Search Results

Search found 4842 results on 194 pages for 'computation expression'.

Page 84/194 | < Previous Page | 80 81 82 83 84 85 86 87 88 89 90 91  | Next Page >

  • Haskell: Why is it saying my function type is off?

    - by linkmaster03
    I wrote a little Haskell program to find the area of a triangle, primarily to practice custom types, but it keeps throwing the following error on compile: areafinder.hs:7:4: Couldn't match expected type 'Triangle' against inferred type 'm b' In a stmt of a 'do' expression: putStr "Base: " In the expression: do { putStr "Base: "; baseStr I'm not sure where 'm b' comes from, so I'm at a loss here. Why is it throwing this error, and what can I do to fix it? Here is my code: module Main where data Triangle = Triangle Double Double -- base, height getTriangle :: Triangle getTriangle = do putStr "Base: " baseStr Double calcTriangle (Triangle base height) = base * height main = putStrLn ("Area = " ++ show (calcTriangle getTriangle)) Thanks. :)

    Read the article

  • How do you add < or > to a summary tag in Visual studio?

    - by Tony
    How do you add < (less than) or (greater than) to a summary comment in visual studio? I am in Visual Studio 2008. I have a generic method: public bool IsMemberProtected<T>(Expression<Func<T, object>> expression) Would love to have a summary tag of something like this /// <summary> /// Determines whether a member is protected. /// /// Usage: IsMemberProtected<ExampleType>(x => x.Member) /// </summary> But when I do that, the tooltip for the property no longer works when a developer hovers over the method in code to view the summary tag. Thoughts?

    Read the article

  • How to generate random strings that match a given regexp?

    - by Pies
    Duplicate: Random string that matches a regexp No, it isn't. I'm looking for an easy and universal method, one that I could actually implement. That's far more difficult than randomly generating passwords. I want to create an application that takes a regular expression, and shows 10 randomly generated strings that match that expression. It's supposed to help people better understand their regexps, and to decide i.e. if they're secure enough for validation purposes. Does anyone know of an easy way to do that? One obvious solution would be to write (or steal) a regexp parser, but that seems really over my head. I repeat, I'm looking for an easy and universal way to do that. Edit: Brute force approach is out of the question. Assuming the random strings would just be [a-z0-9]{10} and 1 million iterations per second, it would take 65 years to iterate trough the space of all 10-char strings.

    Read the article

  • RegularExpressionValidator always fails, but ValidationExpression works in testing

    - by Jerph
    I found the answer to this, but it's a bit of a gotcha so I wanted to share it here. I have a regular expression that validates passwords. They should be 7 to 60 characters with at least one numeric and one alpha character. Pretty standard. I used positive lookaheads (the (?= operator) to implement it: (?=^.{7,60}$)(?=.*[0-9].*)(?=.*[a-zA-Z].*) I checked this expression in my unit tests using Regex.IsMatch(), and it worked fine. However, when I use it in a RegularExpressionValidator, it always fails. Why?

    Read the article

  • negative look ahead to exclude html tags

    - by Remoh
    I'm trying to come up with a validation expression to prevent users from entering html or javascript tags into a comment box on a web page. The following works fine for a single line of text: ^(?!.(<|)).$ ..but it won't allow any newline characters because of the dot(.). If I go with something like this: ^(?!.(<|))(.|\s)$ it will allow multiple lines but the expression only matches '<' and '' on the first line. I need it to match any line. This works fine: ^[-_\s\d\w"'.,:;#/&\$\%\?!@+*\()]{0,4000}$ but it's ugly and I'm concerned that it's going to break for some users because it's a multi-lingual application. Any ideas? Thanks!

    Read the article

  • How to choose programaticaly the column to be querried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to querry the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); the myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq querries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to querry. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • preg_replace or regex string translation

    - by ccolon
    I found some partial help but cannot seem to fully accomplish what I need. I need to be able to do the following: I need an regular expression to replace any 1 to 3 character words between two words that are longer than 3 characters with a match any expression: For example: walk to the beach == walk(.*)beach If the 1 to 3 character word is not preceded by a word that's longer than 3 characters then I want to translate that 1 to 3 letter word to ' ?' For example: on the beach == on ?the ?beach The simpler the rule the better (of course, if there's an alternative more complicated version that's more performant then I'll take that as well as I eventually anticipate heavy usage eventually). This will be used in a PHP context most likely with preg_replace. Thus, if you can put it in that context then even better!

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • one-liner if statements...

    - by snickered
    Total noob here so be gentle. I've looked everywhere and can't seem to find the answer to this. How do I condense the following? if (expression) { return true; } else { return false; } I can't get it to work since it's returning something vs. setting something. I've already seen things like this: somevar = (expression) ? value1 : value2; Like I said, please be gentle :)

    Read the article

  • Is void *p = 0L valid?

    - by Artefacto
    In this answer, sassman initializes a pointer with: zend_class_entry* ce = 0L; My question is – is this valid? I would say it isn't, to initialize the variable with a null pointer either an unadorned (and possibly casted to void *) 0 constant, or some macro that evaluates to that such as NULL should be used. However, I can't find definitive language in the standard that supports this interpretation. All it says is: An integer constant expression with the value 0, or such an expression cast to type void *, is called a null pointer constant.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • antlr: How to rewrite only specific

    - by user1293945
    I am sure antlr can solve my problem, but can't figure out how to implement it, even high level. I rapidly got caught into syntax problems of antlr itself. My grammar is quite simple and made of following tokens and rules. Don't really need to go in their details here. The evaluator resolves to expressions, which finally resolve to IDENT: evaluator : expression EOF! ; ... ... term : PARTICIPANT_TYPE(IDENT | '('! expression ')'! | max | min | if_ | NUMBER)+ ; Now, I would like to analyse and rewrite the 'term', so that IDENT tokens (and them only) get re-written with the PARTICIPANT_TYPE. All the others should simply remain the same.

    Read the article

  • How to choose programaticaly the column to be queried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to query the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); The myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq queries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to query. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • Is there a way to create a string that matches a given C# regex?

    - by Chris Phillips
    My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

    Read the article

  • How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

    - by prateeksaluja20
    I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

    Read the article

  • How to create a NSPredicate to find entries with leading numerical value?

    - by Toastor
    Hello, I'm using NSPredicates to fetch entities based on a name attribute. Creating a predicate for names beginning with letters was easy (@"name BEGINSWITH %@", searchLetter), however now I'd like to fetch all entities with a name that begins with a numerical value, or rather a non-alphabetical number. What would be the appropriate predicate expression here? Right now I don't want to get too deep into predicate programming, as this is all I need right now and time flies. So, please, don't point me to the Predicate Programming Guide, I just need that expression.. :) Thanks alot guys!

    Read the article

  • Looking for another regex explanation

    - by Sam
    In my regex expression, I was trying to match a password between 8 and 16 character, with at least 2 of each of the following: lowercase letters, capital letters, and digits. In my expression I have: ^((?=.*\d)(?=.*[a-z])(?=.*[A-Z])(?=.*\d)(?=.*[a-z])(?=.*[A-Z]).{8,16})$ But I don't understand why it wouldn't work like this: ^((?=\d)(?=[a-z])(?=[A-Z])(?=\d)(?=[a-z])(?=[A-Z]){8,16})$ Doesnt ".*" just meant "zero or more of any character"? So why would I need that if I'm just checking for specific conditions? And why did I need the period before the curly braces defining the limit of the password? And one more thing, I don't understand what it means to "not consume any of the string" in reference to "?=".

    Read the article

  • EM12c Release 4: New EMCLI Verbs

    - by SubinDaniVarughese
    Here are the new EM CLI verbs in Enterprise Manager 12c Release 4 (12.1.0.4). This helps you in writing new scripts or enhancing your existing scripts for further automation. Basic Administration Verbs invoke_ws - Invoke EM web service.ADM Verbs associate_target_to_adm - Associate a target to an application data model. export_adm - Export Application Data Model to a specified .xml file. import_adm - Import Application Data Model from a specified .xml file. list_adms - List the names, target names and application suites of existing Application Data Models verify_adm - Submit an application data model verify job for the target specified.Agent Update Verbs get_agent_update_status -  Show Agent Update Results get_not_updatable_agents - Shows Not Updatable Agents get_updatable_agents - Show Updatable Agents update_agents - Performs Agent Update Prereqs and submits Agent Update JobBI Publisher Reports Verbs grant_bipublisher_roles - Grants access to the BI Publisher catalog and features. revoke_bipublisher_roles - Revokes access to the BI Publisher catalog and features.Blackout Verbs create_rbk - Create a Retro-active blackout.CFW Verbs cancel_cloud_service_requests -  To cancel cloud service requests delete_cloud_service_instances -  To delete cloud service instances delete_cloud_user_objects - To delete cloud user objects. get_cloud_service_instances - To get information about cloud service instances get_cloud_service_requests - To get information about cloud requests get_cloud_user_objects - To get information about cloud user objects.Chargeback Verbs add_chargeback_entity - Adds the given entity to Chargeback. assign_charge_plan - Assign a plan to a chargeback entity. assign_cost_center - Assign a cost center to a chargeback entity. create_charge_entity_type - Create  charge entity type export_charge_plans - Exports charge plans metadata to file export_custom_charge_items -  Exports user defined charge items to a file import_charge_plans - Imports charge plans metadata from given file import_custom_charge_items -  Imports user defined charge items metadata from given file list_charge_plans - Gives a list of charge plans in Chargeback. list_chargeback_entities - Gives a list of all the entities in Chargeback list_chargeback_entity_types - Gives a list of all the entity types that are supported in Chargeback list_cost_centers - Lists the cost centers in Chargeback. remove_chargeback_entity - Removes the given entity from Chargeback. unassign_charge_plan - Un-assign the plan associated to a chargeback entity. unassign_cost_center - Un-assign the cost center associated to a chargeback entity.Configuration/Association History disable_config_history - Disable configuration history computation for a target type. enable_config_history - Enable configuration history computation for a target type. set_config_history_retention_period - Sets the amount of time for which Configuration History is retained.ConfigurationCompare config_compare - Submits the configuration comparison job get_config_templates - Gets all the comparison templates from the repositoryCompliance Verbs fix_compliance_state -  Fix compliance state by removing references in deleted targets.Credential Verbs update_credential_setData Subset Verbs export_subset_definition - Exports specified subset definition as XML file at specified directory path. generate_subset - Generate subset using specified subset definition and target database. import_subset_definition - Import a subset definition from specified XML file. import_subset_dump - Imports dump file into specified target database. list_subset_definitions - Get the list of subset definition, adm and target nameDelete pluggable Database Job Verbs delete_pluggable_database - Delete a pluggable databaseDeployment Procedure Verbs get_runtime_data - Get the runtime data of an executionDiscover and Push to Agents Verbs generate_discovery_input - Generate Discovery Input file for discovering Auto-Discovered Domains refresh_fa - Refresh Fusion Instance run_fa_diagnostics - Run Fusion Applications DiagnosticsFusion Middleware Provisioning Verbs create_fmw_domain_profile - Create a Fusion Middleware Provisioning Profile from a WebLogic Domain create_fmw_home_profile - Create a Fusion Middleware Provisioning Profile from an Oracle Home create_inst_media_profile - Create a Fusion Middleware Provisioning Profile from Installation MediaGold Agent Image Verbs create_gold_agent_image - Creates a gold agent image. decouple_gold_agent_image - Decouples the agent from gold agent image. delete_gold_agent_image - Deletes a gold agent image. get_gold_agent_image_activity_status -  Gets gold agent image activity status. get_gold_agent_image_details - Get the gold agent image details. list_agents_on_gold_image - Lists agents on a gold agent image. list_gold_agent_image_activities - Lists gold agent image activities. list_gold_agent_image_series - Lists gold agent image series. list_gold_agent_images - Lists the available gold agent images. promote_gold_agent_image - Promotes a gold agent image. stage_gold_agent_image - Stages a gold agent image.Incident Rules Verbs add_target_to_rule_set - Add a target to an enterprise rule set. delete_incident_record - Delete one or more open incidents remove_target_from_rule_set - Remove a target from an enterprise rule set. Job Verbs export_jobs - Export job details in to an xml file import_jobs - Import job definitions from an xml file job_input_file - Supply details for a job verb in a property file resume_job - Resume a job or set of jobs suspend_job - Suspend a job or set of jobs Oracle Database as Service Verbs config_db_service_target - Configure DB Service target for OPCPrivilege Delegation Settings Verbs clear_default_privilege_delegation_setting - Clears the default privilege delegation setting for a given list of platforms set_default_privilege_delegation_setting - Sets the default privilege delegation setting for a given list of platforms test_privilege_delegation_setting - Tests a Privilege Delegation Setting on a hostSSA Verbs cleanup_dbaas_requests - Submit cleanup request for failed request create_dbaas_quota - Create Database Quota for a SSA User Role create_service_template - Create a Service Template delete_dbaas_quota - Delete the Database Quota setup for a SSA User Role delete_service_template - Delete a given service template get_dbaas_quota - List the Database Quota setup for all SSA User Roles get_dbaas_request_settings - List the Database Request Settings get_service_template_detail - Get details of a given service template get_service_templates -  Get the list of available service templates rename_service_template -  Rename a given service template update_dbaas_quota - Update the Database Quota for a SSA User Role update_dbaas_request_settings - Update the Database Request Settings update_service_template -  Update a given service template. SavedConfigurations get_saved_configs  - Gets the saved configurations from the repository Server Generated Alert Metric Verbs validate_server_generated_alerts  - Server Generated Alert Metric VerbServices Verbs edit_sl_rule - Edit the service level rule for the specified serviceSiebel Verbs list_siebel_enterprises -  List Siebel enterprises currently monitored in EM list_siebel_servers -  List Siebel servers under a specified siebel enterprise update_siebel- Update a Siebel enterprise or its underlying serversSiteGuard Verbs add_siteguard_aux_hosts -  Associate new auxiliary hosts to the system configure_siteguard_lag -  Configure apply lag and transport lag limit for databases delete_siteguard_aux_host -  Delete auxiliary host associated with a site delete_siteguard_lag -  Erases apply lag or transport lag limit for databases get_siteguard_aux_hosts -  Get all auxiliary hosts associated with a site get_siteguard_health_checks -  Shows schedule of health checks get_siteguard_lag -  Shows apply lag or transport lag limit for databases schedule_siteguard_health_checks -  Schedule health checks for an operation plan stop_siteguard_health_checks -  Stops all future health check execution of an operation plan update_siteguard_lag -  Updates apply lag and transport lag limit for databasesSoftware Library Verbs stage_swlib_entity_files -  Stage files of an entity from Software Library to a host target.Target Data Verbs create_assoc - Creates target associations delete_assoc - Deletes target associations list_allowed_pairs - Lists allowed association types for specified source and destination list_assoc - Lists associations between source and destination targets manage_agent_partnership - Manages partnership between agents. Used for explicitly assigning agent partnershipsTrace Reports generate_ui_trace_report  -  Generate and download UI Page performance report (to identify slow rendering pages)VI EMCLI Verbs add_virtual_platform - Add Oracle Virtual PLatform(s). modify_virtual_platform - Modify Oracle Virtual Platform.To get more details about each verb, execute$ emcli help <verb_name>Example: $ emcli help list_assocNew resources in list verbThese are the new resources in EM CLI list verb :Certificates  WLSCertificateDetails Credential Resource Group  PreferredCredentialsDefaultSystemScope - Preferred credentials (System Scope)   PreferredCredentialsSystemScope - Target preferred credentialPrivilege Delegation Settings  TargetPrivilegeDelegationSettingDetails  - List privilege delegation setting details on a host  TargetPrivilegeDelegationSetting - List privilege delegation settings on a host   PrivilegeDelegationSettings  - Lists all Privilege Delegation Settings   PrivilegeDelegationSettingDetails - Lists details of  Privilege Delegation Settings To get more details about each resource, execute$ emcli list -resource="<resource_name>" -helpExample: $ emcli list -resource="PrivilegeDelegationSettings" -helpDeprecated Verbs:Agent Administration Verbs resecure_agent - Resecure an agentTo get the complete list of verbs, execute:$ emcli help Stay Connected: Twitter | Facebook | YouTube | Linkedin | Newsletter Download the Oracle Enterprise Manager 12c Mobile app

    Read the article

  • MapReduce in DryadLINQ and PLINQ

    - by JoshReuben
    MapReduce See http://en.wikipedia.org/wiki/Mapreduce The MapReduce pattern aims to handle large-scale computations across a cluster of servers, often involving massive amounts of data. "The computation takes a set of input key/value pairs, and produces a set of output key/value pairs. The developer expresses the computation as two Func delegates: Map and Reduce. Map - takes a single input pair and produces a set of intermediate key/value pairs. The MapReduce function groups results by key and passes them to the Reduce function. Reduce - accepts an intermediate key I and a set of values for that key. It merges together these values to form a possibly smaller set of values. Typically just zero or one output value is produced per Reduce invocation. The intermediate values are supplied to the user's Reduce function via an iterator." the canonical MapReduce example: counting word frequency in a text file.     MapReduce using DryadLINQ see http://research.microsoft.com/en-us/projects/dryadlinq/ and http://connect.microsoft.com/Dryad DryadLINQ provides a simple and straightforward way to implement MapReduce operations. This The implementation has two primary components: A Pair structure, which serves as a data container. A MapReduce method, which counts word frequency and returns the top five words. The Pair Structure - Pair has two properties: Word is a string that holds a word or key. Count is an int that holds the word count. The structure also overrides ToString to simplify printing the results. The following example shows the Pair implementation. public struct Pair { private string word; private int count; public Pair(string w, int c) { word = w; count = c; } public int Count { get { return count; } } public string Word { get { return word; } } public override string ToString() { return word + ":" + count.ToString(); } } The MapReduce function  that gets the results. the input data could be partitioned and distributed across the cluster. 1. Creates a DryadTable<LineRecord> object, inputTable, to represent the lines of input text. For partitioned data, use GetPartitionedTable<T> instead of GetTable<T> and pass the method a metadata file. 2. Applies the SelectMany operator to inputTable to transform the collection of lines into collection of words. The String.Split method converts the line into a collection of words. SelectMany concatenates the collections created by Split into a single IQueryable<string> collection named words, which represents all the words in the file. 3. Performs the Map part of the operation by applying GroupBy to the words object. The GroupBy operation groups elements with the same key, which is defined by the selector delegate. This creates a higher order collection, whose elements are groups. In this case, the delegate is an identity function, so the key is the word itself and the operation creates a groups collection that consists of groups of identical words. 4. Performs the Reduce part of the operation by applying Select to groups. This operation reduces the groups of words from Step 3 to an IQueryable<Pair> collection named counts that represents the unique words in the file and how many instances there are of each word. Each key value in groups represents a unique word, so Select creates one Pair object for each unique word. IGrouping.Count returns the number of items in the group, so each Pair object's Count member is set to the number of instances of the word. 5. Applies OrderByDescending to counts. This operation sorts the input collection in descending order of frequency and creates an ordered collection named ordered. 6. Applies Take to ordered to create an IQueryable<Pair> collection named top, which contains the 100 most common words in the input file, and their frequency. Test then uses the Pair object's ToString implementation to print the top one hundred words, and their frequency.   public static IQueryable<Pair> MapReduce( string directory, string fileName, int k) { DryadDataContext ddc = new DryadDataContext("file://" + directory); DryadTable<LineRecord> inputTable = ddc.GetTable<LineRecord>(fileName); IQueryable<string> words = inputTable.SelectMany(x => x.line.Split(' ')); IQueryable<IGrouping<string, string>> groups = words.GroupBy(x => x); IQueryable<Pair> counts = groups.Select(x => new Pair(x.Key, x.Count())); IQueryable<Pair> ordered = counts.OrderByDescending(x => x.Count); IQueryable<Pair> top = ordered.Take(k);   return top; }   To Test: IQueryable<Pair> results = MapReduce(@"c:\DryadData\input", "TestFile.txt", 100); foreach (Pair words in results) Debug.Print(words.ToString());   Note: DryadLINQ applications can use a more compact way to represent the query: return inputTable         .SelectMany(x => x.line.Split(' '))         .GroupBy(x => x)         .Select(x => new Pair(x.Key, x.Count()))         .OrderByDescending(x => x.Count)         .Take(k);     MapReduce using PLINQ The pattern is relevant even for a single multi-core machine, however. We can write our own PLINQ MapReduce in a few lines. the Map function takes a single input value and returns a set of mapped values àLINQ's SelectMany operator. These are then grouped according to an intermediate key à LINQ GroupBy operator. The Reduce function takes each intermediate key and a set of values for that key, and produces any number of outputs per key à LINQ SelectMany again. We can put all of this together to implement MapReduce in PLINQ that returns a ParallelQuery<T> public static ParallelQuery<TResult> MapReduce<TSource, TMapped, TKey, TResult>( this ParallelQuery<TSource> source, Func<TSource, IEnumerable<TMapped>> map, Func<TMapped, TKey> keySelector, Func<IGrouping<TKey, TMapped>, IEnumerable<TResult>> reduce) { return source .SelectMany(map) .GroupBy(keySelector) .SelectMany(reduce); } the map function takes in an input document and outputs all of the words in that document. The grouping phase groups all of the identical words together, such that the reduce phase can then count the words in each group and output a word/count pair for each grouping: var files = Directory.EnumerateFiles(dirPath, "*.txt").AsParallel(); var counts = files.MapReduce( path => File.ReadLines(path).SelectMany(line => line.Split(delimiters)), word => word, group => new[] { new KeyValuePair<string, int>(group.Key, group.Count()) });

    Read the article

< Previous Page | 80 81 82 83 84 85 86 87 88 89 90 91  | Next Page >