Search Results

Search found 5154 results on 207 pages for 'expression evaluation'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 91/207 | < Previous Page | 87 88 89 90 91 92 93 94 95 96 97 98  | Next Page >

  • group by with 3 diffrent

    - by NN
    I have 2 table and I wanna a query with 3 column result in on of them 2 column with view count and title name and in the other 1 column with type_ and i wanna to grouping type_ with max(view count) and show the them title but i didn't have any idea about grouping expression. i think we can solve in by using sub query but i don't know which column use in group by. 2 table join with this expression class pk=resource key i exam this query: SELECT t.title,j.type_ FROM tags asset t,journal article j where type_ in (select type_ from journal article,tags asset where class pk=resource key group by type_) but the answer was wrong

    Read the article

  • Using Nokogiri to scrape groupon deal

    - by hyngyn
    I'm following the Nokogiri railscast to write a scraper for Groupon. I keep on getting the following error when I run my rb file. traveldeal_scrape.rb:10: warning: regular expression has ']' without escape: /\[0-9 \.]+/ Flamingo Conference Resort and Spa Deal of the Day | Groupon Napa / Sonoma traveldeal_scrape.rb:9:in `block in <main>': undefined local variable or method `item' for main:Object (NameError) Here is my scrape file. require 'rubygems' require 'nokogiri' require 'open-uri' url = "http://www.groupon.com/deals/ga-flamingo-conferences-resort-spa?c=all&p=0" doc = Nokogiri::HTML(open(url)) puts doc.at_css("title").text doc.css(".deal").each do |deal| title = deal.at_css("#content//a").text price = deal.at_css("#amount").text[/\[0-9\.]+/] puts "#{title} - #{price}" puts deal.at_css(".deal")[:href] end I used the exact same rubular expression as the tutorial. I am also unsure of whether or not my CSS tags are correct. Thanks!

    Read the article

  • algorithmes with no executable example code

    - by gcc
    [link] http://stackoverflow.com/questions/2932016/parsing-of-mathematical-expressions (problem has been told before) ** program is to create the infix tree for the given math expression.** if the expression is given completely paranthesized then the out put is fine but when there are no paranthesis or some part paranthesized then the out put is wrong. cant get the idea how to solve. my problem is told above. I have some algorithm to solve my problem, but I have no simple code which will be guide for me. Can anyone give me simple code (not working code) so that I will try working to understand.(for a 3 hours ,I have been searching and reading some text to understand algorithm which is told above.Actually,there is no example code investigating how it is working. Can anyone send me example which is written in c not other language.

    Read the article

  • Extract IP address from an html string (python)

    - by GoJian
    My Friends, I really want to extract a simple IP address from a string (actually an one-line html) using Python. But it turns out that 2 hours passed I still couldn't come up with a good solution. >>> s = "<html><head><title>Current IP Check</title></head><body>Current IP Address: 165.91.15.131</body></html>" -- '165.91.15.131' is what I want! I tried using regular expression, but so far I can only get to the first number. >>> import re >>> ip = re.findall( r'([0-9]+)(?:\.[0-9]+){3}', s ) >>> ip ['165'] In fact, I don't feel I have a firm grasp on reg-expression and the above code was found and modified from elsewhere on the web. Seek your input and ideas!

    Read the article

  • using NEWSEQUENTIALID() with UPDATE Trigger

    - by Ram
    I am adding a new GUID/Uniqueidentifier column to my table. ALTER TABLE table_name ADD VersionNumber UNIQUEIDENTIFIER UNIQUE NOT NULL DEFAULT NEWSEQUENTIALID() GO And when ever a record is updated in the table, I would want to update this column "VersionNumber". So I create a new trigger CREATE TRIGGER [DBO].[TR_TABLE_NAMWE] ON [DBO].[TABLE_NAME] AFTER UPDATE AS BEGIN UPDATE TABLE_NAME SET VERSIONNUMBER=NEWSEQUENTIALID() FROM TABLE_NAME D JOIN INSERTED I ON D.ID=I.ID/* some ID which is used to join*/ END GO But just realized that NEWSEQUENTIALID() can only be used with CREATE TABLE or ALTER TABLE. I got this error The newsequentialid() built-in function can only be used in a DEFAULT expression for a column of type 'uniqueidentifier' in a CREATE TABLE or ALTER TABLE statement. It cannot be combined with other operators to form a complex scalar expression. Is there a workaround for this ? Edit1: Changing NEWSEQUENTIALID() to NEWID() in the trigger solves this, but I am indexing this column and using NEWID() would be sub-optimal

    Read the article

  • Access is refusing to run an query with linked table?

    - by Mahmoud
    Hey all i have 3 tables each as follow cash_credit Bank_Name-------in_date-------Com_Id---Amount America Bank 15/05/2010 1 200 HSBC 17/05/2010 3 500 Cheque_credit Bank_Name-----Cheque_Number-----in_date-------Com_Id---Amount America Bank 74835435-5435 15/05/2010 2 600 HSBC 41415454-2851 17/05/2010 5 100 Companies com_id----Com_Name 1 Ebay 2 Google 3 Facebook 4 Amazon Companies table is a linked table when i tried to create an query as follow SELECT cash_credit.Amount, Companies.Com_Name, cheque_credit.Amount FROM cheque_credit INNER JOIN (cash_credit INNER JOIN Companies ON cash_credit.com_id = Companies.com_id) ON cheque_credit.com_id = Companies.com_id; I get an error saying that my inner Join is incorrectly, this query was created using Access 2007 query design the error is Type mismatch in expression then i thought it might be the inner join so i tried Left Join and i get an error that this method is not used JOIN expression is not supported I am confused on where is the problem that is causing all this

    Read the article

  • an error "variable of field declared void"

    - by lego69
    I have this code: header - test.h Inside header I have some class Z and definitions of two functions test and test2 I call function test2 from test void test2(Z z, Z const *za); this is implementation of the function: void test2(Z z, Z const *za){ int i = z; //this row works cout << i << endl; } I call it from test: test2(z1, za1); // za1 is pinter to object and z1 is some object but in my header I receive an 3 errors: Multiple markers at this line - initializer expression list treated as compound expression - `A' was not declared in this scope - variable or field `quiz2' declared void can somebody please explain why? thanks in advance

    Read the article

  • Problem using Conditional Operation with Nullable Int

    - by Rajarshi
    A small problem. Any idea guys why this does not work? int? nullableIntVal = (this.Policy == null) ? null : 1; I am trying to return 'null' if the left hand expression is True, else 1. Seems simple but gives compilation error - Type of conditional expression cannot be determined because there is no implicit conversion between 'null' and 'int' If I replace the " ? null : 1 " with any valid int, then there is no problem.

    Read the article

  • Haskell: Why is it saying my function type is off?

    - by linkmaster03
    I wrote a little Haskell program to find the area of a triangle, primarily to practice custom types, but it keeps throwing the following error on compile: areafinder.hs:7:4: Couldn't match expected type 'Triangle' against inferred type 'm b' In a stmt of a 'do' expression: putStr "Base: " In the expression: do { putStr "Base: "; baseStr I'm not sure where 'm b' comes from, so I'm at a loss here. Why is it throwing this error, and what can I do to fix it? Here is my code: module Main where data Triangle = Triangle Double Double -- base, height getTriangle :: Triangle getTriangle = do putStr "Base: " baseStr Double calcTriangle (Triangle base height) = base * height main = putStrLn ("Area = " ++ show (calcTriangle getTriangle)) Thanks. :)

    Read the article

  • Regex in javascript for enum datatype of mysql

    - by himadri
    Hello, I am working with php and mysql. I have one dropdown box where I am asking datatype of mysql field. Now, I want to put javascript validation for it. I am confused with the enum datatype. I am using regular expression /^[']{1}[^',^\\]+[']{1}$/. This is for one single value of enum values. It is working fine but issue is when I put single quote or backslash with backslash, it is valid but this regular expression shows it as invalid. For eg, 'a'b' is invalid but 'a\'b' is valid.

    Read the article

  • How to generate random strings that match a given regexp?

    - by Pies
    Duplicate: Random string that matches a regexp No, it isn't. I'm looking for an easy and universal method, one that I could actually implement. That's far more difficult than randomly generating passwords. I want to create an application that takes a regular expression, and shows 10 randomly generated strings that match that expression. It's supposed to help people better understand their regexps, and to decide i.e. if they're secure enough for validation purposes. Does anyone know of an easy way to do that? One obvious solution would be to write (or steal) a regexp parser, but that seems really over my head. I repeat, I'm looking for an easy and universal way to do that. Edit: Brute force approach is out of the question. Assuming the random strings would just be [a-z0-9]{10} and 1 million iterations per second, it would take 65 years to iterate trough the space of all 10-char strings.

    Read the article

  • How to replace all the blanks within square brackets with an underscore using sed?

    - by Ringerrr
    I figured out that in order to turn [some name] into [some_name] I need to use the following expression: s/\(\[[^ ]*\) /\1_/ i.e. create a backreference capture for anything that starts with a literal '[' that contains any number of non space characters, followed by a space, to be replaced with the non space characters followed by an underscore. What I don't know yet though is how to alter this expression so it works for ALL underscores within the braces e.g. [a few words] into [a_few_words]. I sense that I'm close, but am just missing a chunk of knowledge that will unlock the key to making this thing work an infinite number of times within the constraints of the first set of []s contained in a line (of SQL Server DDL in this case). Any suggestions gratefully received....

    Read the article

  • How do you add < or > to a summary tag in Visual studio?

    - by Tony
    How do you add < (less than) or (greater than) to a summary comment in visual studio? I am in Visual Studio 2008. I have a generic method: public bool IsMemberProtected<T>(Expression<Func<T, object>> expression) Would love to have a summary tag of something like this /// <summary> /// Determines whether a member is protected. /// /// Usage: IsMemberProtected<ExampleType>(x => x.Member) /// </summary> But when I do that, the tooltip for the property no longer works when a developer hovers over the method in code to view the summary tag. Thoughts?

    Read the article

  • negative look ahead to exclude html tags

    - by Remoh
    I'm trying to come up with a validation expression to prevent users from entering html or javascript tags into a comment box on a web page. The following works fine for a single line of text: ^(?!.(<|)).$ ..but it won't allow any newline characters because of the dot(.). If I go with something like this: ^(?!.(<|))(.|\s)$ it will allow multiple lines but the expression only matches '<' and '' on the first line. I need it to match any line. This works fine: ^[-_\s\d\w"'.,:;#/&\$\%\?!@+*\()]{0,4000}$ but it's ugly and I'm concerned that it's going to break for some users because it's a multi-lingual application. Any ideas? Thanks!

    Read the article

  • How to choose programaticaly the column to be querried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to querry the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); the myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq querries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to querry. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • RegularExpressionValidator always fails, but ValidationExpression works in testing

    - by Jerph
    I found the answer to this, but it's a bit of a gotcha so I wanted to share it here. I have a regular expression that validates passwords. They should be 7 to 60 characters with at least one numeric and one alpha character. Pretty standard. I used positive lookaheads (the (?= operator) to implement it: (?=^.{7,60}$)(?=.*[0-9].*)(?=.*[a-zA-Z].*) I checked this expression in my unit tests using Regex.IsMatch(), and it worked fine. However, when I use it in a RegularExpressionValidator, it always fails. Why?

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • preg_replace or regex string translation

    - by ccolon
    I found some partial help but cannot seem to fully accomplish what I need. I need to be able to do the following: I need an regular expression to replace any 1 to 3 character words between two words that are longer than 3 characters with a match any expression: For example: walk to the beach == walk(.*)beach If the 1 to 3 character word is not preceded by a word that's longer than 3 characters then I want to translate that 1 to 3 letter word to ' ?' For example: on the beach == on ?the ?beach The simpler the rule the better (of course, if there's an alternative more complicated version that's more performant then I'll take that as well as I eventually anticipate heavy usage eventually). This will be used in a PHP context most likely with preg_replace. Thus, if you can put it in that context then even better!

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • one-liner if statements...

    - by snickered
    Total noob here so be gentle. I've looked everywhere and can't seem to find the answer to this. How do I condense the following? if (expression) { return true; } else { return false; } I can't get it to work since it's returning something vs. setting something. I've already seen things like this: somevar = (expression) ? value1 : value2; Like I said, please be gentle :)

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Is void *p = 0L valid?

    - by Artefacto
    In this answer, sassman initializes a pointer with: zend_class_entry* ce = 0L; My question is – is this valid? I would say it isn't, to initialize the variable with a null pointer either an unadorned (and possibly casted to void *) 0 constant, or some macro that evaluates to that such as NULL should be used. However, I can't find definitive language in the standard that supports this interpretation. All it says is: An integer constant expression with the value 0, or such an expression cast to type void *, is called a null pointer constant.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 87 88 89 90 91 92 93 94 95 96 97 98  | Next Page >