Search Results

Search found 4625 results on 185 pages for 'split tunnel'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 91/185 | < Previous Page | 87 88 89 90 91 92 93 94 95 96 97 98  | Next Page >

  • How do I solve "405 Method Not Allowed" for our subversion setup?

    - by macke
    We're serving our source code using VisualSVN running on Windows Server 2003. Recently, we split a portion of a project into a new project in it's own repository, and then linked it back to the original project using svn:externals. Since then, we've been having issues when we try to commit files with Subclipse. The error we're getting is: svn: Commit failed (details follow): svn: PROPFIND of '/svn': 405 Method Not Allowed (https://svn.ourserver.com) Googling for a while didn't really help, our config seems to be correct. It should also be noted that we've been running this server for a while no without these problems and apart from splitting the project into two repositories, no changes have been made to the server (ie, config files are the same). It should also be noted that these errors only appear when we try to check in multiple files at once. If we check in one file at a time there are no errors. Also, it only appears in Subclipse as far as we know right now, Versions.app (OS X) seems to work fine so that is our current workaround. So, the questions is how do I analyze the error to find the cause and subsequently fix it? I'm by no means a svn guru and right now I'm clueless. EDIT: It seems we can check in multiple files in the same package, but not files from multiple packages. Also, when I "split" the project into two repositories, I imported the original repository with a new name. I did not do a dump and then import that dump. Could that be the source of our issues, and if so, how would I solve that? EDIT: After some jerking around it seems as though it is indeed related to when checking in files in different repositories. If I try to do a single commit in both Repo A and Repo B (referenced by svn:externals) at the same time, I get the error. Versions.app handles this correctly, but I guess it might just be doing two commits, not a single one. Subclipse fails miserably. For now, we simply do multiple commits, one for Repo A and one for Repo B, that works just fine. If anyone smarter than me could fill in the details why this is happening, whether or not this kind of setup is stupid etc, please go right ahead.

    Read the article

  • working validation hint, working word counter but not working together

    - by Sriyani Rathnayaka
    I added a word counter to a my form's textarea... it is something like this... <div> <label>About you:</label> <textarea id="qualification" class="textarea hint_needed" rows="4" cols="30" ></textarea> <span class="hint">explain about you</span> <script type="text/javascript"> $("textarea").textareaCounter(); </script> </div> My problem is when I add textaracounter() like this my validation hint is not working.. when I remover the counter function validation hint is working... this is the jquery for hint message.. $(".hint").css({ "display":"none" }); $("input.hint_needed, select.hint_needed, textarea.hint_needed, radio.hint_needed").on("mouseenter", function() { $(this).next(".hint").css({ "display":"inline" }); }).on("mouseleave", function() { $(this).next(".hint").css({ "display":"none" }); }); this is for the word counter.. (function($){ $.fn.textareaCounter = function(options) { // setting the defaults // $("textarea").textareaCounter({ limit: 100 }); var defaults = { limit: 150 }; var options = $.extend(defaults, options); // and the plugin begins return this.each(function() { var obj, text, wordcount, limited; obj = $("#experience"); obj.after('<span style="font-weight: bold; color:#6a6a6a; clear: both; margin: 3px 0 0 150px; float: left; overflow: hidden;" id="counter-text">Max. '+options.limit+' words</span>'); obj.keyup(function() { text = obj.val(); if(text === "") { wordcount = 0; } else { wordcount = $.trim(text).split(" ").length; } if(wordcount > options.limit) { $("#counter-text").html('<span style="color: #DD0000;">0 words left</span>'); limited = $.trim(text).split(" ", options.limit); limited = limited.join(" "); $(this).val(limited); } else { $("#counter-text").html((options.limit - wordcount)+' words left'); } }); }); }; })(jQuery); can anybody tell me what is the problem there? Thank you..

    Read the article

  • Access Creates new file every time I Compact & Repair

    - by NickSentowski
    It didn't always do this, but ever since I split my database and made the front-end an ACCDE file, any time I try to compact and repair either file, a new file called "Database 1" is generated and my original file size doesn't change. Is this normal? My ACCDB is roughly 20MB, and my ACCDE is just over 1M after being used the first time. Before opening, the ACCDE was only 600k (I have lots of forms and queries, and regularly store PDF attachments.

    Read the article

  • how to start with a voip/public announcement project?

    - by Metiu
    The main requirements are: open source solution on Linux support P2P VoIP calls support presence support multicast VoIP announcements (and maybe some way of setting up such a "conference") preferably serverless (maybe the network can get split and I'd need to keep the functionality for all clients that still see each other) I tried looking at telepathy, in particular telepathy-salut, but it seems to be quite a new technology, so it lacks clear/good documentation and/or working examples. I'm also evaluating SIP (e.g. SofiaSIP), but it's working only if connected to a server.

    Read the article

  • Can splitting .MDB files into segments help with stability?

    - by Craig Johnston
    Is this a realistic solution to the problems associated with larger .mdb files: split the large .mdb file into smaller .mdb files have one 'central' .mdb containing links to the tables in the smaller .mdb files How easy would it be to make this change to an .mdb backed VB application? Could the changes to the database be done so that there are no changes required to the front-end application?

    Read the article

  • Managing conflicting ivy repositories (in eclipse)

    - by Stephen
    I've got eclipse workspaces for my full time job and my home test work that are both set up with ivy (and using ivyDE). However, I'm finding that I'm getting strange behaviour and conflicts between the different workspaces - issues like not being able to find certain dependencies, or not compiling etc. Is there a way in ivy or ivyDE to set the home .ivy2 directory so that I can split my workspaces? At the moment, I'm alternating different directories for my .ivy2 cache.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • im writing a spellchecking program, how do i replace ch in a string..eg..

    - by Ajay Hopkins
    what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

    Read the article

  • SQL Server architecture guidance

    - by Liam
    Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

    Read the article

  • Adding google.maps.latlng within a loop

    - by Mick Morrison
    I am new to Java Script. I am using it, in combination with Java Server Faces. I want to add some points to define a Polilyne using GoogleMaps Apiv3. My problem is that I can't add a FOR statement to the javascript, because it dumps. If I comment this FOR loop, it also dumps. The dump I am getting is: "javax.servlet.ServletException: null source". Has anyone any suggestion to solve this? Thanks in advance, Emanuel <script type="text/javascript"> function initialize() { var longit = "${dateRange.longitude}" ; var lat = "${dateRange.latitude}" ; var latlng = new google.maps.LatLng(lat, longit); var myOptions = { zoom: 15, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP }; var map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); var points = []; var cadena1 = "${dateRange.latArray}" ; var cadena2 = "${dateRange.longArray}" ; var latArray = cadena1.split('?'); var longArray = cadena2.split('?'); /* The code Below is the one that fails */ for (var i=0; i < latArray.length; i++) { points.push(new google.maps.LatLng(latArray[i], longArray[i])); } /* Finish of the error code */ // The Polilyne is created var mapPath = new google.maps.Polyline ({ path: points, strokeColor: "#FF0000", strokeOpacity: 1.0, strokeWeight: 4 }); mapPath.setMap(map); } </script> </head> <body onload="initialize()"> <h:graphicImage url="http://localhost:8080/gps_tracking/faces/resources/images/logo.jpg"> </h:graphicImage> <h1 align="center">Sol-Tech</h1><br /> <hr></hr> <div id="map_canvas" style="width:100%; height:100%"></div> </body>

    Read the article

  • Dreamweaver CS5 - Have Design Window as a Panel?

    - by Oliver Jones
    I've been looking around on the dreamweaver interface, and I'm trying to get my design window as an external panel. Reason is, I have a dual monitor system, and I would like to have the main window (where you can have both code/split/design) on my main screen, but with the code selected, and a design view on my secondary monitor. I'm assuming this can't be done, although I have noticed you can have your code as an external panel (Code Inspector). Would like to hear your input. Thanks

    Read the article

  • Proper HTML technique to create an web form out of an image

    - by Lars
    I plan to create an interactive golf score card for my website (XHTML). (Btw. thats how such a scorecard looks like: ScoreCard). So at the end one should be able to insert a score for each hole in the appropriated input field in the virtual scorecard on the website. For me it is very important that the interactive scorecard really looks the same as the original (paper-) scorecard does and so my first approach was to scan and slice the scorecard image to reach that appearance. Here you can see the way I sliced the image: The idea was to insert HTML text input for each score field ending up with something like this: After I sliced the image I reconstructed it using the HTML . To do that I put the image slices as the cell background. <table> <tr> <td style="background: url("slice1.jpg") width="58px" height="25px"> <input type="text"></inputText> </td> </tr> ... </table> At the first moment this worked fine (as Gimp offers quite a nice feature for this). Then the problem was that I had to create a HTML table to create the exact layout. As you can see the lower part of the layout is split up into 3 columns. The middle column is split up into several (for each hole) rows. So the left and right column have to be spanned over those rows. Ok finally that worked, but it lead to some kind of scaling problem. If I zoom in or out on the table the middle column (and only that one) is not scaled the right way. Iam not able to fix this, and so I start doubting if this is the right technique for html image virtualization. Iam really no specialist in the area of creating websites, so I would really appriciate any help on this. Maybe there is a complete other and better technique to do that, as I think it is a common job in webcreation. I couldnt find any nice examples or tuts on that.

    Read the article

  • What common routines do you put in your Program.cs for C#

    - by Rick
    I'm interested in any common routine/procedures/methods that you might use in you Program.cs when creating a .NET project. For instance I commonly use the following code in my desktop applications to allow easy upgrades, single instance execution and friendly and simple reporting of uncaught system application errors. using System; using System.Diagnostics; using System.Threading; using System.Windows.Forms; namespace NameoftheAssembly { internal static class Program { /// <summary> /// The main entry point for the application. Modified to check for another running instance on the same computer and to catch and report any errors not explicitly checked for. /// </summary> [STAThread] private static void Main() { //for upgrading and installing newer versions string[] arguments = Environment.GetCommandLineArgs(); if (arguments.GetUpperBound(0) > 0) { foreach (string argument in arguments) { if (argument.Split('=')[0].ToLower().Equals("/u")) { string guid = argument.Split('=')[1]; string path = Environment.GetFolderPath(Environment.SpecialFolder.System); var si = new ProcessStartInfo(path + "\\msiexec.exe", "/x" + guid); Process.Start(si); Application.Exit(); } } //end of upgrade } else { bool onlyInstance = false; var mutex = new Mutex(true, Application.ProductName, out onlyInstance); if (!onlyInstance) { MessageBox.Show("Another copy of this running"); return; } AppDomain.CurrentDomain.UnhandledException += CurrentDomain_UnhandledException; Application.ThreadException += ApplicationThreadException; Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); Application.Run(new Form1()); } } private static void CurrentDomain_UnhandledException(object sender, UnhandledExceptionEventArgs e) { try { var ex = (Exception) e.ExceptionObject; MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + ex.Message + ex.StackTrace, " Fatal Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } finally { Application.Exit(); } } public static void ApplicationThreadException(object sender, ThreadExceptionEventArgs e) { try { MessageBox.Show("Whoops! Please contact the developers with the following" + " information:\n\n" + e.Exception.Message + e.Exception.StackTrace, " Error", MessageBoxButtons.OK, MessageBoxIcon.Stop); } catch (Exception) { //do nothing - Another Exception! Wow not a good thing. } } } } I find these routines to be very helpful. What methods have you found helpful in Program.cs?

    Read the article

  • how to wait multiple function processing to finish

    - by user351412
    I have a problem about multiple function processing , listed as below code, the main function is btnEvalClick, I have try to use alter native 1and 2 to wait the function not move to next record before theprocessed function finish, but it does not work //private function btnEvalClick(event:Event):void { // var i:int; // for(i= 0; i < (dataArr1.length); i++) { // dispatchEvent( new FlexEvent('test') ); // callfunc1('cydatGMX'); //call function 1 // callfun2('cydatGMO'); //call function 1 // editSave(); //save record (HTTP) //## Alternative 1 //if (String(event) == 'SAVEOK') { // RecMov('next'); //move record if save = OK //} //## Alternative 2 //while (waitfc == '') // if waitfc not 'OK' continue looping //{ // z = z + 1; //} // RecMov('next'); //Move to next record to process //} //private function callfunc1(tasal:String):void { // var mySO :SharedObject; // var myDP: Array; // var i:int; // var prm:Array; // try // { // mySO = SharedObject.getLocal(tasal,'/'); // prm = mySO.data.txt.split('?'); // for(i=0; i < (prm.length - 1); i++) { // myDP = prm[i].toString().split('^'); // if ( myDP[0].toString() == String(dataArr1[dg].MatrixCDCol)){ // myDPX = myDP; // break; // } // } // } // catch (err:Error) { // Alert.show('Limit object creation fail (' + tasal + '), please retry ); // } //} //private function editSave():void //{ // var parameters:* = // { // 'CertID': CertIDCol.text, 'AssetID': AssetIDCol.text, 'CertDate': cdt, //'Ccatat': CcatatCol.text, 'CertBy': CertByCol.text, 'StatusID': StatusIDCol.text, //'UpdDate': lele, 'UpdUsr': ApplicationState.instance.luNm }; // doRequest('Update', parameters, saveItemHandler); //} //private function doRequest(method_name:String, parameters:Object, callback:Function):void // { // add the method to the parameters list // parameters['method'] = (method_name + 'ASC'); // gateway.request = parameters; // var call:AsyncToken = gateway.send(); // call.request_params = gateway.request; // call.handler = callback; // } //private function saveItemHandler(e:Object):void // { // if (e.isError) // { // Alert.show('Error: ' + e.data.error); // } // else // { // Alert.show('Record Saved..'); // waitfc = 'OK'; // dispatchEvent( new FlexEvent('SAVEOK') ); // } // }

    Read the article

  • How to get path to the installed GIT in Python?

    - by Vladimir Prudnikov
    I need to get a path to the GIT on Max OS X 10.6 using Python 2.6.1 into script variables. I use this code for that: r = subprocess.Popen(shlex.split("which git"), stdout=subprocess.PIPE) print r.stdout.read() but the problem is that output is empty (I tried stderr too). It works fine with another commands such as pwd or ls. Can anyone help me with that?

    Read the article

  • ruby - find and replace in a string for commonly used street suffix

    - by go minimal
    The post office actually publishes a list of commonly used street suffixes in addresses: http://www.usps.com/ncsc/lookups/abbr_suffix.txt I want to take this list and make a ruby function that takes a string, takes the last word ("183 main strt".split[' '].last) and if it matches any of the commonly used street suffixes ("strt"), replace it with the official Postal Service Standard Suffix ("st"). Is there a better way to approach this than a massive str.sub.sub.sub.sub.sub?

    Read the article

  • how to tackle a new project

    - by stevo
    Hi, I have a question about best practice on how to tackle a new project, any project. When starting a new project how do you go about tackling the project, do you split it into sections, start writing code, draw up flow diagrams. I'm asking this question because I'm looking for advice on how I can start new projects so I can get going on them quicker. I can have it planned, designed and starting coding with everything worked out. Any advice? Thanks Stephen

    Read the article

  • mysql IN parameter

    - by proyb2
    When the user check more than one (checkbox) option which are then combine into a string of "apple,orange,pear" SELECT id, pos, FROM $db WHERE dtime>='$now' AND jsub IN ('$arr[1]') ; When I pass the string to $arr[1], it won't work correctly, how do I split into array and get mysql IN function to process correctly?

    Read the article

  • Parsing string logic issue c#

    - by N0xus
    This is a follow on from this question My program is taking in a string that is comprised of two parts: a distance value and an id number respectively. I've split these up and stored them in local variables inside my program. All of the id numbers are stored in a dictionary and are used check the incoming distance value. Though I should note that each string that gets sent into my program from the device is passed along on a single string. The next time my program receives that a signal from a device, it overrides the previous data that was there before. Should the id key coming into my program match one inside my dictionary, then a variable held next to my dictionaries key, should be updated. However, when I run my program, I don't get 6 different values, I only get the same value and they all update at the same time. This is all the code I have written trying to do this: Dictionary<string, string> myDictonary = new Dictionary<string, string>(); string Value1 = ""; string Value2 = ""; string Value3 = ""; string Value4 = ""; string Value5 = ""; string Value6 = ""; void Start() { myDictonary.Add("11111111", Value1); myDictonary.Add("22222222", Value2); myDictonary.Add("33333333", Value3); myDictonary.Add("44444444", Value4); myDictonary.Add("55555555", Value5); myDictonary.Add("66666666", Value6); } private void AppendString(string message) { testMessage = message; string[] messages = message.Split(','); foreach(string w in messages) { if(!message.StartsWith(" ")) outputContent.text += w + "\n"; } messageCount = "RSSI number " + messages[0]; uuidString = "UUID number " + messages[1]; if(myDictonary.ContainsKey(messages[1])) { Value1 = messageCount; Value2 = messageCount; Value3 = messageCount; Value4 = messageCount; Value5 = messageCount; Value6 = messageCount; } } How can I get it so that when programs recives the first key, for example 1111111, it only updates Value1? The information that comes through can be dynamic, so I'd like to avoid harding as much information as I possibly can.

    Read the article

  • Whats wrong with my script??

    - by John Augst
    Hi guys; Could you tell me whats wrong with this script: I think the error is in IF statment <script> productID=new Array() variaveis=location.search.replace(/\x3F/,"").replace(/\x2B/g," ").split("&") if(variaveis!=""){ for(i=0;iflash1"); } else if (flash = "flash2") { document.write("flash2"); } else { document.write("another"); }

    Read the article

  • C++ Headers/Source Files

    - by incrediman
    (Duplicate of C++ Code in Header Files) What is the standard way to split up C++ classes between header and source files? Am I supposed to put everything in the header file? Or should I declare the classes in the header file and define them in a .cpp file (source file)? Sorry if I'm shaky on the terminology here (declare, define, etc). So what's the standard?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 87 88 89 90 91 92 93 94 95 96 97 98  | Next Page >