message or a login link. It works - except that instead of returning the persons name in the welcome message it just is blank where the name should be. The cookie is there, with all the appropriate info.. not sure what I am doing wrong. var itm = new Array(); itm[0] = findCookie("ui"); if (itm[0] == null) { document.write("<h2><a href='logreg.html'>Log In or Sign Up</a></h2>"); } else { var c1 = itm[0].indexOf(","); var c2 = itm[0].indexOf(",",c1); var c3 = itm[0].indexOf(",",c2); var gname = itm[0].substring(c2,c3); document.write("<h2>Welcome "+gname+"!</h2>"); } The findCookie function is.. function findCookie(val){ var cookie = null; var findVal = val + "="; var dc = document.cookie; if (dc.length > 0) { var start = dc.indexOf(findVal); if (start >= 0) { start += findVal.length; lastVal = dc.indexOf(";", start); if (lastVal == -1) { lastVal = dc.length; } cookie = (dc.substring(start, lastVal)); } else { return cookie; } } return cookie; }

  Read the article

• Build error with variables and url_for in Flask

  - by Rob

  Have found one or two people on the interwebs with similar problems, but haven't seen a solution posted anywhere. I'm getting a build error from the code/template below, but can't figure out where the issue is or why it's occurring. It appears that the template isn't recognizing the function, but don't know why this would be occurring. Any help would be greatly appreciated - have been pounding my against the keyboard for two nights now. Function: @app.route('/viewproj/<proj>', methods=['GET','POST']) def viewproj(proj): ... Template Excerpt: {% for project in projects %} <li> <a href="{{ url_for('viewproj', proj=project.project_name) }}"> {{project.project_name}}</a></li> {% else %} No projects {% endfor %} Error log: https://gist.github.com/1684250 EDIT: Also wanted to include that it's not recognizing the variable "proj" when building the URL, so it's just appending the value as a parameter. Here's an example: //myproject/viewproj?projname=what+up Last few lines: [Wed Jan 25 09:47:34 2012] [error] [client 199.58.143.128] File "/srv/www/myproject.com/myproject/templates/layout.html", line 103, in top-level template code, referer: xx://myproject.com/ [Wed Jan 25 09:47:34 2012] [error] [client 199.58.143.128] {% block body %}{% endblock %}, referer: xx://myproject.com/ [Wed Jan 25 09:47:34 2012] [error] [client 199.58.143.128] File "/srv/www/myproject.com/myproject/templates/main.html", line 34, in block "body", referer: xx://myproject.com/ [Wed Jan 25 09:47:34 2012] [error] [client 199.58.143.128] , referer: xx://myproject.com/ [Wed Jan 25 09:47:34 2012] [error] [client 199.58.143.128] File "/usr/lib/python2.7/dist-packages/flask/helpers.py", line 195, in url_for, referer: xx://myproject.com/ [Wed Jan 25 09:47:34 2012] [error] [client 199.58.143.128] return ctx.url_adapter.build(endpoint, values, force_external=external), referer: xx://myproject.com/ [Wed Jan 25 09:47:34 2012] [error] [client 199.58.143.128] File "/usr/lib/pymodules/python2.7/werkzeug/routing.py", line 1409, in build, referer: xx://myproject.com/ [Wed Jan 25 09:47:34 2012] [error] [client 199.58.143.128] raise BuildError(endpoint, values, method), referer: xx://myproject.com/ [Wed Jan 25 09:47:34 2012] [error] [client 199.58.143.128] BuildError: ('viewproj', {'proj': '12th'}, None), referer: xx://myproject.com/

  Read the article

• Using Word COM objects in .NET, InlineShapes not copied from template to document

  - by Keith

  Using .NET and the Word Interop I am programmatically creating a new Word doc from a template (.dot) file. There are a few ways to do this but I've chosen to use the AttachedTemplate property, as such: Dim oWord As New Word.Application() oWord.Visible = False Dim oDocuments As Word.Documents = oWord.Documents Dim oDoc As Word.Document = oDocuments.Add() oDoc.AttachedTemplate = sTemplatePath oDoc.UpdateStyles() (I'm choosing the AttachedTemplate means of doing this over the Documents.Add() method because of a memory leak issue I discovered when using Documents.Add() to open from templates.) This works fine EXCEPT when there is an image (represented as an InlineShape) in the template footer. In that case the image does not appear in the resulting document. Specifically the image should appear in the oDoc.Sections.Item(1).Footers.Item(WdHeaderFooterIndex.wdHeaderFooterPrimary).Range.InlineShapes collection but it does not. This is not a problem when using Documents.Add(), however as I said that method is not an option for me. Is there an extra step I have to take to get the images from the template? I already discovered that when using AttachedTemplate I have to explicitly call UpdateStyles() (as you can see in my code snippet) to apply the template styles to the document, whereas that is done automatically when using Documents.Add(). Or maybe there's some crazy workaround? Your help is much appreciated! :)

  Read the article

• AjaxControlToolkit Resource Files Not Copied To Output in MSBuild Script

  - by Dario Solera

  I'm new to MSBuild, but I managed to setup the following simple script: <Project ToolsVersion="3.5" DefaultTargets="Compile" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <PropertyGroup> <Configuration Condition="'$(Configuration)' == ''">Debug</Configuration> </PropertyGroup> <ItemGroup> <SolutionRoot Include=".." /> <BuildArtifacts Include=".\Artifacts\" /> <SolutionFile Include="..\SolutionName.sln" /> </ItemGroup> <Target Name="Clean"> <RemoveDir Directories="@(BuildArtifacts)" /> </Target> <Target Name="Init" DependsOnTargets="Clean"> <MakeDir Directories="@(BuildArtifacts)" /> </Target> <Target Name="Compile" DependsOnTargets="Init"> <MSBuild Projects="@(SolutionFile)" Properties="OutDir=%(BuildArtifacts.FullPath);Configuration=$(Configuration)" /> <MakeDir Directories="%(BuildArtifacts.FullPath)\_PublishedWebsites\RDE.XAP.UnifiedGui.Web\Temp" /> </Target> </Project> The solution has 23 projects, 4 of which are WebApps. Now, the script works fine and the output is generated correctly. The only problem I counter is with two WebApp projects in the solution that use the AJAX Control Toolkit. The toolkit has a set of folders (e.g. ar, it, es, fr) that contain localized resources. These folders are not copied in the bin directory of the WebApps when the solution is built in MSBuild, but they are copied when it is built in Visual Studio. How can I solve this in a clean manner? I know I could write a (quite convoluted) task that copies the directories after the compile, but it does not seem the right solution to me. Also, neither Google, SO and MSDN could provide more details on this kind of issue.

  Read the article

• segmentation fault on Unix - possible stack corruption

  - by bob

  hello, i'm looking at a core from a process running in Unix. Usually I can work my around and root into the backtrace to try identify a memory issue. In this case, I'm not sure how to proceed. Firstly the backtrace only gives 3 frames where I would expect alot more. For those frames, all the function parameters presented appears to completely invalid. There are not what I would expect. Some pointer parameters have the following associated with them - Cannot access memory at address Would this suggest some kind of complete stack corruption. I ran the process with libumem and all the buffers were reported as being clean. umem_status reported nothing either. so basically I'm stumped. What is the likely causes? What should I look for in code since libumem appears to have reported no errors. Any suggestions on how I can debug furhter? any extra features in mdb I should consider? thank you.

  Read the article

• Amazon S3 and swfaddress

  - by justinbach

  I recently migrated a large AS3 site (lots of swfs, lots of flvs) to Amazon S3. Pretty much everything but HTML and JS files is being stored/served from Amazon, and it's working well. The only problem I'm having is that I built the site using SWFaddress (actually, via the Gaia framework which uses SWFaddress), and for some reason, SWFaddress is no longer updating the address bar correctly as users navigate from page to page. In other words, the URL persistently remains http://www.mysite.com, not http://www.mysite.com/#/section as would be the case were SWFaddress functioning correctly (and as it was functioning prior to the migration). Stranger yet, if I go to (e.g.) http://www.mysite.com/#/section directly, the deeplinking functions as you'd expect--I arrive directly at the correct section. However, navigating away from that section doesn't have any effect on the address bar, despite the fact that it should be dynamically updated. I've got a crossdomain.xml file set up on the site that allows access from all domains, so that's not the issue, and I don't know what else might be. Any ideas would be greatly appreciated! P.S. I integrated S3 by putting pretty much the entire site in an S3 bucket and then just changing the initial swfobject embed to point to the S3 instance of main.swf, passing in the S3 path as the "base" param to the embedded swf so that all dynamically loaded assets and swfs would also be sourced from s3. Dunno if that's related to the troubles I'm having.

  Read the article

• Detecting Xml namespace fast

  - by Anna Tjsoken

  Hello there, This may be a very trivial problem I'm trying to solve, but I'm sure there's a better way of doing it. So please go easy on me. I have a bunch of XSD files that are internal to our application, we have about 20-30 Xml files that implement datasets based off those XSDs. Some Xml files are small (<100Kb), others are about 3-4Mb with a few being over 10Mb. I need to find a way of working out what namespace these Xml files are in order to provide (something like) intellisense based off the XSD. The implementation of this is not an issue - another developer has written the code for this. But I'm not sure the best (and fastest!) way of detecting the namespace is without the use of XmlDocument (which does a full parse). I'm using C# 3.5 and the documents come through as a Stream (some are remote files). All the files are *.xml (I can detect if it was extension based) but unfortunately the Xml namespace is the only way. Right now I've tried XmlDocument but I've found it to be innefficient and slow as the larger documents are awaiting to be parsed (even the 100Kb docs). public string GetNamespaceForDocument(Stream document); Something like the above is my method signature - overloads include string for "content". Would a RegEx (compiled) pattern be good? How does Visual Studio manage this so efficiently? Another college has told me to find a fast Xml parser in C/C++, parse the content and have a stub that gives back the namespace as its slower in .NET, is this a good idea?

  Read the article

• Converting plain text in SQL to hyperlink in Access

  - by manemawanna

  Hello, I've just started a new job my first since leaving University and as part of this my first task is to convert a wholly Access 2003 database to an Access front-end, SQL back-end. The Access database consists of a series of front end forms to add or review staff data, as part of this there is hyperlinks pointing to a photograph of the employee and there CV located on a shared drive. These were saved as hyperlinks within the Access DB. I have since converted the data in the Access DB to SQL and stored it in a database for me to test on, now as part of the data conversion the photo and CV locations were converted to nvarchar from hyperlink. I've done this using SSMA. My issue now is that I need to have these text links displayed and working as hyperlinks on the front end hidden behind the words "Photo" and "CV", but am unsure as to how to go about this, as in the past I've only ever used SQL and not Access. Any help or suggestions would be appreciated and if I've not been clear in any areas please feel free to ask questions and I'll try to clear anything up for you.

  Read the article

• rails test.log is always empty

  - by Raiden

  All the log entries generated when running tests with 'rake' are written to my development.log instead of test.log file Do I have to explicitly enable logging for test in enviornments/test.config?? (I'm using 'turn' gem to format test output, Can that cause an issue?) I'm running rails 2.3.5, ruby 1.8.7 I've all these gems installed for RAILS_ENV=test. Any help is appreciated. -[I] less -[I] treetop = 1.4.2 - [I] polyglot = 0.2.5 - [I] mutter = 0.4.2 - [I] mysql - [I] authlogic - [R] activesupport - [I] turn - [I] ansi = 1.1.0 - [I] facets = 2.8.0 - [I] rspec = 1.2.0 - [I] rspec-rails = 1.2.0 - [I] rspec = 1.3.0 - [R] rack = 1.0.0 - [I] webrat = 0.4.3 - [I] nokogiri = 1.2.0 - [R] rack = 1.0 - [I] rack-test = 0.5.3 - [R] rack = 1.0 - [I] cucumber = 0.2.2 - [I] term-ansicolor = 1.0.4 - [I] treetop = 1.4.2 - [I] polyglot = 0.2.5 - [I] polyglot = 0.2.9 - [R] builder = 2.1.2 - [I] diff-lcs = 1.1.2 - [R] json_pure = 1.2.0 - [I] cucumber-rails - [I] cucumber = 0.6.2 - [I] term-ansicolor = 1.0.4 - [I] treetop = 1.4.2 - [I] polyglot = 0.2.5 - [I] polyglot = 0.2.9 - [R] builder = 2.1.2 - [I] diff-lcs = 1.1.2 - [R] json_pure = 1.2.0 - [I] database_cleaner = 0.2.3 - [I] launchy - [R] rake = 0.8.1 - [I] configuration = 0.0.5 - [I] faker - [I] populator - [R] flog = 2.1.0 - [R] flay - [I] rcov - [I] reek - [R] ruby_parser ~ 2.0 - [I] ruby2ruby ~ 1.2 - [R] sexp_processor ~ 3.0 - [R] ruby_parser ~ 2.0 - [R] sexp_processor ~ 3.0 - [I] roodi - [R] ruby_parser - [I] gruff - [I] rmagick - [I] ruby-prof - [R] jscruggs-metric_fu = 1.1.5 - [I] factory_girl - [I] notahat-machinist

  Read the article

• Kohana 3 jQuery/AJAX request not working

  - by dscher

  I am trying to post some data to a controller in Kohana 3 using the jQuery AJAX method. I seem to have an issue with the data not getting to where I want it to be. I want the data to go to the /application/classes/controller/stock.php file where the file will process the data. I can't seem to figure this one out. Hopefully someone can help. My jQuery ajax call is: $.ajax({ type: 'POST', url: 'add_stock', data: { 'links': 'link_array' } }); 'add_stock' is the name of the action within the controller. I didn't know what else to try. I've also tried '.' and './' hoping that would be right but it's not. In Firebug, although it says the request was 200 OK, I see that the "RESPONSE" is "Failed to load source for: http://localhost/ddm/v2/stocks/add_stock" and my script in my controller which grabs the data isn't working. Here is that code in case it helps: $links = $_POST['links']; $link_obj = Jelly::factory('link') ->set('stock', $stock->id) ->set('links', $links); $link_obj->save(); I think that the problem is that I'm giving the ajax call the ROUTE and not the actual page it needs to deliver the POST data to. I just can't figure it out here. Any help?

  Read the article

• Good resources for building web-app in Tapestry

  - by Rich

  Hi, I'm currently researching into Tapestry for my company and trying to decide if I think we can port our pre-existing proprietary web applications to something better. Currently we are running Tomcat and using JSP for our front end backed by our own framework that eventually uses JDBC to connect to an Oracle database. I've gone through the Tapestry tutorial, which was really neat and got me interested, but now I'm faced with what seems to be a common issue of documentation. There are a lot of things I'd need to be sure that I could accomplish with Tapestry before I'd be ready to commit fully to it. Does anyone have any good resources, be it a book or web article or anything else, that go into more detail beyond what the Tapestry tutorial explains? I am also considering integrating with Hibernate, and have read a little bit about Spring too. I'm still having a hard time understanding how Spring would be more useful than cumbersome in tandem with Tapestry,as they seem to have a lot of overlapping features. An example I read seemed to use Spring to interface with Hibernate, and then Tapestry to Spring, but I was under the impression Tapestry integrates to the same degree with Hibernate. The resource I'm speaking of is http://wiki.apache.org/tapestry/Tapstry5First_project_with_Tapestry5,_Spring_and_Hibernate . I was interested because I hadn't found information anywhere else on how to maintain user levels and sessions through a Tapestry application before, but wasn't exactly impressed by the need to use Spring in the example.

  Read the article

• VPython in Eclipse - thinks it has the wrong architecture type.

  - by Duncan Tait

  Evening, So I've recently installed VPython on my MacBook (OS X, Snow Leopard) - and it works absolutely fine in IDLE and from the command line (interactive mode). However, eclipse has issues. Firstly it couldn't find it (which is a bit of an issue actually with all these 'easy install' python modules - when they don't tell you where they actually install to!) but I searched it out in the depths of Library\Frameworks... and added that to the System PYTHONPATH listbox in Eclipse. Now it can find it, but it says the following: Traceback (most recent call last): File "/Users/duncantait/dev/workspace/Network_Simulation/src/Basic/Net_Sim1.py", line 15, in <module> import visual File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/__init__.py", line 59, in <module> import cvisual ImportError: dlopen(/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/cvisual.so, 2): no suitable image found. Did find: /Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/site-packages/visual/cvisual.so: mach-o, but wrong architecture I am guessing that VPython might not be built for a 64-bit architecture (Intel), but the fact remains that it works in both IDLE and command prompt... So there must be a way to configure Eclipse to run it right? (Wishful thinking). Thanks for any help! Duncan

  Read the article

• Makefile for DOS/Windows and Cygwin

  - by Thomas Matthews

  I need to have a makefile work under DOS (Windows) and Cygwin. I having problems with the makefile detecting the OS correctly and setting appropriate variables. The objective is to set variables for the following commands, then invoke the commands in rules using the variables: Delete file: rm in Cygwin, del in DOS. Remove directory: rmdir (different parameters in Cygwin and DOS) Copy file: cp in Cygwin, copy in DOS. Testing for file existance: test in Cygwin, IF EXIST in DOS. Listing contents of a file: cat in Cygwin, type in DOS. Here is my attempt, which always uses the else clause: OS_KIND = $(OSTYPE) #OSTYPE is an environment variable set by Cygwin. ifeq ($(OS_KIND), cygwin) ENV_OS = Cygwin RM = rm -f RMDIR = rmdir -r CP = cp REN = mv IF_EXIST = test -a IF_NOT_EXIST = ! test -a LIST_FILE = cat else ENV_OS = Win_Cmd RM = del -f -Q RMDIR = rmdir /S /Q IF_EXIST = if exist IF_NOT_EXIST = if not exist LIST_FILE = type endif I'm using the forward slash character, '/', as a directory separator. This is a problem with the DOS command, as it is interpreting it as program argument rather than a separator. Anybody know how to resolve this issue? Edit: I am using make with Mingw in both Windows Console (DOS) and Cygwin.

  Read the article

• JVM segmentation faults due to "Invalid memory access of location"

  - by Dan

  I have a small project written in Scala 2.9.2 with unit tests written using ScalaTest. I use SBT for compiling and running my tests. Running sbt test on my project makes the JVM segfault regularly, but just compiling and running my project from SBT works fine. Here is the exact error message: Invalid memory access of location 0x8 rip=0x10959f3c9 [1] 11925 segmentation fault sbt I cannot locate a core dump anywhere, but would be happy to provide it if it can be obtained. Running java -version results in this: java version "1.6.0_37" Java(TM) SE Runtime Environment (build 1.6.0_37-b06-434-11M3909) Java HotSpot(TM) 64-Bit Server VM (build 20.12-b01-434, mixed mode) But I've also got Java 7 installed (though I was never able to actually run a Java program with it, afaik). Another issue that may be related: some of my test cases contain titles including parentheses like ( and ). SBT or ScalaTest (not sure) will consequently insert square parens in the middle of the output. For example, a test case with the name (..)..(..) might suddenly look like (..[)..](..). Any help resolving these issues is much appreciated :-) EDIT: I installed the Java 7 JDK, so now java -version shows the right thing: java version "1.7.0_07" Java(TM) SE Runtime Environment (build 1.7.0_07-b10) Java HotSpot(TM) 64-Bit Server VM (build 23.3-b01, mixed mode) This also means that I now get a more detailed segfault error and a core dump: # # A fatal error has been detected by the Java Runtime Environment: # # SIGSEGV (0xb) at pc=0x000000010a71a3e3, pid=16830, tid=19459 # # JRE version: 7.0_07-b10 # Java VM: Java HotSpot(TM) 64-Bit Server VM (23.3-b01 mixed mode bsd-amd64 compressed oops) # Problematic frame: # V [libjvm.dylib+0x3cd3e3] And the dump.

  Read the article

• Javascript Square bracket notation for global variables

  - by Yousuf Haider

  I ran into an interesting issue the other day and was wondering if someone could shed light on why this is happening. Here is what I am doing (for the purposes of this example I have dumbed down the example somewhat): I am creating a globally scoped variable using the square bracket notation and assigning it a value. Later I declare a var with the same name as the one I just created above. Note I am not assigning a value. Since this is a redeclaration of the same variable the old value should not be overriden as described here: http://www.w3schools.com/js/js_variables.asp //create global variable with square bracket notation window['y'] = 'old'; //redeclaration of the same variable var y; if (!y) y = 'new'; alert(y); //shows New instead of Old The problem is that the old value actually does get overriden and in the above eg. the alert shows 'new' instead of 'old'. Why ? I guess another way to state my question is how is the above code different in terms of semantics from the code below: //create global variable var y = 'old'; //redeclaration of the same variable var y; if (!y) y = 'new'; alert(y); //shows New instead of Old

  Read the article

• ColdFusion 8: Database Connection Reset Error

  - by Gavin

  I have been getting these intermittent ColdFusion Database connection reset errors and was wondering if anyone had experience with this and had a particular solution that worked? Here is the error: Error Executing Database Query.[Macromedia][SQLServer JDBC Driver]A problem occurred when attempting to contact the server (Server returned: Connection reset). Please ensure that the server parameters passed to the driver are correct and that the server is running. Also ensure that the maximum number of connections have not been exceeded for this server. This doesn't happen with any particular query, the code breaks in different queries every time, returning a SQLState error 08s01. These query's logic are fine, no logic errors etc. I checked the network logs and there were no database server connection refusals at the time of the error. Once the first error occurs, it keeps happening for no more than a minute or so at random times of the day, every few days. I've googled this thing and so far anyone that has had this issue was only on CF6 or 7, which the fixes coldFusion put out are only for CF6 or 7. Server configuration wise: The ColdFusion server is version 8 The database server is SQL Server 2005 Standard The database connections allowed setting is set to unlimited on both SQL Server and ColdFusion Any help would be greatly appreciated, Thanks!

  Read the article

< Previous Page | 833 834 835 836 837 838 839 840 841 842 843 844  | Next Page >