Search Results

Search found 20336 results on 814 pages for 'connection strings'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 86/814 | < Previous Page | 82 83 84 85 86 87 88 89 90 91 92 93  | Next Page >

  • "The server refused the connection" error in Facebook App [closed]

    - by balajimca
    I am working on creating a facebook app for a webstore and listing its contents in facebook app. My server is not https, but facebook app requires https, it showed "Operation timed out" error. So I disabled secured browsing option in facebook and tested in facebook appcentre. After disable secured browsing , the site was worked well till yesterday.But Today, I tried to check the output, It showing this error "The server refused the connection". How can I fix this error. Please look at the screenshot for clarification.

    Read the article

  • Zend Framework 2 loading slow and loss of connection using WAMP

    - by Charlie
    I've been facing an issue with Zend framework running on my local Wamp 2.2 server. I am not sure what I'm doing wrong but ZF2 seems to load really slow when making an http request. Any other request to a php or html file seems to run smoothly. Also, sometimes when the loading time takes longer, I get this message: "The connection to [virtualhostname] was interrupted" I then need to hit refresh to complete the request. I checked apache error log and everything looks fine. Please, I appreciate any type of guide/suggestion to take care of this issue. I followed the starter guide word by word.

    Read the article

  • windows7 cant get to internet( cable connection)

    - by user29297
    I'm using a window 7 with wireless & cable equipments to connect to internet, it's been fine for moths. But Three days ago, the local connection ran out of control and i can no longer use the cable to get access to internet. But fortunately the wireless equipment still works. I reinstalled the driver, took off/inserted in the cable, the computer still didn't work. And every time I let the computer diagnose itself, it told me that :"Default gateway is not valid"(or something else, forgive my terrible english XD). If anyone could give any advice, i will be very appreciated. And I'm in california, but i don't know the gateway of this area.

    Read the article

  • getting database connectivity issue from only one part of my ASP.net project?

    - by Greg
    Hi, Something weird has started happening to my project with Dynamic Data. Suddenly I am now getting connection errors when going to the DD navigation pages, but things work fine on the default DD main page, and also other MVC pages I've added in myself work fine to the database. Any ideas? So in summary if I go to the following web pages: custom URL for my custom controller - this works fine, including getting database data main DD page from root URL - this works fine click on a link to a table maintenance page from the main DD page - GET DATABASE CONNECTIVITY ERROR Some items: * I'm using SQL Server Express 2008 * Doesn't seem to be any debug/error info in VS2010 at all I can see * Web config entry: <add name="Model1Container" connectionString="metadata=res://*/Model1.csdl|res://*/Model1.ssdl|res://*/Model1.msl;provider=System.Data.SqlClient;provider connection string=&quot;Data Source=GREG\SQLEXPRESS_2008;Initial Catalog=greg_development;Integrated Security=True;MultipleActiveResultSets=True&quot;" providerName="System.Data.EntityClient"/> Error: Server Error in '/' Application. A network-related or instance-specific error occurred while establishing a connection to SQL Server. The server was not found or was not accessible. Verify that the instance name is correct and that SQL Server is configured to allow remote connections. (provider: SQL Network Interfaces, error: 26 - Error Locating Server/Instance Specified) Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Data.SqlClient.SqlException: A network-related or instance-specific error occurred while establishing a connection to SQL Server. The server was not found or was not accessible. Verify that the instance name is correct and that SQL Server is configured to allow remote connections. (provider: SQL Network Interfaces, error: 26 - Error Locating Server/Instance Specified) Source Error: Line 39: DropDownList1.Items.Add(new ListItem("[Not Set]", NullValueString)); Line 40: } Line 41: PopulateListControl(DropDownList1); Line 42: // Set the initial value if there is one Line 43: string initialValue = DefaultValue; Source File: U:\My Dropbox\source\ToplogyLibrary\Topology_Web_Dynamic\DynamicData\Filters\ForeignKey.ascx.cs Line: 41 Stack Trace: [SqlException (0x80131904): A network-related or instance-specific error occurred while establishing a connection to SQL Server. The server was not found or was not accessible. Verify that the instance name is correct and that SQL Server is configured to allow remote connections. (provider: SQL Network Interfaces, error: 26 - Error Locating Server/Instance Specified)] System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection) +5009598 System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning() +234 System.Data.SqlClient.TdsParser.Connect(ServerInfo serverInfo, SqlInternalConnectionTds connHandler, Boolean ignoreSniOpenTimeout, Int64 timerExpire, Boolean encrypt, Boolean trustServerCert, Boolean integratedSecurity) +341 System.Data.SqlClient.SqlInternalConnectionTds.AttemptOneLogin(ServerInfo serverInfo, String newPassword, Boolean ignoreSniOpenTimeout, TimeoutTimer timeout, SqlConnection owningObject) +129 System.Data.SqlClient.SqlInternalConnectionTds.LoginNoFailover(ServerInfo serverInfo, String newPassword, Boolean redirectedUserInstance, SqlConnection owningObject, SqlConnectionString connectionOptions, TimeoutTimer timeout) +239 System.Data.SqlClient.SqlInternalConnectionTds.OpenLoginEnlist(SqlConnection owningObject, TimeoutTimer timeout, SqlConnectionString connectionOptions, String newPassword, Boolean redirectedUserInstance) +195 System.Data.SqlClient.SqlInternalConnectionTds..ctor(DbConnectionPoolIdentity identity, SqlConnectionString connectionOptions, Object providerInfo, String newPassword, SqlConnection owningObject, Boolean redirectedUserInstance) +232 System.Data.SqlClient.SqlConnectionFactory.CreateConnection(DbConnectionOptions options, Object poolGroupProviderInfo, DbConnectionPool pool, DbConnection owningConnection) +185 System.Data.ProviderBase.DbConnectionFactory.CreatePooledConnection(DbConnection owningConnection, DbConnectionPool pool, DbConnectionOptions options) +33 System.Data.ProviderBase.DbConnectionPool.CreateObject(DbConnection owningObject) +524 System.Data.ProviderBase.DbConnectionPool.UserCreateRequest(DbConnection owningObject) +66 System.Data.ProviderBase.DbConnectionPool.GetConnection(DbConnection owningObject) +479 System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) +108 System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) +126 System.Data.SqlClient.SqlConnection.Open() +125 System.Data.EntityClient.EntityConnection.OpenStoreConnectionIf(Boolean openCondition, DbConnection storeConnectionToOpen, DbConnection originalConnection, String exceptionCode, String attemptedOperation, Boolean& closeStoreConnectionOnFailure) +52 [EntityException: The underlying provider failed on Open.] System.Data.EntityClient.EntityConnection.OpenStoreConnectionIf(Boolean openCondition, DbConnection storeConnectionToOpen, DbConnection originalConnection, String exceptionCode, String attemptedOperation, Boolean& closeStoreConnectionOnFailure) +161 System.Data.EntityClient.EntityConnection.Open() +98 System.Data.Objects.ObjectContext.EnsureConnection() +81 System.Data.Objects.ObjectQuery`1.GetResults(Nullable`1 forMergeOption) +46 System.Data.Objects.ObjectQuery`1.System.Collections.Generic.IEnumerable<T>.GetEnumerator() +44 System.Data.Objects.ObjectQuery`1.GetEnumeratorInternal() +36 System.Data.Objects.ObjectQuery.System.Collections.IEnumerable.GetEnumerator() +10 System.Web.DynamicData.Misc.FillListItemCollection(IMetaTable table, ListItemCollection listItemCollection) +50 System.Web.DynamicData.QueryableFilterUserControl.PopulateListControl(ListControl listControl) +85 Topology_Web_Dynamic.ForeignKeyFilter.Page_Init(Object sender, EventArgs e) in U:\My Dropbox\source\ToplogyLibrary\Topology_Web_Dynamic\DynamicData\Filters\ForeignKey.ascx.cs:41 System.Web.Util.CalliHelper.EventArgFunctionCaller(IntPtr fp, Object o, Object t, EventArgs e) +14 System.Web.Util.CalliEventHandlerDelegateProxy.Callback(Object sender, EventArgs e) +35 System.Web.UI.Control.OnInit(EventArgs e) +91 System.Web.UI.UserControl.OnInit(EventArgs e) +83 System.Web.UI.Control.InitRecursive(Control namingContainer) +140 System.Web.UI.Control.AddedControl(Control control, Int32 index) +197 System.Web.UI.ControlCollection.Add(Control child) +79 System.Web.DynamicData.DynamicFilter.EnsureInit(IQueryableDataSource dataSource) +200 System.Web.DynamicData.QueryableFilterRepeater.<Page_InitComplete>b__1(DynamicFilter f) +11 System.Collections.Generic.List`1.ForEach(Action`1 action) +145 System.Web.DynamicData.QueryableFilterRepeater.Page_InitComplete(Object sender, EventArgs e) +607 System.EventHandler.Invoke(Object sender, EventArgs e) +0 System.Web.UI.Page.OnInitComplete(EventArgs e) +8871862 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +604 Version Information: Microsoft .NET Framework Version:4.0.30319; ASP.NET Version:4.0.30319.1

    Read the article

  • Ruby on rails - how to retrieve connection strings

    - by Jett
    Hi Everyone, Are there any ways to retrieve the database connection string where my ruby is connected? what i would like to get is the: 1) Database name where the ruby is connected 2) The username of the SQL Server 3) Password of the SQL Server 4) Server name I want to store it in session variables. (I'am using MS SQL Server.) Please help! thanks!

    Read the article

  • Reading Excel by OLEDB reads strings as DBNull

    - by Sathish
    I am reading Excel file using OLEDB in Csharp i have shown the sample excel data what i have F1 F2 F3 F4 India 23 44 4 China 4 8 Month 6 USA 45 Neg 4 When i read this data and check in my DataTable i get Null values for "Month 6" and "Neg" where as i can be able get the F1 column correctly... my connection string is as shown Provider=Microsoft.ACE.OLEDB.12.0;Data Source=[XLSource];Extended Properties=Excel 12.0;

    Read the article

  • Unable to SSH into EC2 instance on Fedora 17

    - by abhishek
    I did following steps But I am not able to SSH to it(Same steps work fine on Fedora 14 image). I am getting Permission denied (publickey,gssapi-keyex,gssapi-with-mic) I created new instance using fedora 17 amazon community image(ami-2ea50247). I copied my ssh keys under /home/usertest/.ssh/ after creating a usertest I have SELINUX=disabled here is Debug info: $ ssh -vvv ec2-54-243-101-41.compute-1.amazonaws.com ssh -vvv ec2-54-243-101-41.compute-1.amazonaws.com OpenSSH_5.2p1, OpenSSL 1.0.0b-fips 16 Nov 2010 debug1: Reading configuration data /etc/ssh/ssh_config debug1: Applying options for * debug2: ssh_connect: needpriv 0 debug1: Connecting to ec2-54-243-101-41.compute-1.amazonaws.com [54.243.101.41] port 22. debug1: Connection established. debug1: identity file /home/usertest/.ssh/identity type -1 debug1: identity file /home/usertest/.ssh/id_rsa type -1 debug3: Not a RSA1 key file /home/usertest/.ssh/id_dsa. debug2: key_type_from_name: unknown key type '-----BEGIN' debug3: key_read: missing keytype debug2: key_type_from_name: unknown key type 'Proc-Type:' debug3: key_read: missing keytype debug2: key_type_from_name: unknown key type 'DEK-Info:' debug3: key_read: missing keytype debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug2: key_type_from_name: unknown key type '-----END' debug3: key_read: missing keytype debug1: identity file /home/usertest/.ssh/id_dsa type 2 debug1: Remote protocol version 2.0, remote software version OpenSSH_5.9 debug1: match: OpenSSH_5.9 pat OpenSSH* debug1: Enabling compatibility mode for protocol 2.0 debug1: Local version string SSH-2.0-OpenSSH_5.2 debug2: fd 3 setting O_NONBLOCK debug1: SSH2_MSG_KEXINIT sent debug1: SSH2_MSG_KEXINIT received debug2: kex_parse_kexinit: diffie-hellman-group-exchange-sha256,diffie-hellman-group-exchange-sha1,diffie-hellman-group14-sha1,diffie-hellman-group1-sha1 debug2: kex_parse_kexinit: ssh-rsa,ssh-dss debug2: kex_parse_kexinit: aes128-ctr,aes192-ctr,aes256-ctr,arcfour256,arcfour128,aes128-cbc,3des-cbc,blowfish-cbc,cast128-cbc,aes192-cbc,aes256-cbc,arcfour,[email protected] debug2: kex_parse_kexinit: aes128-ctr,aes192-ctr,aes256-ctr,arcfour256,arcfour128,aes128-cbc,3des-cbc,blowfish-cbc,cast128-cbc,aes192-cbc,aes256-cbc,arcfour,[email protected] debug2: kex_parse_kexinit: hmac-md5,hmac-sha1,[email protected],hmac-ripemd160,[email protected],hmac-sha1-96,hmac-md5-96 debug2: kex_parse_kexinit: hmac-md5,hmac-sha1,[email protected],hmac-ripemd160,[email protected],hmac-sha1-96,hmac-md5-96 debug2: kex_parse_kexinit: none,[email protected],zlib debug2: kex_parse_kexinit: none,[email protected],zlib debug2: kex_parse_kexinit: debug2: kex_parse_kexinit: debug2: kex_parse_kexinit: first_kex_follows 0 debug2: kex_parse_kexinit: reserved 0 debug2: kex_parse_kexinit: diffie-hellman-group-exchange-sha256,diffie-hellman-group-exchange-sha1,diffie-hellman-group14-sha1,diffie-hellman-group1-sha1 debug2: kex_parse_kexinit: ssh-rsa,ssh-dss debug2: kex_parse_kexinit: aes128-ctr,aes192-ctr,aes256-ctr,arcfour256,arcfour128,aes128-cbc,3des-cbc,blowfish-cbc,cast128-cbc,aes192-cbc,aes256-cbc,arcfour,[email protected] debug2: kex_parse_kexinit: aes128-ctr,aes192-ctr,aes256-ctr,arcfour256,arcfour128,aes128-cbc,3des-cbc,blowfish-cbc,cast128-cbc,aes192-cbc,aes256-cbc,arcfour,[email protected] debug2: kex_parse_kexinit: hmac-md5,hmac-sha1,[email protected],hmac-sha2-256,hmac-sha2-256-96,hmac-sha2-512,hmac-sha2-512-96,hmac-ripemd160,[email protected],hmac-sha1-96,hmac-md5-96 debug2: kex_parse_kexinit: hmac-md5,hmac-sha1,[email protected],hmac-sha2-256,hmac-sha2-256-96,hmac-sha2-512,hmac-sha2-512-96,hmac-ripemd160,[email protected],hmac-sha1-96,hmac-md5-96 debug2: kex_parse_kexinit: none,[email protected] debug2: kex_parse_kexinit: none,[email protected] debug2: kex_parse_kexinit: debug2: kex_parse_kexinit: debug2: kex_parse_kexinit: first_kex_follows 0 debug2: kex_parse_kexinit: reserved 0 debug2: mac_setup: found hmac-md5 debug1: kex: server->client aes128-ctr hmac-md5 none debug2: mac_setup: found hmac-md5 debug1: kex: client->server aes128-ctr hmac-md5 none debug1: SSH2_MSG_KEX_DH_GEX_REQUEST(1024<1024<8192) sent debug1: expecting SSH2_MSG_KEX_DH_GEX_GROUP debug2: dh_gen_key: priv key bits set: 131/256 debug2: bits set: 506/1024 debug1: SSH2_MSG_KEX_DH_GEX_INIT sent debug1: expecting SSH2_MSG_KEX_DH_GEX_REPLY debug3: check_host_in_hostfile: filename /home/usertest/.ssh/known_hosts debug3: check_host_in_hostfile: match line 17 debug3: check_host_in_hostfile: filename /home/usertest/.ssh/known_hosts debug3: check_host_in_hostfile: match line 17 debug1: Host 'ec2-54-243-101-41.compute-1.amazonaws.com' is known and matches the RSA host key. debug1: Found key in /home/usertest/.ssh/known_hosts:17 debug2: bits set: 500/1024 debug1: ssh_rsa_verify: signature correct debug2: kex_derive_keys debug2: set_newkeys: mode 1 debug1: SSH2_MSG_NEWKEYS sent debug1: expecting SSH2_MSG_NEWKEYS debug2: set_newkeys: mode 0 debug1: SSH2_MSG_NEWKEYS received debug1: SSH2_MSG_SERVICE_REQUEST sent debug2: service_accept: ssh-userauth debug1: SSH2_MSG_SERVICE_ACCEPT received debug2: key: /home/usertest/.ssh/identity ((nil)) debug2: key: /home/usertest/.ssh/id_rsa ((nil)) debug2: key: /home/usertest/.ssh/id_dsa (0x7f904b5ae260) debug1: Authentications that can continue: publickey,gssapi-keyex,gssapi-with-mic debug3: start over, passed a different list publickey,gssapi-keyex,gssapi-with-mic debug3: preferred gssapi-with-mic,publickey,keyboard-interactive,password debug3: authmethod_lookup gssapi-with-mic debug3: remaining preferred: publickey,keyboard-interactive,password debug3: authmethod_is_enabled gssapi-with-mic debug1: Next authentication method: gssapi-with-mic debug3: Trying to reverse map address 54.243.101.41. debug1: Unspecified GSS failure. Minor code may provide more information Credentials cache file '/tmp/krb5cc_500' not found debug1: Unspecified GSS failure. Minor code may provide more information Credentials cache file '/tmp/krb5cc_500' not found debug1: Unspecified GSS failure. Minor code may provide more information debug2: we did not send a packet, disable method debug3: authmethod_lookup publickey debug3: remaining preferred: keyboard-interactive,password debug3: authmethod_is_enabled publickey debug1: Next authentication method: publickey debug1: Trying private key: /home/usertest/.ssh/identity debug3: no such identity: /home/usertest/.ssh/identity debug1: Trying private key: /home/usertest/.ssh/id_rsa debug3: no such identity: /home/usertest/.ssh/id_rsa debug1: Offering public key: /home/usertest/.ssh/id_dsa debug3: send_pubkey_test debug2: we sent a publickey packet, wait for reply debug1: Authentications that can continue: publickey,gssapi-keyex,gssapi-with-mic debug2: we did not send a packet, disable method debug1: No more authentication methods to try. Permission denied (publickey,gssapi-keyex,gssapi-with-mic).

    Read the article

  • Problems with this stack implementation

    - by Andersson Melo
    where is the mistake? My code here: typedef struct _box { char *dados; struct _box * proximo; } Box; typedef struct _pilha { Box * topo; }Stack; void Push(Stack *p, char * algo) { Box *caixa; if (!p) { exit(1); } caixa = (Box *) calloc(1, sizeof(Box)); caixa->dados = algo; caixa->proximo = p->topo; p->topo = caixa; } char * Pop(Stack *p) { Box *novo_topo; char * dados; if (!p) { exit(1); } if (p->topo==NULL) return NULL; novo_topo = p->topo->proximo; dados = p->topo->dados; free(p->topo); p->topo = novo_topo; return dados; } void StackDestroy(Stack *p) { char * c; if (!p) { exit(1); } c = NULL; while ((c = Pop(p)) != NULL) { free(c); } free(p); } int main() { int conjunto = 1; char p[30]; int flag = 0; Stack *pilha = (Stack *) calloc(1, sizeof(Stack)); FILE* arquivoIN = fopen("L1Q3.in","r"); FILE* arquivoOUT = fopen("L1Q3.out","w"); if (arquivoIN == NULL) { printf("Erro na leitura do arquivo!\n\n"); exit(1); } fprintf(arquivoOUT,"Conjunto #%d\n",conjunto); while (fscanf(arquivoIN,"%s", p) != EOF ) { if (pilha->topo == NULL && flag != 0) { conjunto++; fprintf(arquivoOUT,"\nConjunto #%d\n",conjunto); } if(strcmp(p, "return") != 0) { Push(pilha, p); } else { p = Pop(pilha); if(p != NULL) { fprintf(arquivoOUT, "%s\n", p); } } flag = 1; } StackDestroy(pilha); return 0; } The Pop function returns the string value read from file. But is not correct and i don't know why.

    Read the article

  • Varnish "FetchError no backend connection" error

    - by clueless-anon
    Varnishlog: 0 CLI - Rd ping 0 CLI - Wr 200 19 PONG 1340829925 1.0 12 SessionOpen c 79.124.74.11 3063 :80 12 SessionClose c EOF 12 StatSess c 79.124.74.11 3063 0 1 0 0 0 0 0 0 0 CLI - Rd ping 0 CLI - Wr 200 19 PONG 1340829928 1.0 0 CLI - Rd ping 0 CLI - Wr 200 19 PONG 1340829931 1.0 12 SessionOpen c 108.62.115.226 46211 :80 12 ReqStart c 108.62.115.226 46211 467185881 12 RxRequest c GET 12 RxURL c / 12 RxProtocol c HTTP/1.0 12 RxHeader c User-Agent: Pingdom.com_bot_version_1.4_(http://www.pingdom.com/) 12 RxHeader c Host: www.mysite.com 12 VCL_call c recv lookup 12 VCL_call c hash 12 Hash c / 12 Hash c www.mysite.com 12 VCL_return c hash 12 VCL_call c miss fetch 12 FetchError c no backend connection 12 VCL_call c error deliver 12 VCL_call c deliver deliver 12 TxProtocol c HTTP/1.1 12 TxStatus c 503 12 TxResponse c Service Unavailable 12 TxHeader c Server: Varnish 12 TxHeader c Content-Type: text/html; charset=utf-8 12 TxHeader c Retry-After: 5 12 TxHeader c Content-Length: 418 12 TxHeader c Accept-Ranges: bytes 12 TxHeader c Date: Wed, 27 Jun 2012 20:45:31 GMT 12 TxHeader c X-Varnish: 467185881 12 TxHeader c Age: 1 12 TxHeader c Via: 1.1 varnish 12 TxHeader c Connection: close 12 Length c 418 12 ReqEnd c 467185881 1340829931.192433119 1340829931.891024113 0.000051022 0.698516846 0.000074035 12 SessionClose c error 12 StatSess c 108.62.115.226 46211 1 1 1 0 0 0 256 418 0 CLI - Rd ping 0 CLI - Wr 200 19 PONG 1340829934 1.0 0 CLI - Rd ping 0 CLI - Wr 200 19 PONG 1340829937 1.0 netstat -tlnp Active Internet connections (only servers) Proto Recv-Q Send-Q Local Address Foreign Address State PID/Program name tcp 0 0 0.0.0.0:8080 0.0.0.0:* LISTEN 3086/nginx tcp 0 0 0.0.0.0:80 0.0.0.0:* LISTEN 1915/varnishd tcp 0 0 0.0.0.0:22 0.0.0.0:* LISTEN 1279/sshd tcp 0 0 127.0.0.2:25 0.0.0.0:* LISTEN 3195/sendmail: MTA: tcp 0 0 127.0.0.2:6082 0.0.0.0:* LISTEN 1914/varnishd tcp 0 0 127.0.0.2:9000 0.0.0.0:* LISTEN 1317/php-fpm.conf) tcp 0 0 127.0.0.2:3306 0.0.0.0:* LISTEN 1192/mysqld tcp 0 0 127.0.0.2:587 0.0.0.0:* LISTEN 3195/sendmail: MTA: tcp 0 0 127.0.0.2:11211 0.0.0.0:* LISTEN 3072/memcached tcp6 0 0 :::8080 :::* LISTEN 3086/nginx tcp6 0 0 :::80 :::* LISTEN 1915/varnishd tcp6 0 0 :::22 :::* LISTEN 1279/sshd /etc/nginx/site-enabled/default server { listen 8080; ## listen for ipv4; this line is default and implied listen [::]:8080 default ipv6only=on; ## listen for ipv6 root /usr/share/nginx/www; index index.html index.htm index.php; # Make site accessible from http://localhost/ server_name localhost; location / { # First attempt to serve request as file, then # as directory, then fall back to index.html try_files $uri $uri/ /index.html; } location /doc { root /usr/share; autoindex on; allow 127.0.0.2; deny all; } location /images { root /usr/share; autoindex off; } #error_page 404 /404.html; # redirect server error pages to the static page /50x.html # #error_page 500 502 503 504 /50x.html; #location = /50x.html { # root /usr/share/nginx/www; #} # proxy the PHP scripts to Apache listening on 127.0.0.1:80 # #location ~ \.php$ { # proxy_pass http://127.0.0.1; #} # pass the PHP scripts to FastCGI server listening on 127.0.0.1:9000 # location ~ \.php$ { fastcgi_pass 127.0.0.2:9000; fastcgi_index index.php; include fastcgi_params; } # deny access to .htaccess files, if Apache's document root # concurs with nginx's one # #location ~ /\.ht { # deny all; #} } /etc/nginx/sites-enabled/www.mysite.com.vhost server { listen 8080; server_name www.mysite.com mysite.com.net; root /var/www/www.mysite.com/web; if ($http_host != "www.mysite.com") { rewrite ^ http://www.mysite.com$request_uri permanent; } index index.php index.html; location = /favicon.ico { log_not_found off; access_log off; } location = /robots.txt { allow all; log_not_found off; access_log off; } # Deny all attempts to access hidden files such as .htaccess, .htpasswd, .DS_Store (Mac). location ~ /\. { deny all; access_log off; log_not_found off; } location / { try_files $uri $uri/ /index.php?$args; } # Add trailing slash to */wp-admin requests. rewrite /wp-admin$ $scheme://$host$uri/ permanent; location ~* \.(jpg|jpeg|png|gif|css|js|ico)$ { expires max; log_not_found off; } location ~ \.php$ { try_files $uri =404; include /etc/nginx/fastcgi_params; fastcgi_pass 127.0.0.2:9000; fastcgi_param SCRIPT_FILENAME $document_root$fastcgi_script_name; } include /var/www/www.mysite.com/web/nginx.conf; location ~ /nginx.conf { deny all; access_log off; log_not_found off; } } /etc/varnish/default.vcl # This is a basic VCL configuration file for varnish. See the vcl(7) # man page for details on VCL syntax and semantics. # # Default backend definition. Set this to point to your content # server. # backend default { .host = "127.0.0.2"; .port = "8080"; # .connect_timeout = 600s; #.first_byte_timeout = 600s; # .between_bytes_timeout = 600s; # .max_connections = 800; Note: uncommenting the last four options at default.vcl made no difference. cat /etc/default/varnish # Configuration file for varnish # # /etc/init.d/varnish expects the variables $DAEMON_OPTS, $NFILES and $MEMLOCK # to be set from this shell script fragment. # # Should we start varnishd at boot? Set to "yes" to enable. START=yes # Maximum number of open files (for ulimit -n) NFILES=131072 # Maximum locked memory size (for ulimit -l) # Used for locking the shared memory log in memory. If you increase log size, # you need to increase this number as well MEMLOCK=82000 # Default varnish instance name is the local nodename. Can be overridden with # the -n switch, to have more instances on a single server. INSTANCE=$(uname -n) # This file contains 4 alternatives, please use only one. ## Alternative 1, Minimal configuration, no VCL # # Listen on port 6081, administration on localhost:6082, and forward to # content server on localhost:8080. Use a 1GB fixed-size cache file. # # DAEMON_OPTS="-a :6081 \ # -T localhost:6082 \ # -b localhost:8080 \ # -u varnish -g varnish \ # -S /etc/varnish/secret \ # -s file,/var/lib/varnish/$INSTANCE/varnish_storage.bin,1G" ## Alternative 2, Configuration with VCL # # Listen on port 6081, administration on localhost:6082, and forward to # one content server selected by the vcl file, based on the request. Use a 1GB # fixed-size cache file. # DAEMON_OPTS="-a :80 \ -T 127.0.0.2:6082 \ -f /etc/varnish/default.vcl \ -S /etc/varnish/secret \ -s file,/var/lib/varnish/$INSTANCE/varnish_storage.bin,1G" If you need any other info let me know. I am all out of clue as to whats the problem.

    Read the article

  • strchr in objective C?

    - by Brian Postow
    I'm trying to write the equivalent of strchr, but with NSStrings... I've currently got this: Boolean nsstrchr(NSString* s, char c) { NSString *tmps = [NSString stringWithFormat: @"%c", c]; NSCharacterSet *cSet = [NSCharacterSet characterSetWithCharactersInString: tmps]; NSRange rg = [s rangeOfCharacterFromSet: cSet]; return rg.location != NSNotFound; } This seems needlessly complex... Is there a way to do this (preferably, one that doesn't involve turning the NSString into a cstring which doubles the run time, or writing it myself using characterAtIndex:... Am I missing some obvious method in the NSString description?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • endsWith in javascript

    - by Bobby Kumar
    How can I check if a string ends with a particular character in javascript? example I have a string say var str = "mystring#"; I want to know if that string str is ending with "#". How can I check it? is there a endsWith() method in javascript? one solution I have is take the length of the string and get the last character and check it. Is this the best way or there is any other way?

    Read the article

  • reading a string with spaces with sscanf

    - by SDLFunTimes
    For a project I'm trying to read an int and a string from a string. The only problem is sscanf appears to break reading an %s when it sees a space. Is there anyway to get around this limitation? Here's an example of what I'm trying to do: #include<stdio.h> #include<stdlib.h> int main(int argc, char** argv) { int age; char* buffer; buffer = malloc(200 * sizeof(char)); sscanf("19 cool kid", "%d %s", &age, buffer); printf("%s is %d years old\n", buffer, age); return 0; } What it prints is: "cool is 19 years old" where I need "cool kid is 19 years old". Does anyone know how to fix this?

    Read the article

  • I-Phone: Trying to check an Array for an item based on a string produced

    - by MB
    Hello! I'm writing a program that will concatenate a string based on letters, and then check an array to see if that string exists. If it does, then it will print a line in IB saying so. I've got all the ins-and-outs worked out, save for the fact that the simulator keeps crashing on me! Here's the code: -(IBAction)checkWord:(id)sender { NSMutableArray *wordList = [NSMutableArray arrayWithObjects:@"BIKE", @"BUS", @"BILL", nil]; if([wordList containsObject:theWord]) { NSString *dummyText = [[NSString alloc] initWithFormat:@"%@ is a real word.", theWord]; checkText.text = dummyText; [dummyText release]; } } "theWord" is the string that is being referenced against the Array to see if it matches an item contained within it. In this case "BIKE" is 'theWord'. Thank you for your help in advance! -MB

    Read the article

  • Counting longest occurence of repeated sequence in Python

    - by user248237
    What's the easiest way to count the longest consecutive repeat of a certain character in a string? For example, the longest consecutive repeat of "b" in the following string: my_str = "abcdefgfaabbbffbbbbbbfgbb" would be 6, since other consecutive repeats are shorter (3 and 2, respectively.) How can I do this in Python? thanks.

    Read the article

  • why string is a reference type?

    - by saurabh
    We know that string is a reference type , so we have string s="God is great!"; but on the same note if i declare class say Employee which is a reference type so why below piece of code does not work ? Employee e = "Saurabh"; 2- How do we actually determine if a type is a reference type or value type?

    Read the article

  • Create a string with the result of an expression and the expression that originated the value. Is it

    - by Oscar Reyes
    Like String r = SomeThing.toExecString("new Object().toString()"); And when executed the value of r would be: "new Object().toString() = java.lang.Object@c5e3974" Is this even possible at all? Would it need a bunch of reflection? A built in compiler maybe? AFAIK, this is not possible with regular Java. The closest thing I could get is IDE support like in IDEA with the "macro" soutv+tab that prints: Hit taband type the expression The IDE types the rest for you. But that's quite another completely thing.

    Read the article

  • PHP-REGEX: accented letters matches non-accented ones, and visceversa. How to achive it?

    - by Lightworker
    I want to do the typical higlight code. So I have something like: $valor = preg_replace("/(".$_REQUEST['txt_search'].")/iu", "<span style='background-color:yellow; font-weight:bold;'>\\1</span>", $valor); Now, the request word could be something like "josé". And with it, I want "jose" or "JOSÉ" or "José" or ... highlighted too. With this expression, if I write "josé", it matches "josé" and "JOSÉ" (and all the case variants). It always matches the accented variants only. If I search "jose", it matches "JOSE", "jose", "Jose"... but not the accented ones. So I've partially what I want, cause I have case insensitive on accented and non-accented separately. I need it fully combined, wich means accent (unicode) insensitive, so I can search "jose", and highlight "josé", "josÉ", "José", "JOSE", "JOSÉ", "JoSé", ... I don't want to do a replace of accents on the word, cause when I print it on screen I need to see the real word as it comes. Any ideas? Thanks!

    Read the article

  • split string error in a compiled VB.NET class

    - by Andy Payne
    I'm having some trouble compiling some VB code I wrote to split a string based on a set of predefined delimeters (comma, semicolon, colon, etc). I have successfully written some code that can be loaded inside a custom VB component (I place this code inside a VB.NET component in a plug-in called Grasshopper) and everything works fine. For instance, let's say my incoming string is "123,456". When I feed this string into the VB code I wrote, I get a new list where the first value is "123" and the second value is "456". However, I have been trying to compile this code into it's own class so I can load it inside Grasshopper separately from the standard VB component. When I try to compile this code, it isn't separating the string into a new list with two values. Instead, I get a message that says "System.String []". Do you guys see anything wrong in my compile code? You can find an screenshot image of my problem at the following link: click to see image This is the VB code for the compiled class: Public Class SplitString Inherits GH_Component Public Sub New() MyBase.New("Split String", "Split", "Splits a string based on delimeters", "FireFly", "Serial") End Sub Public Overrides ReadOnly Property ComponentGuid() As System.Guid Get Return New Guid("3205caae-03a8-409d-8778-6b0f8971df52") End Get End Property Protected Overrides ReadOnly Property Internal_Icon_24x24() As System.Drawing.Bitmap Get Return My.Resources.icon_splitstring End Get End Property Protected Overrides Sub RegisterInputParams(ByVal pManager As Grasshopper.Kernel.GH_Component.GH_InputParamManager) pManager.Register_StringParam("String", "S", "Incoming string separated by a delimeter like a comma, semi-colon, colon, or forward slash", False) End Sub Protected Overrides Sub RegisterOutputParams(ByVal pManager As Grasshopper.Kernel.GH_Component.GH_OutputParamManager) pManager.Register_StringParam("Tokenized Output", "O", "Tokenized Output") End Sub Protected Overrides Sub SolveInstance(ByVal DA As Grasshopper.Kernel.IGH_DataAccess) Dim myString As String DA.GetData(0, myString) myString = myString.Replace(",", "|") myString = myString.Replace(":", "|") myString = myString.Replace(";", "|") myString = myString.Replace("/", "|") myString = myString.Replace(")(", "|") myString = myString.Replace("(", String.Empty) myString = myString.Replace(")", String.Empty) Dim parts As String() = myString.Split("|"c) DA.SetData(0, parts) End Sub End Class This is the custom VB code I created inside Grasshopper: Private Sub RunScript(ByVal myString As String, ByRef A As Object) myString = myString.Replace(",", "|") myString = myString.Replace(":", "|") myString = myString.Replace(";", "|") myString = myString.Replace("/", "|") myString = myString.Replace(")(", "|") myString = myString.Replace("(", String.Empty) myString = myString.Replace(")", String.Empty) Dim parts As String() = myString.Split("|"c) A = parts End Sub ' ' End Class

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 82 83 84 85 86 87 88 89 90 91 92 93  | Next Page >