Search Results

Search found 4670 results on 187 pages for 'jvm arguments'.

Page 88/187 | < Previous Page | 84 85 86 87 88 89 90 91 92 93 94 95  | Next Page >

  • Can a single argument constructor with a default value be subject to implicit type conversion

    - by Richard
    I understand the use of the explicit keyword to avoid the implicit type conversions that can occur with a single argument constructor, or with a constructor that has multiple arguments of which only the first does not have a default value. However, I was wondering, does a single argument constructor with a default value behave the same as one without a default value when it comes to implicit conversions?

    Read the article

  • Scala: is it possible to override default case class constructor?

    - by adam77
    Just wondering if this is possible. What I would actually like to do is check and possibly modify one of the arguments before it is stored as a val. Alternatively, I could use an overload and make the default constructor private. In which case I would also like to make private the default factory constructor in the companion object, how would I do that? Many thanks. Adam

    Read the article

  • Javascript: Inline function vs predefined functions

    - by glaz666
    Can any body throw me some arguments for using inline functions against passing predefined function name to some handler. I.e. which is better: (function(){ setTimeout(function(){ /*some code here*/ }, 5); })(); versus (function(){ function invokeMe() { /*code*/ } setTimeout(invokeMe, 5); })(); Strange question, but we are almost fighting in the team about this

    Read the article

  • How do I use a custom #theme function to a fieldset in a drupal module?

    - by Rob Crowell
    I have a module that builds a form that includes a fieldset. Instead of using the <legend> element to render the fieldset title, I want to place this content in a <div> element instead. But I want to change the behavior only for the form returned by my module, so I don't want to place any new functionality into my theme's template.php file. In mymod.module I have defined: // custom rendering function for fieldset elements function theme_mymod_fieldset($element) { return 'test'; } // implement hook_theme function mymod_theme() { return array( 'mymod_fieldset' => array('arguments' => array('element' => NULL)), 'mymod_form' => array('arguments' => array()) ); } // return a form that is based on the 'Basic Account Info' category of the user profile function mymod_form() { // load the user's profile global $user; $account = user_load($user->uid); // load the profile form, and then edit it $form_state = array(); $form = drupal_retrieve_form('user_profile_form', $form_state, $account, 'Basic Account Info'); // set the custom #theme function for this fieldset $form['Basic Account Info']['#theme'] = 'mymod_fieldset'; // more form manipulations // ... return $form; } When my page gets rendered, I expected to see the fieldset representing 'Basic Account Info' to be wholly replaced by my test message 'test'. Instead what happens is that the <fieldset> and <legend> elements are rendered as normal, but with the body of the fieldset replaced by the test message instead, like this: <fieldset> <legend>Basic Account Info</legend> test </fieldset> Why doesn't my #theme function have the chance to replace the entire <fieldset> element? If I wrap a textfield in this function instead, I am able to completely replace the <input> element along with its label. Furthermore, if I provide an override in my site's template.php for theme_fieldset, it works as expected and I am able to completely replace the <fieldset>, so I know it is possible. What's different about providing #theme functions to fieldsets inside a module?

    Read the article

  • Good policy to force all developers in a company to use the same IDE?

    - by Henrik
    In my organization they are thinking about rolling out Eclipse company wide but I prefer using another editor (UltraEdit). I do not have any good arguments against this except subjective opinions that a developer should get to use whatever he/she wants as long as he's productive enough. This to make the developer a happy employee :-) Do you guys think its a good policy to force all developers in the same company to use the same IDE? Would there be any technical (dis)advantages of this decision?

    Read the article

  • Which style is preferable when writing this boolean expression?

    - by Jeppe Stig Nielsen
    I know this question is to some degree a matter of taste. I admit this is not something I don't understand, it's just something I want to hear others' opinion about. I need to write a method that takes two arguments, a boolean and a string. The boolean is in a sense (which will be obvious shortly) redundant, but it is part of a specification that the method must take in both arguments, and must raise an exception with a specific message text if the boolean has the "wrong" value. The bool must be true if and only if the string is not null or empty. So here are some different styles to write (hopefully!) the same thing. Which one do you find is the most readable, and compliant with good coding practice? // option A: Use two if, repeat throw statement and duplication of message string public void SomeMethod(bool useName, string name) { if (useName && string.IsNullOrEmpty(name)) throw new SomeException("..."); if (!useName && !string.IsNullOrEmpty(name)) throw new SomeException("..."); // rest of method } // option B: Long expression but using only && and || public void SomeMethod(bool useName, string name) { if (useName && string.IsNullOrEmpty(name) || !useName && !string.IsNullOrEmpty(name)) throw new SomeException("..."); // rest of method } // option C: With == operator between booleans public void SomeMethod(bool useName, string name) { if (useName == string.IsNullOrEmpty(name)) throw new SomeException("..."); // rest of method } // option D1: With XOR operator public void SomeMethod(bool useName, string name) { if (!(useName ^ string.IsNullOrEmpty(name))) throw new SomeException("..."); // rest of method } // option D2: With XOR operator public void SomeMethod(bool useName, string name) { if (useName ^ !string.IsNullOrEmpty(name)) throw new SomeException("..."); // rest of method } Of course you're welcome to suggest other possibilities too. Message text "..." would be something like "If 'useName' is true a name must be given, and if 'useName' is false no name is allowed".

    Read the article

  • JQuery UI popup elements not positioning correctly

    - by Okku
    I am using both JQuery UI Dialog and JQuery UI autocomplete both have the same erroneous behavior when they popup, the position is always 0,0! I have tried some different position arguments when popping up the dialog but non seems to help. Any clues? Is this a bug in the position calculation in JQuery? Or is this some css bug? Versions are 1.4.2 and 1.8.0

    Read the article

  • Remove first and last characters from a string in Lisp

    - by powerj1984
    I am passing in command line arguments to my Lisp program and they are formatted like this when they hit my main function: ("1 1 1" "dot" "2 2 2") I have a dot function and would like to call it directly from the argument, but first I must strip the " characters. I tried variations of this function: (defun remove-quotes (s) (setf (aref s 0) '"")) to no avail, Lisp complains that "" is not a member of base-char. Thanks!

    Read the article

  • Simulating "focus" and "blur" in jQuery .live() method...

    - by Jonathan Sampson
    Update: As of jQuery 1.4, $.live() now supports focusin and focusout events. jQuery currently1 doesn't support "blur" or "focus" as arguments for the $.live() method. What type of work-around could I implement to achieve the following: $("textarea") .live("focus", function() { foo = "bar"; }) .live("blur", function() { foo = "fizz"; }); 1. 07/29/2009, version 1.3.2

    Read the article

  • how get fully result from Asynchronism communication?

    - by rima
    Hi all refer to these post : here1 and here2 at last I solve my problem by build a asynchronous solution,and it work well!!! but there is a problem that i face with it,now my code is like this: class MyProcessStarter { private Process process; private StreamWriter myStreamWriter; private static StringBuilder shellOutput = null; public String GetShellOutput { get { return shellOutput.ToString(); }} public MyProcessStarter(){ shellOutput = new StringBuilder(""); process = new Process(); process.StartInfo.FileName = "sqlplus"; process.StartInfo.UseShellExecute = false; process.StartInfo.CreateNoWindow = true; process.OutputDataReceived += new DataReceivedEventHandler(ShellOutputHandler); process.StartInfo.RedirectStandardInput = true; process.StartInfo.RedirectStandardOutput = true; //process.StartInfo.RedirectStandardError = true; process.Start(); myStreamWriter = process.StandardInput; process.BeginOutputReadLine(); } private static void ShellOutputHandler(object sendingProcess,DataReceivedEventArgs outLine) { if (!String.IsNullOrEmpty(outLine.Data)) shellOutput.Append(Environment.NewLine + outLine.Data); } public void closeConnection() { myStreamWriter.Close(); process.WaitForExit(); process.Close(); } public void RunCommand(string arguments) { myStreamWriter.WriteLine(arguments); myStreamWriter.Flush(); process.WaitForExit(100); Console.WriteLine(shellOutput); Console.WriteLine("============="+Environment.NewLine); process.WaitForExit(2000); Console.WriteLine(shellOutput); } } and my input is like this: myProcesStarter.RunCommand("myusername/mypassword"); Console.writeline(myProcesStarter.GetShellOutput); but take a look at my out put: SQL*Plus: Release 11.1.0.6.0 - Production on Thu May 20 11:57:38 2010 Copyright (c) 1982, 2007, Oracle. All rights reserved. ============= SQL*Plus: Release 11.1.0.6.0 - Production on Thu May 20 11:57:38 2010 Copyright (c) 1982, 2007, Oracle. All rights reserved. Enter user-name: Connected to: Oracle Database 11g Enterprise Edition Release 11.1.0.6.0 - Production With the Partitioning, OLAP, Data Mining and Real Application Testing options as u see the output for run a function is not same in different time!So now would you do me a faver and help me that how I can wait until all the output done in other mean how I can customize my process to wait until output finishing ?? because I want to write a sqlcompiler so I need the exact output of shell. plz help me soon.thanxxxxxxxxxxxx :X

    Read the article

  • LINQ Query returns nothing.

    - by gtas
    Why is this query returns 0 lines? There is a record matching the arguments. Deafkaw.Where(p => (p.ImerominiaKataxorisis >= aDate && p.ImerominiaKataxorisis <= DateTime.Now) && (p.Year == etos && p.IsYpodeigma == false) ).ToList(); Am i missing something?

    Read the article

  • Running Java CORBA Client on Unix

    - by Benny
    I'm trying to run a Java application I wrote to subscribe to a CORBA event service. It runs OK on my Windows machine, but as soon as I deploy it to the UNIX server, it gives me an org.omg.CORBA.NO_IMPLEMENT exception. Any ideas as to why this might be happening? I'm using JacORB on my Windows machine and passing VM arguments to initialize the client ORB, but I'm not sure how to do that on UNIX and if it's even necessary. Thanks in advance!

    Read the article

  • Passing BLOB/CLOB as parameter to PL/SQL function

    - by Ula Krukar
    I have this procedure i my package: PROCEDURE pr_export_blob( p_name IN VARCHAR2, p_blob IN BLOB, p_part_size IN NUMBER); I would like for parameter p_blob to be either BLOB or CLOB. When I call this procedure with BLOB parameter, everything is fine. When I call it with CLOB parameter, I get compilation error: PLS-00306: wrong number or types of arguments in call to 'pr_export_blob' Is there a way to write a procedure, that can take either of those types as parameter? Some kind of a superclass maybe?

    Read the article

  • How can I implement NotOfType<T> in LINQ that has a nice calling syntax?

    - by Lette
    I'm trying to come up with an implementation for NotOfType, which has a readable call syntax. NotOfType should be the complement to OfType<T> and would consequently yield all elements that are not of type T My goal was to implement a method which would be called just like OfType<T>, like in the last line of this snippet: public abstract class Animal {} public class Monkey : Animal {} public class Giraffe : Animal {} public class Lion : Animal {} var monkey = new Monkey(); var giraffe = new Giraffe(); var lion = new Lion(); IEnumerable<Animal> animals = new Animal[] { monkey, giraffe, lion }; IEnumerable<Animal> fewerAnimals = animals.NotOfType<Giraffe>(); However, I can not come up with an implementation that supports that specific calling syntax. This is what I've tried so far: public static class EnumerableExtensions { public static IEnumerable<T> NotOfType<T>(this IEnumerable<T> sequence, Type type) { return sequence.Where(x => x.GetType() != type); } public static IEnumerable<T> NotOfType<T, TExclude>(this IEnumerable<T> sequence) { return sequence.Where(x => !(x is TExclude)); } } Calling these methods would look like this: // Animal is inferred IEnumerable<Animal> fewerAnimals = animals.NotOfType(typeof(Giraffe)); and // Not all types could be inferred, so I have to state all types explicitly IEnumerable<Animal> fewerAnimals = animals.NotOfType<Animal, Giraffe>(); I think that there are major drawbacks with the style of both of these calls. The first one suffers from a redundant "of type/type of" construct, and the second one just doesn't make sense (do I want a list of animals that are neither Animals nor Giraffes?). So, is there a way to accomplish what I want? If not, could it be possible in future versions of the language? (I'm thinking that maybe one day we will have named type arguments, or that we only need to explicitly supply type arguments that can't be inferred?) Or am I just being silly?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Other ternary operators besides ternary conditional (?:)

    - by Malcolm
    The "ternary operator" expression is now almost equivalent to the ternary conditional operator: condition ? trueExpression : falseExpression; However, "ternary operator" only means that it takes three arguments. I'm just curious, are there any languages with any other built-in ternary operators besides conditional operator and which ones?

    Read the article

< Previous Page | 84 85 86 87 88 89 90 91 92 93 94 95  | Next Page >