Search Results

Search found 15637 results on 626 pages for 'memory efficient'.

Page 91/626 | < Previous Page | 87 88 89 90 91 92 93 94 95 96 97 98  | Next Page >

  • The most efficient method of drawing multiple quads in OpenGL

    - by CPatton
    I'm not very keen with OpenGL and I was wondering if someone could give me some insight on this. I'm a 'seasoned' programmer, I've read the redbook about VBOs and the like, but I was wondering from a more experienced person about the best/most efficient way of achieving this. I've been producing this 2d tile-based game engine to be used in several projects. I have a class called "ScreenObject" which is mainly composed of a Dictionary<Point, Tile> The Point key is to show where to render the Tile on the screen, and the Tile contains one or more textures to be drawn at that point. This ScreenObject is where the tiles will be modified, deleted, added, etc.. My original method of drawing the tiles in the testing I've done was to iterate through the ScreenObject and draw each quad at each location separately. From what I've read, this is a massive waste of resources. It wasn't horribly slow in the testing, but after I've completed the animation classes and effect classes, I'm sure it would be extremely slow. And one last thing, if you wouldn't mind.. As I said before, the Tile class can contain multiple textures to be drawn at the Point location on the screen. I recognize possibly two options for me here. Either add a quad at that location for each texture to be drawn, or, somehow.. use a multiple texture for the same quad (if it's possible). Even if each tile contained one texture only, that would be 64 quads to be drawn on the screen. Most of the tiles will contain 2-5 textures, so the number of total quads would increase dramatically with this method. Would it be feasible to add a quad for each new texture, or am I ignoring a better way to do this? Just need some help understanding this if you don't mind :) I've tried to be as concise as possible, and I'd greatly appreciate any responses.. and even some criticism. Programming is often a learning process and one who develops seems to never stops learning. Thanks for your time.

    Read the article

  • How to make efficient code emerge through unit testing

    - by Jean
    Hi, I participate in a TDD Coding Dojo, where we try to practice pure TDD on simple problems. It occured to me however that the code which emerges from the unit tests isn't the most efficient. Now this is fine most of the time, but what if the code usage grows so that efficiency becomes a problem. I love the way the code emerges from unit testing, but is it possible to make the efficiency property emerge through further tests ? Here is a trivial example in ruby: prime factorization. I followed a pure TDD approach making the tests pass one after the other validating my original acceptance test (commented at the bottom). What further steps could I take, if I wanted to make one of the generic prime factorization algorithms emerge ? To reduce the problem domain, let's say I want to get a quadratic sieve implementation ... Now in this precise case I know the "optimal algorithm, but in most cases, the client will simply add a requirement that the feature runs in less than "x" time for a given environment. require 'shoulda' require 'lib/prime' class MathTest < Test::Unit::TestCase context "The math module" do should "have a method to get primes" do assert Math.respond_to? 'primes' end end context "The primes method of Math" do should "return [] for 0" do assert_equal [], Math.primes(0) end should "return [1] for 1 " do assert_equal [1], Math.primes(1) end should "return [1,2] for 2" do assert_equal [1,2], Math.primes(2) end should "return [1,3] for 3" do assert_equal [1,3], Math.primes(3) end should "return [1,2] for 4" do assert_equal [1,2,2], Math.primes(4) end should "return [1,5] for 5" do assert_equal [1,5], Math.primes(5) end should "return [1,2,3] for 6" do assert_equal [1,2,3], Math.primes(6) end should "return [1,3] for 9" do assert_equal [1,3,3], Math.primes(9) end should "return [1,2,5] for 10" do assert_equal [1,2,5], Math.primes(10) end end # context "Functionnal Acceptance test 1" do # context "the prime factors of 14101980 are 1,2,2,3,5,61,3853"do # should "return [1,2,3,5,61,3853] for ${14101980*14101980}" do # assert_equal [1,2,2,3,5,61,3853], Math.primes(14101980*14101980) # end # end # end end and the naive algorithm I created by this approach module Math def self.primes(n) if n==0 return [] else primes=[1] for i in 2..n do if n%i==0 while(n%i==0) primes<<i n=n/i end end end primes end end end

    Read the article

  • Efficient list compacting

    - by Patrik
    Suppose you have a list of unsigned ints. Suppose some elements are equal to 0 and you want to push them back. Currently I use this code (list is a pointer to a list of unsigned ints of size n for (i = 0; i < n; ++i) { if (list[i]) continue; int j; for (j = i + 1; j < n && !list[j]; ++j); int z; for (z = j + 1; z < n && list[z]; ++z); if (j == n) break; memmove(&(list[i]), &(list[j]), sizeof(unsigned int) * (z - j))); int s = z - j + i; for(j = s; j < z; ++j) list[j] = 0; i = s - 1; } Can you think of a more efficient way to perform this task? The snippet is purely theoretical, in the production code, each element of list is a 64 bytes struct EDIT: I'll post my solution. Many thanks to Jonathan Leffler. void RemoveDeadParticles(int * list, int * n) { int i, j = *n - 1; for (; j >= 0 && list[j] == 0; --j); for (i = 0; i < j; ++i) { if (list[i]) continue; memcpy(&(list[i]), &(list[j]), sizeof(int)); list[j] = 0; for (; j >= 0 && list[j] == 0; --j); if (i == j) break; } *n = i + 1; }

    Read the article

  • Is this postgres function cost efficient or still have to clean

    - by kiranking
    There are two tables in postgres db. english_all and english_glob First table contains words like international,confidential,booting,cooler ...etc I have written the function to get the words from english_all then perform for loop for each word to get word list which are not inserted in anglish_glob table. Word list is like I In Int Inte Inter .. b bo boo boot .. c co coo cool etc.. for some reason zwnj(zero-width non-joiner) is added during insertion to english_all table. But in function I am removing that character with regexp_replace. Postgres function for_loop_test is taking two parameter min and max based on that I am selecting words from english_all table. function code is like DECLARE inMinLength ALIAS FOR $1; inMaxLength ALIAS FOR $2; mviews RECORD; outenglishListRow english_word_list;--custom data type eng_id,english_text BEGIN FOR mviews IN SELECT id,english_all_text FROM english_all where wlength between inMinLength and inMaxLength ORDER BY english_all_text limit 30 LOOP FOR i IN 1..char_length(regexp_replace(mviews.english_all_text,'(?)$','')) LOOP FOR outenglishListRow IN SELECT distinct on (regexp_replace((substring(mviews.english_all_text from 1 for i)),'(?)$','')) mviews.id, regexp_replace((substring(mviews.english_all_text from 1 for i)),'(?)$','') where regexp_replace((substring(mviews.english_all_text from 1 for i)),'(?)$','') not in(select english_glob.english_text from english_glob where i=english_glob.wlength) order by regexp_replace((substring(mviews.english_all_text from 1 for i)),'(?)$','') LOOP RETURN NEXT outenglishListRow; END LOOP; END LOOP; END LOOP; END; Once I get the word list I will insert that into another table english_glob. My question is is there any thing I can add to or remove from function to make it more efficient. edit Let assume english_all table have words like footer,settle,question,overflow,database,kingdom If inMinLength = 5 and inmaxLength=7 then in the outer loop footer,settle,kingdom will be selected. For above 3 words inner two loop will apply to get words like f,fo,foo,foot,foote,footer,s,se,set,sett,settl .... etc. In the final process words which are bold will be entered into english_glob with another parameter like 1 to denote it is a proper word and stored in the another filed of english_glob table. Remaining word will be stored with another parameter 0 because in the next call words which are saved in database should not be fetched again. edit2: This is a complete code CREATE TABLE english_all ( id serial NOT NULL, english_all_text text NOT NULL, wlength integer NOT NULL, CONSTRAINT english_all PRIMARY KEY (id), CONSTRAINT english_all_kan_text_uq_id UNIQUE (english_all_text) ) CREATE TABLE english_glob ( id serial NOT NULL, english_text text NOT NULL, is_prop integer default 1, CONSTRAINT english_glob PRIMARY KEY (id), CONSTRAINT english_glob_kan_text_uq_id UNIQUE (english_text) ) insert into english_all(english_text) values ('ant'),('forget'),('forgive'); on function call with parameter 3 and 6 fallowing rows should fetched a an ant f fo for forg forge forget next is insert to another table based on above row insert into english_glob(english_text,is_prop) values ('a',1),('an',1), ('ant',1),('f',0), ('fo',0),('for',1), ('forg',0),('forge',1), ('forget',1), on function call next time with parameter 3 and 7 fallowing rows should fetched.(because f,fo,for,forg are all entered in english_glob table) forgi forgiv forgive

    Read the article

  • Efficient algorithm to distribute work?

    - by Zwei Steinen
    It's a bit complicated to explain but here we go. We have problems like this (code is pseudo-code, and is only for illustrating the problem. Sorry it's in java. If you don't understand, I'd be glad to explain.). class Problem { final Set<Integer> allSectionIds = { 1,2,4,6,7,8,10 }; final Data data = //Some data } And a subproblem is: class SubProblem { final Set<Integer> targetedSectionIds; final Data data; SubProblem(Set<Integer> targetedSectionsIds, Data data){ this.targetedSectionIds = targetedSectionIds; this.data = data; } } Work will look like this, then. class Work implements Runnable { final Set<Section> subSections; final Data data; final Result result; Work(Set<Section> subSections, Data data) { this.sections = SubSections; this.data = data; } @Override public void run(){ for(Section section : subSections){ result.addUp(compute(data, section)); } } } Now we have instances of 'Worker', that have their own state sections I have. class Worker implements ExecutorService { final Map<Integer,Section> sectionsIHave; { sectionsIHave = {1:section1, 5:section5, 8:section8 }; } final ExecutorService executor = //some executor. @Override public void execute(SubProblem problem){ Set<Section> sectionsNeeded = fetchSections(problem.targetedSectionIds); super.execute(new Work(sectionsNeeded, problem.data); } } phew. So, we have a lot of Problems and Workers are constantly asking for more SubProblems. My task is to break up Problems into SubProblem and give it to them. The difficulty is however, that I have to later collect all the results for the SubProblems and merge (reduce) them into a Result for the whole Problem. This is however, costly, so I want to give the workers "chunks" that are as big as possible (has as many targetedSections as possible). It doesn't have to be perfect (mathematically as efficient as possible or something). I mean, I guess that it is impossible to have a perfect solution, because you can't predict how long each computation will take, etc.. But is there a good heuristic solution for this? Or maybe some resources I can read up before I go into designing? Any advice is highly appreciated!

    Read the article

  • Making an efficient algorithm

    - by James P.
    Here's my recent submission for the FB programming contest (qualifying round only requires to upload program output so source code doesn't matter). The objective is to find two squares that add up to a given value. I've left it as it is as an example. It does the job but is too slow for my liking. Here's the points that are obviously eating up time: List of squares is being recalculated for each call of getNumOfDoubleSquares(). This could be precalculated or extended when needed. Both squares are being checked for when it is only necessary to check for one (complements). There might be a more efficient way than a double-nested loop to find pairs. Other suggestions? Besides this particular problem, what do you look for when optimizing an algorithm? public static int getNumOfDoubleSquares( Integer target ){ int num = 0; ArrayList<Integer> squares = new ArrayList<Integer>(); ArrayList<Integer> found = new ArrayList<Integer>(); int squareValue = 0; for( int j=0; squareValue<=target; j++ ){ squares.add(j, squareValue); squareValue = (int)Math.pow(j+1,2); } int squareSum = 0; System.out.println( "Target=" + target ); for( int i = 0; i < squares.size(); i++ ){ int square1 = squares.get(i); for( int j = 0; j < squares.size(); j++ ){ int square2 = squares.get(j); squareSum = square1 + square2; if( squareSum == target && !found.contains( square1 ) && !found.contains( square2 ) ){ found.add(square1); found.add(square2); System.out.println( "Found !" + square1 +"+"+ square2 +"="+ squareSum); num++; } } } return num; }

    Read the article

  • MPM Prefork Apache Uses Absurd Amount of Memory

    - by Charlie JM
    Help! My apache processes are all using 115MB of memory on startup. Relevant information: Linux version (uname -a) Linux 2.6.31-14-generic-pae #48-Ubuntu SMP Fri Oct 16 15:22:42 UTC 2009 i686 GNU/Linux Apache version (/usr/sbin/apache2 -v) Server version: Apache/2.2.8 (Ubuntu) Server built: Mar 9 2010 20:45:36 Top display (top -u www-data) PID USER PR NI VIRT RES SHR S %CPU %MEM TIME+ COMMAND 23377 www-data 20 0 115m 94m 3908 S 28 1.6 0:04.59 apache2 23375 www-data 20 0 119m 99m 5892 S 9 1.6 0:05.04 apache2 23324 www-data 20 0 116m 96m 5144 S 2 1.6 0:04.73 apache2 23283 www-data 20 0 115m 95m 4480 S 1 1.6 0:04.89 apache2 23259 www-data 20 0 116m 96m 5380 S 0 1.6 0:05.55 apache2 23370 www-data 20 0 115m 94m 4396 S 0 1.6 0:04.75 apache2 23229 www-data 20 0 116m 96m 6096 S 0 1.6 0:05.43 apache2 ... and so on ... Memory map (pmap $(pidof apache2)) (actually, just one apache2 process) Most of the memory is [anon], see line 5 23324: /usr/sbin/apache2 -k start 08048000 332K r-x-- /usr/sbin/apache2 0809b000 8K rw--- /usr/sbin/apache2 0809d000 12K rw--- [ anon ] 093a0000 92812K rw--- [ anon ] b5b6c000 4K rw--- [ anon ] b5b6d000 512K rw-s- [ shmid=0x13528003 ] b5fa8000 16K r-x-- /lib/tls/i686/cmov/libnss_dns-2.7.so b5fac000 8K rw--- /lib/tls/i686/cmov/libnss_dns-2.7.so b5fae000 120K r-x-- /usr/lib/php5/20060613+lfs/suhosin.so b5fcc000 16K rw--- /usr/lib/php5/20060613+lfs/suhosin.so b5fd0000 4K rw--- [ anon ] b5fd1000 76K r-x-- /usr/lib/php5/20060613+lfs/pdo.so b5fe4000 8K rw--- /usr/lib/php5/20060613+lfs/pdo.so b5fe6000 92K r-x-- /usr/lib/php5/20060613+lfs/mysqli.so b5ffd000 8K rw--- /usr/lib/php5/20060613+lfs/mysqli.so b5fff000 1648K r-x-- /usr/lib/libmysqlclient.so.15.0.0 b619b000 268K rw--- /usr/lib/libmysqlclient.so.15.0.0 b61de000 4K rw--- [ anon ] b61f0000 92K r-x-- /usr/lib/libxcb.so.1.0.0 b6207000 4K rw--- /usr/lib/libxcb.so.1.0.0 b6208000 164K r-x-- /usr/lib/libfontconfig.so.1.3.0 b6231000 4K rw--- /usr/lib/libfontconfig.so.1.3.0 b6232000 124K r-x-- /usr/lib/libjpeg.so.62.0.0 b6251000 4K rw--- /usr/lib/libjpeg.so.62.0.0 b6252000 136K r-x-- /usr/lib/libpng12.so.0.15.0 b6274000 4K rw--- /usr/lib/libpng12.so.0.15.0 b6275000 60K r-x-- /usr/lib/libXpm.so.4.11.0 b6284000 4K rw--- /usr/lib/libXpm.so.4.11.0 b6285000 912K r-x-- /usr/lib/libX11.so.6.2.0 b6369000 12K rw--- /usr/lib/libX11.so.6.2.0 b636c000 424K r-x-- /usr/lib/libfreetype.so.6.3.16 b63d6000 12K rw--- /usr/lib/libfreetype.so.6.3.16 b63d9000 236K r-x-- /usr/lib/libt1.so.5.1.1 b6414000 12K rw--- /usr/lib/libt1.so.5.1.1 b6417000 84K rw--- [ anon ] b642c000 116K r-x-- /usr/lib/libgd.so.2.0.0 b6449000 128K rw--- /usr/lib/libgd.so.2.0.0 b6469000 16K rw--- [ anon ] b646d000 88K r-x-- /usr/lib/php5/20060613+lfs/gd.so b6483000 16K rw--- /usr/lib/php5/20060613+lfs/gd.so b6487000 192K r-x-- /usr/lib/libidn.so.11.5.30 b64b7000 4K rw--- /usr/lib/libidn.so.11.5.30 b64b8000 232K r-x-- /usr/lib/libcurl.so.4.0.1 b64f2000 4K rw--- /usr/lib/libcurl.so.4.0.1 b64f8000 44K r-x-- /usr/lib/php5/20060613+lfs/mysql.so b6503000 4K rw--- /usr/lib/php5/20060613+lfs/mysql.so b6504000 268K r-x-- /usr/lib/libgmp.so.3.4.2 b6547000 4K rw--- /usr/lib/libgmp.so.3.4.2 b6548000 648K r-x-- /usr/lib/libclamav.so.5.0.4 b65ea000 44K rw--- /usr/lib/libclamav.so.5.0.4 b65f8000 52K r-x-- /usr/lib/php5/20060613+lfs/curl.so b6605000 4K rw--- /usr/lib/php5/20060613+lfs/curl.so b6606000 148K r-x-- /usr/lib/libmcrypt.so.4.4.7 b662b000 8K rw--- /usr/lib/libmcrypt.so.4.4.7 b662d000 28K rw--- [ anon ] b6634000 24K r-x-- /usr/lib/php5/20060613+lfs/pdo_mysql.so b663a000 4K rw--- /usr/lib/php5/20060613+lfs/pdo_mysql.so b663b000 16K r-x-- /usr/lib/libXdmcp.so.6.0.0 b663f000 4K rw--- /usr/lib/libXdmcp.so.6.0.0 b6640000 12K r-x-- /usr/lib/php5/20060613+lfs/clamav.so b6643000 4K rw--- /usr/lib/php5/20060613+lfs/clamav.so b6644000 1036K r-x-- /usr/lib/libc-client.so.2007.0 b6747000 28K rw--- /usr/lib/libc-client.so.2007.0 b674e000 4K rw--- [ anon ] b6750000 24K r-x-- /usr/lib/libltdl.so.3.1.6 b6756000 4K rw--- /usr/lib/libltdl.so.3.1.6 b6757000 32K r-x-- /usr/lib/php5/20060613+lfs/mcrypt.so b675f000 4K rw--- /usr/lib/php5/20060613+lfs/mcrypt.so b6760000 88K r-x-- /usr/lib/php5/20060613+lfs/imap.so b6776000 4K rw--- /usr/lib/php5/20060613+lfs/imap.so b6777000 104K r-x-- /usr/local/lib/libssh2.so b6791000 4K rw--- /usr/local/lib/libssh2.so b6792000 1324K r-x-- /usr/lib/ZendOptimizer.so b68dd000 68K rw--- /usr/lib/ZendOptimizer.so b68ee000 20K rw--- [ anon ] b68f3000 8K r-x-- /usr/lib/libXau.so.6.0.0 b68f5000 4K rw--- /usr/lib/libXau.so.6.0.0 b68f6000 52K r-x-- /usr/lib/php5/20060613+lfs/ssh2.so b6903000 4K rw--- /usr/lib/php5/20060613+lfs/ssh2.so b6904000 252K r---- /usr/lib/locale/en_US.utf8/LC_CTYPE b6974000 64K rw-s- /dev/zero (deleted) b6984000 36K r-x-- /lib/tls/i686/cmov/libnss_files-2.7.so b698d000 8K rw--- /lib/tls/i686/cmov/libnss_files-2.7.so b698f000 32K r-x-- /lib/tls/i686/cmov/libnss_nis-2.7.so b6997000 8K rw--- /lib/tls/i686/cmov/libnss_nis-2.7.so b6999000 28K r-x-- /lib/tls/i686/cmov/libnss_compat-2.7.so b69a0000 8K rw--- /lib/tls/i686/cmov/libnss_compat-2.7.so b69a2000 36K r-x-- /lib/libpam.so.0.81.6 b69ab000 4K rw--- /lib/libpam.so.0.81.6 b69ac000 28K r--s- /usr/lib/gconv/gconv-modules.cache b69b3000 8K r-x-- /usr/lib/apache2/modules/mod_userdir.so b69b5000 4K rw--- /usr/lib/apache2/modules/mod_userdir.so b69b6000 148K r-x-- /usr/lib/apache2/modules/mod_ssl.so b69db000 8K rw--- /usr/lib/apache2/modules/mod_ssl.so b69dd000 8K rw--- [ anon ] b69df000 8K r-x-- /usr/lib/apache2/modules/mod_setenvif.so b69e1000 4K rw--- /usr/lib/apache2/modules/mod_setenvif.so b69e2000 1128K r-x-- /usr/lib/libxml2.so.2.6.31 b6afc000 20K rw--- /usr/lib/libxml2.so.2.6.31 b6b01000 4K rw--- [ anon ] b6b02000 80K r-x-- /lib/tls/i686/cmov/libnsl-2.7.so b6b16000 8K rw--- /lib/tls/i686/cmov/libnsl-2.7.so b6b18000 8K rw--- [ anon ] b6b1a000 140K r-x-- /lib/tls/i686/cmov/libm-2.7.so b6b3d000 8K rw--- /lib/tls/i686/cmov/libm-2.7.so b6b3f000 60K r-x-- /lib/libbz2.so.1.0.4 b6b4e000 4K rw--- /lib/libbz2.so.1.0.4 b6b4f000 4K r-x-- /usr/lib/libxcb-xlib.so.0.0.0 b6b50000 4K rw--- /usr/lib/libxcb-xlib.so.0.0.0 b6b51000 56K r-x-- /usr/lib/apache2/modules/mod_rewrite.so b6b5f000 4K rw--- /usr/lib/apache2/modules/mod_rewrite.so b6b60000 5060K r-x-- /usr/lib/apache2/modules/libphp5.so b7051000 208K rw--- /usr/lib/apache2/modules/libphp5.so b7085000 20K rw--- [ anon ] b708a000 28K r-x-- /usr/lib/apache2/modules/mod_negotiation.so b7091000 4K rw--- /usr/lib/apache2/modules/mod_negotiation.so b7092000 12K r-x-- /usr/lib/apache2/modules/mod_mime.so b7095000 4K rw--- /usr/lib/apache2/modules/mod_mime.so b7096000 36K r-x-- /usr/lib/apache2/modules/mod_include.so b709f000 4K rw--- /usr/lib/apache2/modules/mod_include.so b70a0000 4K r-x-- /usr/lib/apache2/modules/mod_env.so b70a1000 4K rw--- /usr/lib/apache2/modules/mod_env.so b70a2000 4K r-x-- /usr/lib/apache2/modules/mod_dir.so b70a3000 4K rw--- /usr/lib/apache2/modules/mod_dir.so b70a4000 20K r-x-- /usr/lib/apache2/modules/mod_cgi.so b70a9000 4K rw--- /usr/lib/apache2/modules/mod_cgi.so b70aa000 28K r-x-- /usr/lib/apache2/modules/mod_autoindex.so b70b1000 4K rw--- /usr/lib/apache2/modules/mod_autoindex.so b70b2000 4K r-x-- /usr/lib/apache2/modules/mod_authz_user.so b70b3000 4K rw--- /usr/lib/apache2/modules/mod_authz_user.so b70b4000 8K r-x-- /usr/lib/apache2/modules/mod_authz_host.so b70b6000 4K rw--- /usr/lib/apache2/modules/mod_authz_host.so b70b7000 8K r-x-- /usr/lib/apache2/modules/mod_authz_groupfile.so b70b9000 4K rw--- /usr/lib/apache2/modules/mod_authz_groupfile.so b70ba000 8K rw--- [ anon ] b70bc000 12K r-x-- /lib/libgpg-error.so.0.3.0 b70bf000 4K rw--- /lib/libgpg-error.so.0.3.0 b70c0000 4K rw--- [ anon ] b70c1000 8K r-x-- /lib/libkeyutils-1.2.so b70c3000 4K rw--- /lib/libkeyutils-1.2.so b70c4000 28K r-x-- /usr/lib/libkrb5support.so.0.1 b70cb000 4K rw--- /usr/lib/libkrb5support.so.0.1 b70cc000 136K r-x-- /usr/lib/libk5crypto.so.3.1 b70ee000 4K rw--- /usr/lib/libk5crypto.so.3.1 b70ef000 300K r-x-- /lib/libgcrypt.so.11.2.3 b713a000 8K rw--- /lib/libgcrypt.so.11.2.3 b713c000 80K r-x-- /usr/lib/libz.so.1.2.3.3 b7150000 4K rw--- /usr/lib/libz.so.1.2.3.3 b7151000 4K rw--- [ anon ] b7152000 60K r-x-- /usr/lib/libtasn1.so.3.0.12 b7161000 4K rw--- /usr/lib/libtasn1.so.3.0.12 b7162000 160K r-x-- /usr/lib/libgssapi_krb5.so.2.2 b718a000 4K rw--- /usr/lib/libgssapi_krb5.so.2.2 b718b000 8K r-x-- /lib/libcom_err.so.2.1 b718d000 4K rw--- /lib/libcom_err.so.2.1 b718e000 556K r-x-- /usr/lib/libkrb5.so.3.3 b7219000 8K rw--- /usr/lib/libkrb5.so.3.3 b721b000 1192K r-x-- /usr/lib/i686/cmov/libcrypto.so.0.9.8 b7345000 84K rw--- /usr/lib/i686/cmov/libcrypto.so.0.9.8 b735a000 16K rw--- [ anon ] b735e000 248K r-x-- /usr/lib/i686/cmov/libssl.so.0.9.8 b739c000 16K rw--- /usr/lib/i686/cmov/libssl.so.0.9.8 b73a0000 452K r-x-- /usr/lib/libgnutls.so.13.9.1 b7411000 20K rw--- /usr/lib/libgnutls.so.13.9.1 b7416000 88K r-x-- /usr/lib/libsasl2.so.2.0.22 b742c000 4K rw--- /usr/lib/libsasl2.so.2.0.22 b742d000 60K r-x-- /lib/tls/i686/cmov/libresolv-2.7.so b743c000 8K rw--- /lib/tls/i686/cmov/libresolv-2.7.so b743e000 8K rw--- [ anon ] b7440000 8K r-x-- /lib/tls/i686/cmov/libdl-2.7.so b7442000 8K rw--- /lib/tls/i686/cmov/libdl-2.7.so b7444000 36K r-x-- /lib/tls/i686/cmov/libcrypt-2.7.so b744d000 8K rw--- /lib/tls/i686/cmov/libcrypt-2.7.so b744f000 160K rw--- [ anon ] b7477000 28K r-x-- /lib/tls/i686/cmov/librt-2.7.so b747e000 8K rw--- /lib/tls/i686/cmov/librt-2.7.so b7480000 12K r-x-- /lib/libuuid.so.1.2 b7483000 4K rw--- /lib/libuuid.so.1.2 b7484000 124K r-x-- /usr/lib/libexpat.so.1.5.2 b74a3000 8K rw--- /usr/lib/libexpat.so.1.5.2 b74a5000 396K r-x-- /usr/lib/libsqlite3.so.0.8.6 b7508000 8K rw--- /usr/lib/libsqlite3.so.0.8.6 b750a000 120K r-x-- /usr/lib/libpq.so.5.1 b7528000 4K rw--- /usr/lib/libpq.so.5.1 b7529000 1172K r-x-- /usr/lib/libdb-4.6.so b764e000 8K rw--- /usr/lib/libdb-4.6.so b7650000 4K rw--- [ anon ] b7651000 48K r-x-- /usr/lib/liblber-2.4.so.2.0.5 b765d000 4K rw--- /usr/lib/liblber-2.4.so.2.0.5 b765e000 244K r-x-- /usr/lib/libldap_r-2.4.so.2.0.5 b769b000 4K rw--- /usr/lib/libldap_r-2.4.so.2.0.5 b769c000 8K rw--- [ anon ] b769e000 1316K r-x-- /lib/tls/i686/cmov/libc-2.7.so b77e7000 4K r---- /lib/tls/i686/cmov/libc-2.7.so b77e8000 8K rw--- /lib/tls/i686/cmov/libc-2.7.so b77ea000 12K rw--- [ anon ] b77ed000 80K r-x-- /lib/tls/i686/cmov/libpthread-2.7.so b7801000 8K rw--- /lib/tls/i686/cmov/libpthread-2.7.so b7803000 8K rw--- [ anon ] b7805000 136K r-x-- /usr/lib/libapr-1.so.0.2.11 b7827000 4K rw--- /usr/lib/libapr-1.so.0.2.11 b7828000 4K rw--- [ anon ] b7829000 100K r-x-- /usr/lib/libaprutil-1.so.0.2.11 b7842000 4K rw--- /usr/lib/libaprutil-1.so.0.2.11 b7843000 152K r-x-- /usr/lib/libpcre.so.3.12.1 b7869000 4K rw--- /usr/lib/libpcre.so.3.12.1 b786a000 4K r-x-- /usr/lib/apache2/modules/mod_authz_default.so b786b000 4K rw--- /usr/lib/apache2/modules/mod_authz_default.so b786c000 4K r-x-- /usr/lib/apache2/modules/mod_authn_file.so b786d000 4K rw--- /usr/lib/apache2/modules/mod_authn_file.so b786e000 24K r-x-- /usr/lib/apache2/modules/mod_auth_digest.so b7874000 4K rw--- /usr/lib/apache2/modules/mod_auth_digest.so b7875000 8K r-x-- /usr/lib/apache2/modules/mod_auth_basic.so b7877000 4K rw--- /usr/lib/apache2/modules/mod_auth_basic.so b7878000 8K r-x-- /usr/lib/apache2/modules/mod_alias.so b787a000 4K rw--- /usr/lib/apache2/modules/mod_alias.so b787b000 8K rw--- [ anon ] b787d000 4K r-x-- [ anon ] b787e000 104K r-x-- /lib/ld-2.7.so b7898000 8K rw--- /lib/ld-2.7.so bfd68000 76K rwx-- [ stack ] bfd7b000 8K rw--- [ anon ] total 119008K I have no idea what's going on. I've tried adjusting the usual parameters (MaxClients, MaxRequestsPerClient, etc, but those don't do anything.) Note, also, that this is memory usage on startup - it doesn't grow, it just starts like this and then stays more or less constant. Ideas?

    Read the article

  • Bad Performance when SQL Server hits 99% Memory Usage

    - by user15863
    I've got a server that reports 8 GB of ram used up at 99%. When restart Sql Server, it drops down to about 5% usage, but gradually builds back up to 99% over about 2 hours. When I look at the sqlserver process, its reported as only using 100k ram, and generally never goes up or below that number by very much. In fact, if I add up all the processes in my TaskManager, it's barely scratching the surface of my total available (yet TaskManager still shows 99% memory usage with "All processes shown"). It appears that Sql Server has a huge memory leak going on but it's not reporting it. The server has ran fine for nearly two years, with this only starting to manifest itself in the last 3-4 weeks. Anyone seen this or have any insight into the problem? EDIT When the server hits 99%, performance goes down hill. All queries to the server, apps, etc. come to a crawl. Restarting the service makes things zippy again, until 2 hours has passed and the server hits 99% once again.

    Read the article

  • Limit Apache 2 Memory Usage

    - by UltraNurd
    I am running a hobby webserver off of an ancient Blue & White G3/300 running Debian PPC Squeeze 2.6.30. The performance is okay for a while after a restart, but it eventually gets more and more bogged down. Right now it's at 76 days uptime, and the main culprit seems to be the memory usage of 10+ apache2 processes. I think I need to lower the values for StartServers, MinSpareServers, and/or MaxSpareServers, but I'm not sure which one to adjust, and there are three sections for each depending on which mpm module is in use. How do I tell which of the following sections I need to change, and what are some reasonable values given that the box has 448 MB physical memory (weird upgrade history of one each 64, 128, and 256 sticks)? <IfModule mpm_prefork_module> StartServers 5 MinSpareServers 5 MaxSpareServers 10 MaxClients 150 MaxRequestsPerChild 0 </IfModule> <IfModule mpm_worker_module> StartServers 2 MinSpareThreads 25 MaxSpareThreads 75 ThreadLimit 64 ThreadsPerChild 25 MaxClients 150 MaxRequestsPerChild 0 </IfModule> <IfModule mpm_event_module> StartServers 2 MaxClients 150 MinSpareThreads 25 MaxSpareThreads 75 ThreadLimit 64 ThreadsPerChild 25 MaxRequestsPerChild 0 </IfModule> There aren't any other instances of StartServers in my apache2.conf, but none of those mpm modules appear in mods-available or mods-enabled. Ideas? Thanks!

    Read the article

  • I need advices: small memory footprint linux mail server with spam filtering

    - by petermolnar
    I have a VPS which is originally destined to be a webserver but some minimal mail capabilities are needed to be deployed as well, including sending and receiving as standalone server. The current setup is the following: Postfix reveices the mail, the users are in virtual tables, stored in MySQL on connection all servers are tested with policyd-weight service against some DNSBLs all mail is runs through SpamAssassin spamd with the help of spamc client the mail is then delivered with Dovecot 2' LDA (local delivery agent), virtual users as well As you saw... there's no virus scanner running, and that's for a reason: clamav eats all the memory possible and also, virus mails are all filtered out with this setup (I've tested the same with ClamAV enabled for 1,5 years, no virus mail ever got even to ClamAV) I don't use amavisd and I really don't want to. You only need that monster if you have plenty of memory and lots of simultaneous scanners. It's also a nightmare to fine tune by hand. I run policyd-weight instead of policyd and native DNSBLs in postfix. I don't like to send someone away because a single service listed them. Important statement: everything works fine. I receive very small amount of spam, nearly never get a false positive and most of the bad mail is stopped by policyd-weight. The only "problem" that I feel the services at total uses a bit much memory alltogether. I've already cut the modules of spamassassin (see below), but I'd really like to hear some advices how to cut the memory footprint as low as possible, mostly: what plugins SpamAssassin really needs and what are more or less useless, regarding to my current postfix & policyd-weight setup? SpamAssassin rules are also compiled with sa-compile (sa-update runs once a week from cron, compile runs right after that) These are some of the current configurations that may matter, please tell me if you need anything more. postfix/master.cf (parts only) dovecot unix - n n - - pipe flags=DRhu user=vmail:vmail argv=/usr/bin/spamc -e /usr/lib/dovecot/deliver -d ${recipient} -f {sender} postfix/main.cf (parts only) smtpd_helo_required = yes smtpd_helo_restrictions = permit_mynetworks, reject_invalid_hostname, permit smtpd_recipient_restrictions = permit_mynetworks, permit_sasl_authenticated, reject_invalid_hostname, reject_non_fqdn_hostname, reject_non_fqdn_recipient, reject_unknown_recipient_domain, reject_unauth_pipelining, reject_unauth_destination, check_policy_service inet:127.0.0.1:12525, permit policyd-weight.conf (parts only) $REJECTMSG = "550 Mail appeared to be SPAM or forged. Ask your Mail/DNS-Administrator to correct HELO and DNS MX settings or to get removed from DNSBLs"; $REJECTLEVEL = 4; $DEFER_STRING = 'IN_SPAMCOP= BOGUS_MX='; $DEFER_ACTION = '450'; $DEFER_LEVEL = 5; $DNSERRMSG = '450 No DNS entries for your MTA, HELO and Domain. Contact YOUR administrator'; # 1: ON, 0: OFF (default) # If ON request that ALL clients are only checked against RBLs $dnsbl_checks_only = 0; # 1: ON (default), 0: OFF # When set to ON it logs only RBLs which affect scoring (positive or negative) $LOG_BAD_RBL_ONLY = 1; ## DNSBL settings @dnsbl_score = ( # host, hit, miss, log name 'dnsbl.ahbl.org', 3, -1, 'dnsbl.ahbl.org', 'dnsbl.njabl.org', 3, -1, 'dnsbl.njabl.org', 'dnsbl.sorbs.net', 3, -1, 'dnsbl.sorbs.net', 'bl.spamcop.net', 3, -1, 'bl.spamcop.net', 'zen.spamhaus.org', 3, -1, 'zen.spamhaus.org', 'pbl.spamhaus.org', 3, -1, 'pbl.spamhaus.org', 'cbl.abuseat.org', 3, -1, 'cbl.abuseat.org', 'list.dsbl.org', 3, -1, 'list.dsbl.org', ); # If Client IP is listed in MORE DNSBLS than this var, it gets REJECTed immediately $MAXDNSBLHITS = 3; # alternatively, if the score of DNSBLs is ABOVE this level, reject immediately $MAXDNSBLSCORE = 9; $MAXDNSBLMSG = '550 Az levelezoszerveruk IP cime tul sok spamlistan talahato, kerjuk ellenorizze! / Your MTA is listed in too many DNSBLs; please check.'; ## RHSBL settings @rhsbl_score = ( 'multi.surbl.org', 4, 0, 'multi.surbl.org', 'rhsbl.ahbl.org', 4, 0, 'rhsbl.ahbl.org', 'dsn.rfc-ignorant.org', 4, 0, 'dsn.rfc-ignorant.org', # 'postmaster.rfc-ignorant.org', 0.1, 0, 'postmaster.rfc-ignorant.org', # 'abuse.rfc-ignorant.org', 0.1, 0, 'abuse.rfc-ignorant.org' ); # skip a RBL if this RBL had this many continuous errors $BL_ERROR_SKIP = 2; # skip a RBL for that many times $BL_SKIP_RELEASE = 10; ## cache stuff # must be a directory (add trailing slash) $LOCKPATH = '/var/run/policyd-weight/'; # socket path for the cache daemon. $SPATH = $LOCKPATH.'/polw.sock'; # how many seconds the cache may be idle before starting maintenance routines #NOTE: standard maintenance jobs happen regardless of this setting. $MAXIDLECACHE = 60; # after this number of requests do following maintenance jobs: checking for config changes $MAINTENANCE_LEVEL = 5; # negative (i.e. SPAM) result cache settings ################################## # set to 0 to disable caching for spam results. To this level the cache will be cleaned. $CACHESIZE = 2000; # at this number of entries cleanup takes place $CACHEMAXSIZE = 4000; $CACHEREJECTMSG = '550 temporarily blocked because of previous errors'; # after NTTL retries the cache entry is deleted $NTTL = 1; # client MUST NOT retry within this seconds in order to decrease TTL counter $NTIME = 30; # positve (i.,e. HAM) result cache settings ################################### # set to 0 to disable caching of HAM. To this number of entries the cache will be cleaned $POSCACHESIZE = 1000; # at this number of entries cleanup takes place $POSCACHEMAXSIZE = 2000; $POSCACHEMSG = 'using cached result'; #after PTTL requests the HAM entry must succeed one time the RBL checks again $PTTL = 60; # after $PTIME in HAM Cache the client must pass one time the RBL checks again. #Values must be nonfractal. Accepted time-units: s, m, h, d $PTIME = '3h'; # The client must pass this time the RBL checks in order to be listed as hard-HAM # After this time the client will pass immediately for PTTL within PTIME $TEMP_PTIME = '1d'; ## DNS settings # Retries for ONE DNS-Lookup $DNS_RETRIES = 1; # Retry-interval for ONE DNS-Lookup $DNS_RETRY_IVAL = 5; # max error count for unresponded queries in a complete policy query $MAXDNSERR = 3; $MAXDNSERRMSG = 'passed - too many local DNS-errors'; # persistent udp connection for DNS queries. #broken in Net::DNS version 0.51. Works with Net::DNS 0.53; DEFAULT: off $PUDP= 0; # Force the usage of Net::DNS for RBL lookups. # Normally policyd-weight tries to use a faster RBL lookup routine instead of Net::DNS $USE_NET_DNS = 0; # A list of space separated NS IPs # This overrides resolv.conf settings # Example: $NS = '1.2.3.4 1.2.3.5'; # DEFAULT: empty $NS = ''; # timeout for receiving from cache instance $IPC_TIMEOUT = 2; # If set to 1 policyd-weight closes connections to smtpd clients in order to avoid too many #established connections to one policyd-weight child $TRY_BALANCE = 0; # scores for checks, WARNING: they may manipulate eachother # or be factors for other scores. # HIT score, MISS Score @client_ip_eq_helo_score = (1.5, -1.25 ); @helo_score = (1.5, -2 ); @helo_score = (0, -2 ); @helo_from_mx_eq_ip_score= (1.5, -3.1 ); @helo_numeric_score= (2.5, 0 ); @from_match_regex_verified_helo= (1,-2 ); @from_match_regex_unverified_helo = (1.6, -1.5 ); @from_match_regex_failed_helo = (2.5, 0 ); @helo_seems_dialup = (1.5, 0 ); @failed_helo_seems_dialup= (2, 0 ); @helo_ip_in_client_subnet= (0,-1.2 ); @helo_ip_in_cl16_subnet = (0,-0.41 ); #@client_seems_dialup_score = (3.75, 0 ); @client_seems_dialup_score = (0, 0 ); @from_multiparted = (1.09, 0 ); @from_anon= (1.17, 0 ); @bogus_mx_score = (2.1, 0 ); @random_sender_score = (0.25, 0 ); @rhsbl_penalty_score = (3.1, 0 ); @enforce_dyndns_score = (3, 0 ); spamassassin/init.pre (I've put the .pre files together) loadplugin Mail::SpamAssassin::Plugin::Hashcash loadplugin Mail::SpamAssassin::Plugin::SPF loadplugin Mail::SpamAssassin::Plugin::Pyzor loadplugin Mail::SpamAssassin::Plugin::Razor2 loadplugin Mail::SpamAssassin::Plugin::AutoLearnThreshold loadplugin Mail::SpamAssassin::Plugin::MIMEHeader loadplugin Mail::SpamAssassin::Plugin::ReplaceTags loadplugin Mail::SpamAssassin::Plugin::Check loadplugin Mail::SpamAssassin::Plugin::HTTPSMismatch loadplugin Mail::SpamAssassin::Plugin::URIDetail loadplugin Mail::SpamAssassin::Plugin::Bayes loadplugin Mail::SpamAssassin::Plugin::BodyEval loadplugin Mail::SpamAssassin::Plugin::DNSEval loadplugin Mail::SpamAssassin::Plugin::HTMLEval loadplugin Mail::SpamAssassin::Plugin::HeaderEval loadplugin Mail::SpamAssassin::Plugin::MIMEEval loadplugin Mail::SpamAssassin::Plugin::RelayEval loadplugin Mail::SpamAssassin::Plugin::URIEval loadplugin Mail::SpamAssassin::Plugin::WLBLEval loadplugin Mail::SpamAssassin::Plugin::VBounce loadplugin Mail::SpamAssassin::Plugin::Rule2XSBody spamassassin/local.cf (parts) use_bayes 1 bayes_auto_learn 1 bayes_store_module Mail::SpamAssassin::BayesStore::MySQL bayes_sql_dsn DBI:mysql:db:127.0.0.1:3306 bayes_sql_username user bayes_sql_password pass bayes_ignore_header X-Bogosity bayes_ignore_header X-Spam-Flag bayes_ignore_header X-Spam-Status ### User settings user_scores_dsn DBI:mysql:db:127.0.0.1:3306 user_scores_sql_password user user_scores_sql_username pass user_scores_sql_custom_query SELECT preference, value FROM _TABLE_ WHERE username = _USERNAME_ OR username = '$GLOBAL' OR username = CONCAT('%',_DOMAIN_) ORDER BY username ASC # for better speed score DNS_FROM_AHBL_RHSBL 0 score __RFC_IGNORANT_ENVFROM 0 score DNS_FROM_RFC_DSN 0 score DNS_FROM_RFC_BOGUSMX 0 score __DNS_FROM_RFC_POST 0 score __DNS_FROM_RFC_ABUSE 0 score __DNS_FROM_RFC_WHOIS 0 UPDATE 01 As adaptr advised I remove policyd-weight and configured postfix postscreen, this resulted approximately -15-20 MB from RAM usage and a lot faster work. I'm not sure it's working at full capacity but it seems promising.

    Read the article

  • Magento Apache Config & Memory Issues

    - by cheshirepine
    I have a Magento installation on a VPS that is giving me a headache. This particular VPS has a reasonable spec - 2gb Memory and 50gb storage. It runs a single domain, with a single Magento install - and nothing else. About 5 months ago we started having issues. Every so often (about once every 2 or 3 weeks) the VPS would crash - all processes stopped and the only way to restart the container is via Virtuozzo. Now, however its 2 or 3 times a week. My VPS hosts confirm I am breaching the 2gb memory limit, at which point all VPS processes are killed to stop it bringing the entire node down. I have not made any config changes to it at all - I was running New Relic on it for a short while, but have removed that in case it was contributing to the issues. I can see nothing in the logs which indicates an issue and we have no CRON jobs running at the time the crashes happen. The site generates steady, but not huge amounts of traffic (averaging usually less than 100 visits per day) Is there anything in particular I should have done to the Apache or PHP configs to help? Im not a massivley experienced Apache admin, but know more than enough to solve most problems... Failing that, any other ideas that might help? Can't afford for this site to be down this much.

    Read the article

  • Boost interprocess cached pools

    - by porgarmingduod
    I'm trying to figure out if my reading of the docs for boost interprocess allocators is correct. When using cached_adaptive_pool to allocate memory: typedef cached_adaptive_pool<int, managed_shared_memory::segment_manager> pool_allocator_t; pool_allocator_t pool_allocator(segment.get_segment_manager()); // Allocate an integer in the shared memory segment pool_allocator_t::pointer pool_allocator.allocate_one(); My understanding is that with multiple processes one can allocate and deallocate freely: That is, if I have a cached pool allocator for integers in one process, then it can deallocate integers allocated by similar pools in other processes (provided, of course, that they are working on the same shared memory segment). It may be a stupid question, but working with multiple processes and shared memory is hard enough, so I'd like to know 100% whether I got the basics right.

    Read the article

  • "Mem Usage" higher than "VM Size" in WinXP Task Manager

    - by Frederick
    In my Windows XP Task Manager, some processes display a higher value in the Mem Usage column than the VMSize. My Firefox instance, for example shows 111544 K as mem usage and 100576 K as VMSize. According to the help file of Task Manager Mem Usage is the working set of the process and VMSize is the committed memory in the Virtual address space. My question is, if the number of committed pages for a process is A and the number of pages in physical memory for the same process is B, shouldn't it always be B = A? Isn't the number of pages in physical memory per process a subset of the committed pages? Or is this something to do with sharing of memory among processes? Please explain. (Perhaps my definition of 'Working Set' is off the mark). Thanks.

    Read the article

  • What happens when you run out of ram with mlockall set?

    - by James Dean
    I am working on a C++ application that requires a large amounts of memory for a batch run. ( 20gb) Some of my customers are running into memory limits where sometimes the OS starts swapping and the total run time doubles or worse. I have read that I can use the mlockall to keep the process from being swapped out. What would happen when the process memory requirements approaches or exceeds the the available physical memory in this way? I guess the answer might be OS specific so please list the OS in your answer.

    Read the article

  • Why is free() not allowed in garbage-collected languages?

    - by sundar
    I was reading the C# entry on Wikipedia, and came across: Managed memory cannot be explicitly freed; instead, it is automatically garbage collected. Why is it that in languages with automatic memory management, manual management isn't even allowed? I can see that in most cases it wouldn't be necessary, but wouldn't it come in handy where you are tight on memory and don't want to rely on the GC being smart?

    Read the article

  • jvm issue at startup

    - by Mack
    I can set the max memory as 1000 and not more than that, if I set the memory more than that, it throws the following error. Error occurred during initialization of VM Could not reserve enough space for object heap Could not create the Java virtual machine. My question is, why jvm looks for the max memory at startup? Thanks in advance.

    Read the article

  • Problem with using malloc in link lists (urgent ! help please)

    - by Abhinav
    I've been working on this program for five months now. Its a real time application of a sensor network. I create several link lists during the life of the program and Im using malloc for creating a new node in the link. What happens is that the program suddenly stops or goes crazy and restarts. Im using AVR and the microcontroller is ATMEGA 1281. After a lot of debugging I figured out that that the malloc is causing the problem. I do not free the memory after exiting the function that creates a new link so Im guessing that this is eventually causing the heap memory to overflow or something like that. Now if I use the free() function to deallocate the memory at the end of the function using malloc, the program just gets stuck when the control reaches free(). Is this because the memory becomes too clustered after calling free() ? I also create reference tables for example if 'head' is a new link list and I create another list called current and make it equal to head. table *head; table *current = head; After the end of the function if I use free free(current); current = NULL: Then the program gets stuck here. I dont know what to do. What am I doing wrong? Is there a way to increase the size of the heap memory Please help...

    Read the article

  • Memory corruption in System.Move due to changed 8087CW mode (png + stretchblt)

    - by André Mussche
    I have strange a memory corruption problem. After many hours debugging and trying I think I found something. For example: I do a simple string assignment: sTest := 'SET LOCK_TIMEOUT '; However, the result sometimes becomes: sTest = 'SET LOCK'#0'TIMEOUT ' So, the _ gets replaced by an 0 byte. I have seen this happening once (reproducing is tricky, dependent on timing) in the System.Move function, when it uses the FPU stack (fild, fistp) for fast memory copy (in case of 9 till 32 bytes to move): ... @@SmallMove: {9..32 Byte Move} fild qword ptr [eax+ecx] {Load Last 8} fild qword ptr [eax] {Load First 8} cmp ecx, 8 jle @@Small16 fild qword ptr [eax+8] {Load Second 8} cmp ecx, 16 jle @@Small24 fild qword ptr [eax+16] {Load Third 8} fistp qword ptr [edx+16] {Save Third 8} ... Using the FPU view and 2 memory debug views (Delphi - View - Debug - CPU - Memory) I saw it going wrong... once... could not reproduce however... This morning I read something about the 8087CW mode, and yes, if this is changed into $27F I get memory corruption! Normally it is $133F: The difference between $133F and $027F is that $027F sets up the FPU for doing less precise calculations (limiting to Double in stead of Extended) and different infiniti handling (which was used for older FPU’s, but is not used any more). Okay, now I found why but not when! I changed the working of my AsmProfiler with a simple check (so all functions are checked at enter and leave): if Get8087CW = $27F then //normally $1372? if MainThreadID = GetCurrentThreadId then //only check mainthread DebugBreak; I "profiled" some units and dll's and bingo (see stack): Windows.StretchBlt(3372289943,0,0,514,345,4211154027,0,0,514,345,13369376) pngimage.TPNGObject.DrawPartialTrans(4211154027,(0, 0, 514, 345, (0, 0), (514, 345))) pngimage.TPNGObject.Draw($7FF62450,(0, 0, 514, 345, (0, 0), (514, 345))) Graphics.TCanvas.StretchDraw((0, 0, 514, 345, (0, 0), (514, 345)),$7FECF3D0) ExtCtrls.TImage.Paint Controls.TGraphicControl.WMPaint((15, 4211154027, 0, 0)) So it is happening in StretchBlt... What to do now? Is it a fault of Windows, or a bug in PNG (included in D2007)? Or is the System.Move function not failsafe?

    Read the article

  • PHP GD Allowed memory size exhausted

    - by gurun8
    I'm trying to process a directory of JPEG images (roughly 600+, ranging from 50k to 500k) using PHP: GD to resize and save the images but I've hit a bit of a snag quite early in the process. After correctly processing just 3 images (30K, 18K and 231K) I get a Allowed memory size of 16777216 bytes exhausted PHP Fatal error. I'm cycling through the images and calling the code below: list($w, $h) = getimagesize($src); if ($w > $it->width) { $newwidth = $it->width; $newheight = round(($newwidth * $h) / $w); } elseif ($w > $it->height) { $newheight = $it->height; $newwidth = round(($newheight * $w) / $h); } else { $newwidth = $w; $newheight = $h; } // create resize image $img = imagecreatetruecolor($newwidth, $newheight); $org = imagecreatefromjpeg($src); // Resize imagecopyresized($img, $org, 0, 0, 0, 0, $newwidth, $newheight, $w, $h); imagedestroy($org); imagejpeg($img, $dest); // Free up memory imagedestroy($img); I've tried to free up memory with the imagedestroy function but it doesn't seem to have any affect. The script just keeps consistently choking at the imagecreatefromjpeg line of code. I checked the php.ini and the memory_limit = 16M setting seems like it's holding correctly. But I can't figure out why the memory is filling up. Shouldn't it be releasing the memory back to the garbage collector? I don't really want to increase the memory_limit setting. This seems like a bad workaround that could potentially lead to more issues in the future. FYI: I'm running my script from a command prompt. It shouldn't affect the functionality but might influence your response so I thought I should mention it. Can anyone see if I'm just missing something simple or if there's a design flaw here? You'd think that this would be a pretty straightforward task. Surely this has to be possible, right?

    Read the article

  • JBoss as a windows service. Where can i set the JAVA_OPTS?

    - by ikky
    hi. I'm running JBoss as a windows service, but i can't seem to find where i can configure the JAVA_OPTS to make it work properly. I need to set the Xms and the Xmx. I have tried to just run JBoss manually (run.bat) and in the same file i set the JAVA_OPTS= -Xms128m -Xmx512m. And that works. Here is my install.bat where i install the JBoss as a service: set JBOSS_CLASS_PATH=%JAVA_HOME%\lib\tools.jar;%JBOSS_HOME%\bin\run.jar rem copy /Y JavaService.exe D:\PROJECT\bin\JBossService.exe JBossService.exe -install JBoss %JAVA_HOME%\jre\bin\server\jvm.dll -Djava.class.path=%JBOSS_CLASS_PATH% -start org.jboss.Main -stop org.jboss.Shutdown -method systemExit -out %PROJECT_HOME%\log\JBoss_out.log -err %PROJECT_HOME%\log\JBoss_err.log -current D:\PROJECT\bin net start JBoss When i look at the info about JBoss Application Server (http://localhost:8080/web-console/) i see this info: JVM Environment Free Memory: 9 MB Max Memory: 63 MB Total Memory: 63 MB And i MUST have more Max Memory. Does anybody know where i can set the JAVA_OPTS when running JBoss as a service?

    Read the article

  • iPhone: Does it ever make sense for an object to retain its delegate?

    - by randombits
    According to the rules of memory management in a non garbage collected world, one is not supposed to retain a the calling object in a delegate. Scenario goes like this: I have a class that inherits from UITableViewController and contains a search bar. I run expensive search operations in a secondary thread. This is all done with an NSOperationQueue and subclasses NSOperation instances. I pass the controller as a delegate that adheres to a callback protocol into the NSOperation. There are edge cases when the application crashes because once an item is selected from the UITableViewController, I dismiss it and thus its retain count goes to 0 and dealloc gets invoked on it. The delegate didn't get to send its message in time as the results are being passed at about the same time the dealloc happens. Should I design this differently? Should I call retain on my controller from the delegate to ensure it exists until the NSOperation itself is dealloc'd? Will this cause a memory leak? Right now if I put a retain on the controller, the crashes goes away. I don't want to leak memory though and need to understand if there are cases where retaining the delegate makes sense. Just to recap. UITableViewController creates an NSOperationQueue and NSOperation that gets embedded into the queue. The UITableViewController passes itself as a delegate to NSOperation. NSOperation calls a method on UITableViewController when it's ready. If I retain the UITableViewController, I guarantee it's there, but I'm not sure if I'm leaking memory. If I only use an assign property, edge cases occur where the UITableViewController gets dealloc'd and objc_msgSend() gets called on an object that doesn't exist in memory and a crash is imminent.

    Read the article

  • Completely unintuitive Apache/PHP memory-freeing behavior

    - by David
    Okay, this one's weird. I have a Turnkey Linux server with a gig of dedicated RAM. It's running WP3.2 with a boatload of plug-ins. It's a new site, so it has very limited traffic (other than search engines, maybe 20 hits a week). Now, for a few weeks, every few days, it would max out on main RAM, start eating up virtual RAM, and then crash. It's had this behavior for a while and I've been trying to figure out which element was causing the crash. Nine days ago, I pointed my external server monitor to this server. I wrote a 5-line HTML file (not PHP and not WP) that the server monitor accesses every minute, to see if the server is up. So, now, nine days later, the server has been rock solid, up all the time, no memory leak at all. I changed NOTHING on the server itself to see this behavior change. Have you EVER seen anything like this? All the server monitor is doing is retrieving a single, super-simple HTML file and all the memory leak problems have gone away. Weird, eh?

    Read the article

  • Fastest inline-assembly spinlock

    - by sigvardsen
    I'm writing a multithreaded application in c++, where performance is critical. I need to use a lot of locking while copying small structures between threads, for this I have chosen to use spinlocks. I have done some research and speed testing on this and I found that most implementations are roughly equally fast: Microsofts CRITICAL_SECTION, with SpinCount set to 1000, scores about 140 time units Implementing this algorithm with Microsofts InterlockedCompareExchange scores about 95 time units Ive also tried to use some inline assembly with __asm {} using something like this code and it scores about 70 time units, but I am not sure that a proper memory barrier has been created. Edit: The times given here are the time it takes for 2 threads to lock and unlock the spinlock 1,000,000 times. I know this isn't a lot of difference but as a spinlock is a heavily used object, one would think that programmers would have agreed on the fastest possible way to make a spinlock. Googling it leads to many different approaches however. I would think this aforementioned method would be the fastest if implemented using inline assembly and using the instruction CMPXCHG8B instead of comparing 32bit registers. Furthermore memory barriers must be taken into account, this could be done by LOCK CMPXHG8B (I think?), which guarantees "exclusive rights" to the shared memory between cores. At last [some suggests] that for busy waits should be accompanied by NOP:REP that would enable Hyper-threading processors to switch to another thread, but I am not sure whether this is true or not? From my performance-test of different spinlocks, it is seen that there is not much difference, but for purely academic purpose I would like to know which one is fastest. However as I have extremely limited experience in the assembly-language and with memory barriers, I would be happy if someone could write the assembly code for the last example I provided with LOCK CMPXCHG8B and proper memory barriers in the following template: __asm { spin_lock: ;locking code. spin_unlock: ;unlocking code. }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • I need to debug my BrowserHelperObject (BHO) (in C++ with Visual Studio 2008) after a internet explo

    - by BHOdevelopper
    Hi, here is the situation, i'm developping a Browser Helper Object (BHO) in C++ with Visual Studio 2008, and i learned that the memory wasn't managed the same way in Debug mode than in Release mode. So when i run my BHO in debug mode, internet explorer 8 works just fine and i got no erros at all, the browser stays alive forever, but as soon as i compile it in release mode, i got no errors, no message, nothing, but after 5 minutes i can see through the task manager that internet explorer instances are just eating memory and then the browser just stop responding every time. Please, I really need some hint on how to get a feedback on what could be the error. I heard that, often it was happening because of memory mismanagement. I need a software that just grab a memory dump or something when iexplorer crashes to help me find the problem. Any help is appreciated, I'll be looking for responses every single days, thank you.

    Read the article

< Previous Page | 87 88 89 90 91 92 93 94 95 96 97 98  | Next Page >