Search Results

Search found 4625 results on 185 pages for 'split tunnel'.

Page 90/185 | < Previous Page | 86 87 88 89 90 91 92 93 94 95 96 97  | Next Page >

  • Adding google.maps.latlng within a loop

    - by Mick Morrison
    I am new to Java Script. I am using it, in combination with Java Server Faces. I want to add some points to define a Polilyne using GoogleMaps Apiv3. My problem is that I can't add a FOR statement to the javascript, because it dumps. If I comment this FOR loop, it also dumps. The dump I am getting is: "javax.servlet.ServletException: null source". Has anyone any suggestion to solve this? Thanks in advance, Emanuel <script type="text/javascript"> function initialize() { var longit = "${dateRange.longitude}" ; var lat = "${dateRange.latitude}" ; var latlng = new google.maps.LatLng(lat, longit); var myOptions = { zoom: 15, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP }; var map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); var points = []; var cadena1 = "${dateRange.latArray}" ; var cadena2 = "${dateRange.longArray}" ; var latArray = cadena1.split('?'); var longArray = cadena2.split('?'); /* The code Below is the one that fails */ for (var i=0; i < latArray.length; i++) { points.push(new google.maps.LatLng(latArray[i], longArray[i])); } /* Finish of the error code */ // The Polilyne is created var mapPath = new google.maps.Polyline ({ path: points, strokeColor: "#FF0000", strokeOpacity: 1.0, strokeWeight: 4 }); mapPath.setMap(map); } </script> </head> <body onload="initialize()"> <h:graphicImage url="http://localhost:8080/gps_tracking/faces/resources/images/logo.jpg"> </h:graphicImage> <h1 align="center">Sol-Tech</h1><br /> <hr></hr> <div id="map_canvas" style="width:100%; height:100%"></div> </body>

    Read the article

  • .net: does anyone know a free library to download nntp messages

    - by stighy
    hi folks, i'm using ip*works for download newsgroup message and insert them into a database... ipworks is "comfortable" to use because it automatically split nntp data return into different object (or variable). So i've "author" "date" "topic" "messagge" already splitted to my use. However ipworks isn't free and it cost a lot for my use.. so i'm asking you some component or code snippet to use to download and "manage" nntp messagges. Thanks in advance and regards!

    Read the article

  • Does it make sense to fragment cache static partials

    - by ash34
    Hi, I have my views and layouts split into multiple partials, some of them are static partials i.e, no data from the database being displayed here. Does it make sense to cache these to prevent the erb templating system from generating the html each time or it only makes sense to cache in situations where something needs to be retrieved from the db each time. thanks, ash

    Read the article

  • Proper HTML technique to create an web form out of an image

    - by Lars
    I plan to create an interactive golf score card for my website (XHTML). (Btw. thats how such a scorecard looks like: ScoreCard). So at the end one should be able to insert a score for each hole in the appropriated input field in the virtual scorecard on the website. For me it is very important that the interactive scorecard really looks the same as the original (paper-) scorecard does and so my first approach was to scan and slice the scorecard image to reach that appearance. Here you can see the way I sliced the image: The idea was to insert HTML text input for each score field ending up with something like this: After I sliced the image I reconstructed it using the HTML . To do that I put the image slices as the cell background. <table> <tr> <td style="background: url("slice1.jpg") width="58px" height="25px"> <input type="text"></inputText> </td> </tr> ... </table> At the first moment this worked fine (as Gimp offers quite a nice feature for this). Then the problem was that I had to create a HTML table to create the exact layout. As you can see the lower part of the layout is split up into 3 columns. The middle column is split up into several (for each hole) rows. So the left and right column have to be spanned over those rows. Ok finally that worked, but it lead to some kind of scaling problem. If I zoom in or out on the table the middle column (and only that one) is not scaled the right way. Iam not able to fix this, and so I start doubting if this is the right technique for html image virtualization. Iam really no specialist in the area of creating websites, so I would really appriciate any help on this. Maybe there is a complete other and better technique to do that, as I think it is a common job in webcreation. I couldnt find any nice examples or tuts on that.

    Read the article

  • working validation hint, working word counter but not working together

    - by Sriyani Rathnayaka
    I added a word counter to a my form's textarea... it is something like this... <div> <label>About you:</label> <textarea id="qualification" class="textarea hint_needed" rows="4" cols="30" ></textarea> <span class="hint">explain about you</span> <script type="text/javascript"> $("textarea").textareaCounter(); </script> </div> My problem is when I add textaracounter() like this my validation hint is not working.. when I remover the counter function validation hint is working... this is the jquery for hint message.. $(".hint").css({ "display":"none" }); $("input.hint_needed, select.hint_needed, textarea.hint_needed, radio.hint_needed").on("mouseenter", function() { $(this).next(".hint").css({ "display":"inline" }); }).on("mouseleave", function() { $(this).next(".hint").css({ "display":"none" }); }); this is for the word counter.. (function($){ $.fn.textareaCounter = function(options) { // setting the defaults // $("textarea").textareaCounter({ limit: 100 }); var defaults = { limit: 150 }; var options = $.extend(defaults, options); // and the plugin begins return this.each(function() { var obj, text, wordcount, limited; obj = $("#experience"); obj.after('<span style="font-weight: bold; color:#6a6a6a; clear: both; margin: 3px 0 0 150px; float: left; overflow: hidden;" id="counter-text">Max. '+options.limit+' words</span>'); obj.keyup(function() { text = obj.val(); if(text === "") { wordcount = 0; } else { wordcount = $.trim(text).split(" ").length; } if(wordcount > options.limit) { $("#counter-text").html('<span style="color: #DD0000;">0 words left</span>'); limited = $.trim(text).split(" ", options.limit); limited = limited.join(" "); $(this).val(limited); } else { $("#counter-text").html((options.limit - wordcount)+' words left'); } }); }); }; })(jQuery); can anybody tell me what is the problem there? Thank you..

    Read the article

  • How can I extract parts of this filename in Perl?

    - by devtech
    In my Excel sheet with column Changeset I am getting the changeset like: C:\ccviews\hgdasdff-9302\dfcsz\ahgrt\kjhssl\ASGHLS@@\main\ajsdkljlat\hahdasdhfk\1\test.txt\sub\hsdaklfl\3 I need to use split function in a Perl script so that there will be two ouput (input as the above string) the part before @@ (e.g-here C:\ccviews\hgdasdff-9302\dfcsz\ahgrt\kjhssl\ASGHLS) the last character of the string (e.g-here 3)

    Read the article

  • More elegant way to write this?

    - by tesmar
    Hi, I am trying to make a multi-dimensional array of characters in ruby, and this works, but is there a more elegant way? def initialize(text) @map = Array.new i = 0 text.split("\n").each do |x| @map[i] = x.scan(/./) i += 1 end #@map = text end#constructor

    Read the article

  • how to unpack the contents of a javascript file?

    - by altvali
    Hi all! You know how those packed js files look like, right? eval(function(p,a,c,k,e,d){ ... } ('obfuscated-string'.split('|'),0,{})) It just so happens to be that i have to tweak some large legacy code that looks like that and i want to find a way to turn this into a more readable version. If that's not possible, can i at least get rid of the eval?

    Read the article

  • How do I solve "405 Method Not Allowed" for our subversion setup?

    - by macke
    We're serving our source code using VisualSVN running on Windows Server 2003. Recently, we split a portion of a project into a new project in it's own repository, and then linked it back to the original project using svn:externals. Since then, we've been having issues when we try to commit files with Subclipse. The error we're getting is: svn: Commit failed (details follow): svn: PROPFIND of '/svn': 405 Method Not Allowed (https://svn.ourserver.com) Googling for a while didn't really help, our config seems to be correct. It should also be noted that we've been running this server for a while no without these problems and apart from splitting the project into two repositories, no changes have been made to the server (ie, config files are the same). It should also be noted that these errors only appear when we try to check in multiple files at once. If we check in one file at a time there are no errors. Also, it only appears in Subclipse as far as we know right now, Versions.app (OS X) seems to work fine so that is our current workaround. So, the questions is how do I analyze the error to find the cause and subsequently fix it? I'm by no means a svn guru and right now I'm clueless. EDIT: It seems we can check in multiple files in the same package, but not files from multiple packages. Also, when I "split" the project into two repositories, I imported the original repository with a new name. I did not do a dump and then import that dump. Could that be the source of our issues, and if so, how would I solve that? EDIT: After some jerking around it seems as though it is indeed related to when checking in files in different repositories. If I try to do a single commit in both Repo A and Repo B (referenced by svn:externals) at the same time, I get the error. Versions.app handles this correctly, but I guess it might just be doing two commits, not a single one. Subclipse fails miserably. For now, we simply do multiple commits, one for Repo A and one for Repo B, that works just fine. If anyone smarter than me could fill in the details why this is happening, whether or not this kind of setup is stupid etc, please go right ahead.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Are "proxy properties" good style?

    - by erlando
    I have a class with a string property that's actually several strings joined with a separator. I'm wondering if it is good form to have a proxy property like this: public string ActualProperty { get { return actualProperty; } set { actualProperty = value; } } public string[] IndividualStrings { get { return ActualProperty.Split(.....); } set { // join strings from array in propval .... ; ActualProperty = propval; } } Is there any risks I have overlooked?

    Read the article

  • How should I parse this simple text file in Java?

    - by Winston
    I have a text file that looks like this: grn129 agri- ac-214 ahss hud114 ahss lov1150 ahss lov1160 ahss lov1170 ahss lov1210 ahss What is the best way to parse this file using Java if I want to create a HashMap with the first column as the key and the second column as the value. Should I use the Scanner class? Try to read in the whole file as a string and split it? What is the best way?

    Read the article

  • Replace method doesn't work properly

    - by John Smith
    Hello I have a string and when i try to use replace method in for loop it doesn't work String phrase="hello friend"; String[] wordds=phrase.split(" "); String newPhrase="sup friendhello weirdo"; for (int g=0;g<2;g++) { finalPhrase+=newPhrase.replace(wordds[g],"");} } System.out.println(finalPhrase) It prints out "sup hello weirdo" and i expect it to print "sup weirdo". What am i doing wrong?

    Read the article

  • python - remove string from words in an array

    - by tekknolagi
    #!/usr/bin/python #this looks for words in dictionary that begin with 'in' and the suffix is a real word wordlist = [line.strip() for line in open('/usr/share/dict/words')] newlist = [] for word in wordlist: if word.startswith("in"): newlist.append(word) for word in newlist: word = word.split('in') print newlist how would I get the program to remove the string "in" from all the words that it starts with? right now it does not work

    Read the article

  • im writing a spellchecking program, how do i replace ch in a string..eg..

    - by Ajay Hopkins
    what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

    Read the article

  • Detect if a key does is bound to something in vim

    - by WishCow
    I'd like to know if there is a way to figure out if a key does something in vim. I know that I can use :map to see user-defined mappings, but is there something for the built-in stuff? For example, I always had CTRL-W bound to close tab, because I thought that it was unused. After half a year, I found out that there are some sequences that use it, like CTRL-W CTRL-S to split the window, and it was a nightmare to retrain myself.

    Read the article

  • How to get path to the installed GIT in Python?

    - by Vladimir Prudnikov
    I need to get a path to the GIT on Max OS X 10.6 using Python 2.6.1 into script variables. I use this code for that: r = subprocess.Popen(shlex.split("which git"), stdout=subprocess.PIPE) print r.stdout.read() but the problem is that output is empty (I tried stderr too). It works fine with another commands such as pwd or ls. Can anyone help me with that?

    Read the article

  • Control characters as delimiters

    - by Gio Borje
    I have a nodejs TCP server and a client. Basic network communication happens. Client sends "data + STX_CHARACTER + data + ETX_CHARACTER" (just an example). How do I split the string using the STX Control Character as a delimiter or how do I reference the character at all in Javascript.

    Read the article

  • Best practice to modularise a large Grails app?

    - by Mulone
    Hi all, A Grails app I'm working on is becoming pretty big, and it would be good to refactor it into several modules, so that we don't have to redeploy the whole thing every time. In your opinion, what is the best practice to split a Grails app in several modules? In particular I'd like to create a package of domain classes + relevant services and use it in the app as a module. Is this possible? Is it possible to do it with plugins? Cheers, Mulone

    Read the article

  • JS text to array

    - by Sonny
    Hi i got this text 2/92/20 3/32/32 4/62/6 5/22/28 6/60/61 7/33/32 8/34/31 9/31/19 10/19/19 11/34/39 12/32/32 14/19/25 15/45/37 16/32/32 17/84/36 18/72/33 and i need it to be like // 2/92/20 chars[0][0]=2; chars[0][1]=92; chars[0][2]=20; How should i make that PS: the split must be in $.ajax({ type: "POST", url: "char_info2.php", dataType: "html", success: function(data) { //here }

    Read the article

< Previous Page | 86 87 88 89 90 91 92 93 94 95 96 97  | Next Page >