Search Results

Search found 417 results on 17 pages for 'overlapping'.

Page 9/17 | < Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >

  • Flash Animation and Sound Loop

    - by Joseph
    ok so im having an issue with Flash CS5. I have a sound looping, and my animation is only 13 frames long, while the song is like a minute long, so each time the animation loops threw the default "Loop Playback" a new sound audio is played which os overlapping the previous over and over causing a massive echo effect. Whats the best way to loop both of them insync, or atleast copy and paste the animations frames and make it the length of the song?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to host 50 domains/sites with common Django code base

    - by Off Rhoden
    I have 50 different websites that use the same layout and code base, but mostly non-overlapping data (regional support sites, not link farm). Is there a way to have a single installation of the code and run all 50 at the same time? When I have a bug to fix (or deploy new feature), I want to deploy ONE time + 1 restart and be done with it. Also: Code needs to know what domain the request is coming to so the appropriate data is displayed.

    Read the article

  • Tababar application in iphone

    - by Harita
    hi i am making an tabbar application in which i have 4 tabbars. tabbars are working perfectly, my problem is that the title is overlapping over other tab bar. Title are a bit long like Instructional Videos. how can i fix it.

    Read the article

  • I want to add ranges of rates for which I have a particular %

    - by happy
    My problem is I should add rates without overlapping and if a range of rates is missed while adding a new range I should display a message saying the range is missed. Example: 200 300 ----- 3% 300 400 ------5% and if I am adding new range, say 600 800 ------10% I should get a message saying the ranges 401 to 599 is missing.

    Read the article

  • How can a code editor effectively hint at code nesting level - without using indentation?

    - by pgfearo
    I've written an XML text editor that provides 2 view options for the same XML text, one indented (virtually), the other left-justified. The motivation for the left-justified view is to help users 'see' the whitespace characters they're using for indentation of plain-text or XPath code without interference from indentation that is an automated side-effect of the XML context. I want to provide visual clues (in the non-editable part of the editor) for the left-justified mode that will help the user, but without getting too elaborate. I tried just using connecting lines, but that seemed too busy. The best I've come up with so far is shown in a mocked up screenshot of the editor below, but I'm seeking better/simpler alternatives (that don't require too much code). [Edit] Taking the heatmap idea (from: @jimp) I get this and 3 alternatives - labelled a, b and c: The following section describes the accepted answer as a proposal, bringing together ideas from a number of other answers and comments. As this question is now community wiki, please feel free to update this. NestView The name for this idea which provides a visual method to improve the readability of nested code without using indentation. Contour Lines The name for the differently shaded lines within the NestView The image above shows the NestView used to help visualise an XML snippet. Though XML is used for this illustration, any other code syntax that uses nesting could have been used for this illustration. An Overview: The contour lines are shaded (as in a heatmap) to convey nesting level The contour lines are angled to show when a nesting level is being either opened or closed. A contour line links the start of a nesting level to the corresponding end. The combined width of contour lines give a visual impression of nesting level, in addition to the heatmap. The width of the NestView may be manually resizable, but should not change as the code changes. Contour lines can either be compressed or truncated to keep acheive this. Blank lines are sometimes used code to break up text into more digestable chunks. Such lines could trigger special behaviour in the NestView. For example the heatmap could be reset or a background color contour line used, or both. One or more contour lines associated with the currently selected code can be highlighted. The contour line associated with the selected code level would be emphasized the most, but other contour lines could also 'light up' in addition to help highlight the containing nested group Different behaviors (such as code folding or code selection) can be associated with clicking/double-clicking on a Contour Line. Different parts of a contour line (leading, middle or trailing edge) may have different dynamic behaviors associated. Tooltips can be shown on a mouse hover event over a contour line The NestView is updated continously as the code is edited. Where nesting is not well-balanced assumptions can be made where the nesting level should end, but the associated temporary contour lines must be highlighted in some way as a warning. Drag and drop behaviors of Contour Lines can be supported. Behaviour may vary according to the part of the contour line being dragged. Features commonly found in the left margin such as line numbering and colour highlighting for errors and change state could overlay the NestView. Additional Functionality The proposal addresses a range of additional issues - many are outside the scope of the original question, but a useful side-effect. Visually linking the start and end of a nested region The contour lines connect the start and end of each nested level Highlighting the context of the currently selected line As code is selected, the associated nest-level in the NestView can be highlighted Differentiating between code regions at the same nesting level In the case of XML different hues could be used for different namespaces. Programming languages (such as c#) support named regions that could be used in a similar way. Dividing areas within a nesting area into different visual blocks Extra lines are often inserted into code to aid readability. Such empty lines could be used to reset the saturation level of the NestView's contour lines. Multi-Column Code View Code without indentation makes the use of a multi-column view more effective because word-wrap or horizontal scrolling is less likely to be required. In this view, once code has reach the bottom of one column, it flows into the next one: Usage beyond merely providing a visual aid As proposed in the overview, the NestView could provide a range of editing and selection features which would be broadly in line with what is expected from a TreeView control. The key difference is that a typical TreeView node has 2 parts: an expander and the node icon. A NestView contour line can have as many as 3 parts: an opener (sloping), a connector (vertical) and a close (sloping). On Indentation The NestView presented alongside non-indented code complements, but is unlikely to replace, the conventional indented code view. It's likely that any solutions adopting a NestView, will provide a method to switch seamlessly between indented and non-indented code views without affecting any of the code text itself - including whitespace characters. One technique for the indented view would be 'Virtual Formatting' - where a dynamic left-margin is used in lieu of tab or space characters. The same nesting-level data used to dynamically render the NestView could also used for the more conventional-looking indented view. Printing Indentation will be important for the readability of printed code. Here, the absence of tab/space characters and a dynamic left-margin means that the text can wrap at the right-margin and still maintain the integrity of the indented view. Line numbers can be used as visual markers that indicate where code is word-wrapped and also the exact position of indentation: Screen Real-Estate: Flat Vs Indented Addressing the question of whether the NestView uses up valuable screen real-estate: Contour lines work well with a width the same as the code editor's character width. A NestView width of 12 character widths can therefore accommodate 12 levels of nesting before contour lines are truncated/compressed. If an indented view uses 3 character-widths for each nesting level then space is saved until nesting reaches 4 levels of nesting, after this nesting level the flat view has a space-saving advantage that increases with each nesting level. Note: A minimum indentation of 4 character widths is often recommended for code, however XML often manages with less. Also, Virtual Formatting permits less indentation to be used because there's no risk of alignment issues A comparison of the 2 views is shown below: Based on the above, its probably fair to conclude that view style choice will be based on factors other than screen real-estate. The one exception is where screen space is at a premium, for example on a Netbook/Tablet or when multiple code windows are open. In these cases, the resizable NestView would seem to be a clear winner. Use Cases Examples of real-world examples where NestView may be a useful option: Where screen real-estate is at a premium a. On devices such as tablets, notepads and smartphones b. When showing code on websites c. When multiple code windows need to be visible on the desktop simultaneously Where consistent whitespace indentation of text within code is a priority For reviewing deeply nested code. For example where sub-languages (e.g. Linq in C# or XPath in XSLT) might cause high levels of nesting. Accessibility Resizing and color options must be provided to aid those with visual impairments, and also to suit environmental conditions and personal preferences: Compatability of edited code with other systems A solution incorporating a NestView option should ideally be capable of stripping leading tab and space characters (identified as only having a formatting role) from imported code. Then, once stripped, the code could be rendered neatly in both the left-justified and indented views without change. For many users relying on systems such as merging and diff tools that are not whitespace-aware this will be a major concern (if not a complete show-stopper). Other Works: Visualisation of Overlapping Markup Published research by Wendell Piez, dated from 2004, addresses the issue of the visualisation of overlapping markup, specifically LMNL. This includes SVG graphics with significant similarities to the NestView proposal, as such, they are acknowledged here. The visual differences are clear in the images (below), the key functional distinction is that NestView is intended only for well-nested XML or code, whereas Wendell Piez's graphics are designed to represent overlapped nesting. The graphics above were reproduced - with kind permission - from http://www.piez.org Sources: Towards Hermenutic Markup Half-steps toward LMNL

    Read the article

  • Blogging locally and globally–my experience

    - by DigiMortal
    In Baltic MVP Summit 2011 there was discussion about having two blogs - one for local and another for global audience – and how to publish once written information in these blogs. There are many ways how to optimize your blogging activities if you have more than one audience and here you can find my experiences, best practices and advices about this topic. My two blogs I have to working blogs: this one here technology and programming blog for local market My local blog is almost five years old and it makes it one of the oldest company blogs in Estonia. It is still active and I write there as much as I have time for it. This blog here is active since September 2007, so it is about 3.5 years old right now. Both of these blogs are  my major hits in my MVP carrier and they have very good web statistics too. My local blog My local blog is about programming, web and technology. It has way wider target audience then this blog here has. By example, in my local blog I blog also about local events, cool new concept phones, different webs providing some interesting services etc. But local guys can find there also my postings about how to solve one or another programming problem and postings about Microsoft technologies I am playing with. This far my local blog has a lot of readers for such a small country that Estonia is. This blog has made me a lot of cool contacts and I have had there a lot of interesting discussions about different technical topics. Why I started this blog? Living in small country is different than living in big country. In small country you have less people and therefore smaller audience so you have to target more than one technical topic to find enough readers. In a same time you are still interested in your main topics and you want to reach to more people who are sharing same interests with you. Practically one day y will grow out from local market and you go global. This is how this blog was born. Was it worth to create, promote and mess with it? Every second I have put on my time to this blog has been worth of it. Thanks to this blog I have found new good friends and without them I think it is more boring to work on different problems and solutions. Defining target audiences One thing you should always do when having more than one blog is defining target audiences. If you are just technomaniac interested in sharing your stuff and make some new friends and have something to write to your MVP nomination form then you don’t have to go through complex targeting process. You can do it simple way and same effectively. Here is how I defined target audiences to my blogs: local blog – reader of my local blog is IT professional, software developer, technology innovator or just some guy who is interested in technology,   this blog – reader of this blog is experienced professional software developer who works on Microsoft technologies or software developer who is open minded and open to new technologies and interesting solutions to development problems. You can see how local blog – due to small market with less people – has wider definition for audience while this blog is heavily targeted to Microsoft technologies and specially to software development. On practical side these decisions are also made well I think because it is very hard to build up popular common IT blog. On global level it is better to target some specific niche and find readers who are professionals on your favorite topics. Thanks to this blog I have found new friends who are professional developers and I am very happy about all the discussions I have had with them. Publishing content to different blogs My local blog and this blog have some overlapping topics like .NET, databases and SEO. Due to this overlapping there is question: when I write posting to my local blog then should I have to publish same thing in my global blog? And if I write something to my global blog then should I publish same thing also in my local blog? Well, it really depends on the definition of your target audiences. If they match then of course it is good idea to translate you post and publish it also to another blog. But if you have different audiences then you may need to modify your posting before publishing it. The questions you have to answer are: is target audience interested in this topic? is target audience expecting more specific and deeper handling of this topic or are they expecting more general handling of topic? is the problem you are discussing actual for target audience or not? You have to answer these questions and after that make your decision. If you need to modify your original posting then take some time and do it. Provide quality to all your readers because they will respect you if you respect them. Cross-posting and referencing It is tempting to save time that preparing some blog post takes and if you have are done with posting in one blog it may seem like good idea to make short posting to another blog and add reference to first one where topic is discussed longer. Well, don’t do it – all your readers expect good quality content from you and jumping from one blog post to another is disturbing for them. Of course, there is problem with differences between target audiences. You may have wider target audience and some people may be interested in more specific handling of topic. In this case feel free to refer your blog you are writing in english. This is not working very well in opposite direction because almost all my global blog readers understand english but not estonian. By example, estonian language is complex one and online translating tools make very poor translations from estonian language. This is why I don’t even plan to publish postings here that refer to my local blog for more information. I am keeping these two blogs as two different worlds and if there is posting that fits well to both blogs I will write my posting to one blog and then answer previous three questions before posting same thing to another blog. Conclusion Growing out of your local market is not anything mysterious if you are living in small country. As it is harder to find people there who are interested in same topics with you then sooner or later you will start finding these new contacts from global audience. Global audience is bigger and to be visible there you must provide high quality content to your audience. It is something you will learn over time and you will learn every day something new when you are posting to your global blog. You may ask: if global blog is much more complex thing to do then is it worth to do at all? My answer is: yes, do it for sure. It is not easy thing to do when you start but if you work on your global blog and improve it over time you will get over all obstacles pretty soon. Just don’t forget one thing – content is king and your readers expect high quality from you.

    Read the article

  • sudoers file cleanup and consolidation tool/script

    - by Prashanth Sundaram
    Hello All, I am curious to know what other folks out there might be using to keep the sudoers file in a sane manner. I am looking for a tool, that removes redundant entries, overlapping permissions and/or present sudoers file in a organized way(like sorting by permissions/users/Aliases) User_Alias RT1123 jappleseed, sjobs Host_Alias HOST_RT1123 wdc101.domain.com, wdc104.domain.com Cmnd_Alias ..... Our sudoers file is simple but a lot of entries and it needs to be cleaned up. Does anyone know/have a tool/script to fix/present it ? Thanks!

    Read the article

  • sudoers file cleanup and consolidation tool/script

    - by Prashanth Sundaram
    Hello All, I am curious to know what other folks out there might be using to keep the sudoers file in a sane manner. I am looking for a tool, that removes redundant entries, overlapping permissions and/or present sudoers file in a organized way(like sorting by permissions/users/Aliases). I use SVN and Confi Mgmt. tool to version control and deploy resp. Is there any add-on/plugin you would recommend/use? User_Alias RT1123 jappleseed, sjobs Host_Alias HOST_RT1123 wdc101.domain.com, wdc104.domain.com Cmnd_Alias ..... Our sudoers file is simple but a lot of entries and it needs to be cleaned up. Does anyone know/have a tool/script to fix/present it ? Thanks!

    Read the article

  • How to watch 3D on Acer "3D Ready" projector?

    - by glenneroo
    We have here a Acer P1200 DLP projector which is "3D Ready" (using the BrilliantColor™ DarkChip™ 3) and documentation was not included in the packaging. We don't have a Blu-ray player and have no intention of purchasing one in the near future so I'm looking for a way to view encoded or streamed content. My question is: How is it possible to watch 3D content? What extra hardware/software will I need? EDIT: Found this information in the user manual: DLP 3D function: Choose while using DLP 3D glasses, quad buffer (NVIDIA/ATI…) graphic card and HQFS format file or DVD with corresponding SW player. 3D Sync L/R: If you see a discrete or overlapping image while wearing DLP 3D glasses, you may need to execute "Invert" to get best match of left/ right image sequence to get the correct image (for DLP 3D). ...but I'm still at a loss. What is a quad buffer graphics card?

    Read the article

  • Issue with Ivan Heckman's allSnap

    - by karl
    For the longest time I have used Ivan Heckman's allSnap program to better manage Windows on my pc by making them easily snap together, instead of overlapping. However on Windows 8 I cannot seem to get this to work. I suspect it has something to do with how Win8 boarders seem to have a transparent pixel around the outside of the window padding boarder, but overall I would love to get the snapping functionality back if it is at all possible. It's very hard trying to find information about this online as all I find are posts talking about snapping Metro apps to the side of the screen in Desktop Mode.

    Read the article

  • What are the "software" requirements for a 3D video?

    - by Diogo Rocha
    Today, looking for the technical explanations about MPEG4, I saw that it can implement the VRML rendering for a 3D video. This makes me wondering about the "software" requirements to make or to see a 3D video. I mean, assuming that I have all the "hardware" requirements(3D monitor, VGA, 3D-camera, etc), what should I need to make and see 3D videos looking over the "software" side? Must I need to make it on MPEG4 instead MPEG1 or MPEG2 because of the VRML support? May I need a specifc 3D codec to open and see 3D videos?? Until today, I believed that a 3D video was just a regular/ordinary video composed of 2 "overlapping layers". PS: This is the first time I'm researching about technical explanations/references about MPEG standards and 3D videos, any help or basic explanations will help.

    Read the article

  • Certain web pages are suddenly not rendering properly in FireFox

    - by LeopardSkinPillBoxHat
    I am using FireFox 3.6.3. I noticed in the last couple of days that several webpages which I visit regularly are not rendering properly. A lot of the text is overlapping with other text and it basically looks like the style sheet is completely screwed up. I have tried disabling all of my Add-Ons and it doesn't make a difference. When I use Coral IE Tab to render the pages using IE they display without any problems. The websites which are not rending properly for me are: The Age Google Reader One interesting thing I noticed is that if I modify the Google Reader URL to not use SSL (i.e. change https to http) it renders without any issues. However, The Age website is not using SSL, and that still doesn't render properly. I have also disabled my Proxy Server (I normally use one at work) but this doesn't make a difference either.

    Read the article

  • Optimizing wireless router speed and minimizing interference.

    - by Tchalvak
    I've been experiencing problems with my wireless connectivity lately, and want to make sure that it's not related to the abundance of other wireless routers here in my building. So, what I'm looking for is a method (probably via some application or another) to audit the wireless channels (and other factors that might be important that I don't even know of yet) that are floating through the aether around me. Ubuntu or other linux apps are preferred, but some kind of windows/mac solution is possible, since I do have other OSes around me that I could install & test on. Router: netgear WGT624 v3 Hearsay tells me that channels 1, 6, and 11 are "non-overlapping" (I expect they aren't used for non-wireless-router purposes or something, not sure how they couldn't overlap with other routers using other channels), so perhaps my best choices of channel are limited, so if channels aren't really a big concern, I'd be happy to get links to other optimizations that I should look into.

    Read the article

  • Why does Task Scheduler NOT re-run successfully completed tasks

    - by Teo
    I am using Task Scheduler on Windows 2008 x64. I have 3 tasks, running every night on different times without overlapping. It works for some days - usually 2-3 up to 10 (it's really random), then it stops running the tasks. When I look at the history, I see that the tasks completed successfully. In the UI, the column "Next Run Time" stays empty. The tasks are set to run on background; the account for running them is a domain one - it is valid and enabled. When I check with Process Explorer, there are no left-over processes associated with my tasks. I am completely baffled at what's going on.

    Read the article

  • Windows Vista taskbar not resizing desktop

    - by Luke Schafer
    Hi, I recently started having a frustrating problem with Vista on my laptop that I can't seem to solve. I'm trying to get it to have the vanilla taskbar settings - always shown, resizes the desktop area (as in, the space the taskbar takes up isn't available for fullscreen windows), and always on top. No matter what combination of settings and toggles I do, I can't get it. With the normal settings that achieve this (Only keep on top, and optionally locked, checked), I get: Desktop extends behind the taskbar (so icons and the like are behind it) Non-maximised windows appear behind it when overlapping. Maximised windows take the full area of the screen and are behind the taskbar Maximised Google Chrome takes the full screen size and is in front of the taskbar I tried googling and also just randomly toggling on and off the settings, haven't found a fix.

    Read the article

  • VM Build XML file fails to validate against OVF 1.0 schema

    - by siddharthgod
    For our product, we were trying to generate VM / vApp build XML from java code. For this purpose, we were using XML Beans. When we tried to generate JAVA classes for OVF envelope for 0.9 (ovf-envelope.xsd in schemas/ovf) it was successful. However these schemas does not allow us to add IPassignment section which is available in OVF 1.0. When we tried to compile 1.0 schema (ovfenv-vmware.xsd in schemas/ovf1.0.0e/vmware folder), we get validation errors. When we loaded this schema in schema editor we could see some validation errors. First error we saw was following: When we loaded ovfenv-vmware.xsd in XMLspy we could see following validation error in dsp8027.xsd - "cos-nonambig: makes the content model non-deterministic against . Possible causes: name equality, overlapping occurrence or substitution groups." Same error was also thrown by xmlbean while generating java classes from ovfenv-vmware.xsd. Is there any workaround for this problem?

    Read the article

< Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >