Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 914/1408 | < Previous Page | 910 911 912 913 914 915 916 917 918 919 920 921  | Next Page >

  • UITextView cut problem !

    - by Mc.Lover
    Hi , i have problem with cut some text from UITextView , i idon't understand how can implement Cut , for example copy or paste it's like this : -(IBAction)copy { NSString *copyString = [[NSString alloc] initWithFormat:@"%@",[textPad text]]; UIPasteboard *pb = [UIPasteboard generalPasteboard]; [pb setString:copyString]; } -(IBAction)paste { UIPasteboard *pb = [UIPasteboard generalPasteboard]; textPad.text = [pb string]; } but about cut ! thank you ,

    Read the article

  • Best way to return result from business layer to presentation layer when using LINQ-to-SQL

    - by samsur
    I have a business layer that has DTOs that are used in the presentation layer. This application uses entity framework. Here is an example of a class called RoleDTO: public class RoleDTO { public Guid RoleId { get; set; } public string RoleName { get; set; } public string RoleDescription { get; set; } public int? OrganizationId { get; set; } } In the BLL I want to have a method that returns a list of DTO. I would like to know which is the better approach: returning IQueryable or list of DTOs. Although I feel that returning IQueryable is not a good idea because the connection needs to be open. Here are the 2 different methods using the different approaches: First approach public class RoleBLL { private servicedeskEntities sde; public RoleBLL() { sde = new servicedeskEntities(); } public IQueryable<RoleDTO> GetAllRoles() { IQueryable<RoleDTO> role = from r in sde.Roles select new RoleDTO() { RoleId = r.RoleID, RoleName = r.RoleName, RoleDescription = r.RoleDescription, OrganizationId = r.OrganizationId }; return role; } Note: in the above method the DataContext is a private attribute and set in the constructor, so that the connection stays opened. Second approach public static List<RoleDTO> GetAllRoles() { List<RoleDTO> roleDTO = new List<RoleDTO>(); using (servicedeskEntities sde = new servicedeskEntities()) { var roles = from pri in sde.Roles select new { pri.RoleID, pri.RoleName, pri.RoleDescription }; //Add the role entites to the DTO list and return. This is necessary as anonymous types can be returned acrosss methods foreach (var item in roles) { RoleDTO roleItem = new RoleDTO(); roleItem.RoleId = item.RoleID; roleItem.RoleDescription = item.RoleDescription; roleItem.RoleName = item.RoleName; roleDTO.Add(roleItem); } return roleDTO; } } Please let me know, if there is a better approach.

    Read the article

  • Convert month number to month short name

    - by Roland
    I have a variable with the following value $month = 201002; the first 4 numbers represent the year, and the last 2 numbers represent the month. I need to get the last 2 numbers in the month string name eg. Feb My code looks like this <?php echo date('M',substr($month,4,6)); ?> I can I go about to obtain the month name

    Read the article

  • How to bind a double precision using psycopg2

    - by user337636
    I'm trying to bind a float to a postgresql double precision using psycopg2. ele = 1.0/3.0 dic = {'name': 'test', 'ele': ele} sql = '''insert into waypoints (name, elevation) values (%(name)s, %(ele)s)''' cur = db.cursor() cur.execute(sql, dic) db.commit() sql = """select elevation from waypoints where name = 'test'""" cur.execute(sql_out) ele_out = cur.fetchone()[0] ele_out 0.33333333333300003 ele 0.33333333333333331 Obviously I don't need the precision, but I would like to be able to simply compare the values. I could use the struct module and save it as a string, but thought there should be a better way. Thanks

    Read the article

  • What's the difference between these two calls to a function taking a collection of structural types?

    - by James Moore
    Why does the call to fn(Iterator("foo") compile, but the call to fn(fooIterator) fail with an error "type mismatch; found : Iterator[java.lang.String] required: scala.Iterator[com.banshee.Qx.HasLength]" object Qx { type HasLength = {def length: Int} def fn(xs: Iterator[HasLength]) = 3 var tn = fn(Iterator("foo")) var fooIterator = Iterator("foo") var tnFails = fn(fooIterator) //doesn't compile } Aren't they the same thing?

    Read the article

  • JPA 2.0 Eclipse Link

    - by Parhs
    Hello... I have this code @Column(updatable=false) @Enumerated(EnumType.STRING) private ExamType examType; How ever i can change the value when i update it via merge.. WHY????

    Read the article

  • Testing custom constraints in Grails App

    - by WaZ
    Hi there, I have the following as my unit test: void testCreateDealer() { mockForConstraintsTests(Dealer) def _dealer= new Dealer( dealerName:"ABC", Email:"[email protected]", HeadOffice:"", isBranch:false) assertFalse _dealer.validate() } But when I run the test I get the following error: No signature of method: static com.myCompany.Dealer.findByDealerNameIlike() is applicable for argument types: (java.lang.String) values: [ABC] I use some custom constraints in my domain class. How Can I test this? static constraints = { dealerName(blank:false, validator: { val, obj -> def similarDealer = Dealer.findByDealerNameIlike(val) return !similarDealer || (obj.id == similarDealer.id) } )

    Read the article

  • Escape hyperlink with exclamation marks in php.ini

    - by Ciaran McNulty
    I have a config file that takes text warnings like follows: warnings.1 = Please check the date These are presented to the user as HTML. I need to embed a hyperlink like the following: warnings.1 = <a href="http://foo.com/!FOO!/">check with foo</a> I can't for the life of me figure out how to escape this such that parse_ini_file() can read it and get that string the way I want.

    Read the article

  • Given an array of arrays, how can I strip out the substring "GB" from each value?

    - by stormist
    Each item in my array is an array of about 5 values.. Some of them are numerical ending in "GB".. I need the same array but with "GB" stripped out so that just the number remains. So I need to iterate through my whole array, on each subarray take each value and strip the string "GB" from it and create a new array from the output. Can anyone recommend and efficient method of doing this?

    Read the article

  • how to update an Android ListActivity on changing data of the connected SimpleCursorAdapter

    - by 4485670
    I have the following code. What I want to achieve is to update the shown list when I click an entry so I can traverse through the list. I found the two uncommented ways to do it here on stackoverflow, but neither works. I also got the advice to create a new ListActivity on the data update, but that sounds like wasting resources? EDIT: I found the solution myself. All you need to do is call "SimpleCursorAdapter.changeCursor(new Cursor);". No notifying, no things in UI-Thread or whatever. import android.app.ListActivity; import android.database.Cursor; import android.os.Bundle; import android.util.Log; import android.view.View; import android.widget.ListView; import android.widget.SimpleCursorAdapter; public class MyActivity extends ListActivity { private DepartmentDbAdapter mDbHelper; private Cursor cursor; private String[] from = new String[] { DepartmentDbAdapter.KEY_NAME }; private int[] to = new int[] { R.id.text1 }; private SimpleCursorAdapter notes; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.departments_list); mDbHelper = new DepartmentDbAdapter(this); mDbHelper.open(); // Get all of the departments from the database and create the item list cursor = mDbHelper.fetchSubItemByParentId(1); this.startManagingCursor(cursor); // Now create an array adapter and set it to display using our row notes = new SimpleCursorAdapter(this, R.layout.department_row, cursor, from, to); this.setListAdapter(notes); } @Override protected void onListItemClick(ListView l, View v, int position, long id) { super.onListItemClick(l, v, position, id); // get new data and update the list this.updateData(safeLongToInt(id)); } /** * update data for the list * * @param int departmentId id of the parent department */ private void updateData(int departmentId) { // close the old one, get a new one cursor.close(); cursor = mDbHelper.fetchSubItemByParentId(departmentId); // change the cursor of the adapter to the new one notes.changeCursor(cursor); } /** * safely convert long to in to save memory * * @param long l the long variable * * @return integer */ public static int safeLongToInt(long l) { if (l < Integer.MIN_VALUE || l > Integer.MAX_VALUE) { throw new IllegalArgumentException (l + " cannot be cast to int without changing its value."); } return (int) l; } }

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • jms unresolved message-destination-ref

    - by portoalet
    hi, I am using netbeans 6.8, and glassfish v3, and making a simple jms application to work. I got this: com.sun.enterprise.container.common.spi.util.InjectionException: Exception attempting to inject Unresolved Message-Destination-Ref jms/[email protected]@null into class enterpriseapplication4.Main Code: public class Main { @Resource(name = "jms/myQueue") private static Topic myQueue; @Resource(name = "jms/myFactory") private static ConnectionFactory myFactory; ... // the rest is just boiler plate created by netbeans } In my Glassfish v3 admin console, I have jms/myFactory as my ConnectionFactory and jms/myQueue as my Destination Resources. What am I missing? Full stack: WARNING: enterprise.deployment.backend.invalidDescriptorMappingFailure com.sun.enterprise.container.common.spi.util.InjectionException: Exception attempting to inject Unresolved Message-Destination-Ref jms/[email protected]@null into class enterpriseapplication4.Main at com.sun.enterprise.container.common.impl.util.InjectionManagerImpl._inject(InjectionManagerImpl.java:614) at com.sun.enterprise.container.common.impl.util.InjectionManagerImpl.inject(InjectionManagerImpl.java:384) at com.sun.enterprise.container.common.impl.util.InjectionManagerImpl.injectClass(InjectionManagerImpl.java:210) at com.sun.enterprise.container.common.impl.util.InjectionManagerImpl.injectClass(InjectionManagerImpl.java:202) at org.glassfish.appclient.client.acc.AppClientContainer$ClientMainClassSetting.getClientMainClass(AppClientContainer.java:599) at org.glassfish.appclient.client.acc.AppClientContainer.getMainMethod(AppClientContainer.java:498) at org.glassfish.appclient.client.acc.AppClientContainer.completePreparation(AppClientContainer.java:397) at org.glassfish.appclient.client.acc.AppClientContainer.prepare(AppClientContainer.java:311) at org.glassfish.appclient.client.AppClientFacade.prepareACC(AppClientFacade.java:264) at org.glassfish.appclient.client.acc.agent.AppClientContainerAgent.premain(AppClientContainerAgent.java:75) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at sun.instrument.InstrumentationImpl.loadClassAndStartAgent(InstrumentationImpl.java:323) at sun.instrument.InstrumentationImpl.loadClassAndCallPremain(InstrumentationImpl.java:338) Caused by: javax.naming.NamingException: Lookup failed for 'java:comp/env/jms/myQueue' in SerialContext targetHost=localhost,targetPort=3700 [Root exception is javax.naming.NameNotFoundException: No object bound for java:comp/env/jms/myQueue [Root exception is java.lang.NullPointerException]] at com.sun.enterprise.naming.impl.SerialContext.lookup(SerialContext.java:442) at javax.naming.InitialContext.lookup(InitialContext.java:392) at com.sun.enterprise.container.common.impl.util.InjectionManagerImpl._inject(InjectionManagerImpl.java:513) ... 15 more Caused by: javax.naming.NameNotFoundException: No object bound for java:comp/env/jms/myQueue [Root exception is java.lang.NullPointerException] at com.sun.enterprise.naming.impl.JavaURLContext.lookup(JavaURLContext.java:218) at com.sun.enterprise.naming.impl.SerialContext.lookup(SerialContext.java:428) ... 17 more Caused by: java.lang.NullPointerException at javax.naming.InitialContext.getURLScheme(InitialContext.java:269) at javax.naming.InitialContext.getURLOrDefaultInitCtx(InitialContext.java:318) at javax.naming.InitialContext.lookup(InitialContext.java:392) at com.sun.enterprise.naming.util.JndiNamingObjectFactory.create(JndiNamingObjectFactory.java:75) at com.sun.enterprise.naming.impl.GlassfishNamingManagerImpl.lookup(GlassfishNamingManagerImpl.java:688) at com.sun.enterprise.naming.impl.GlassfishNamingManagerImpl.lookup(GlassfishNamingManagerImpl.java:657) at com.sun.enterprise.naming.impl.JavaURLContext.lookup(JavaURLContext.java:148) ... 18 more Regards

    Read the article

  • How to properly encode "[" and "]" in queries using Apache HttpClient?

    - by Jason Nichols
    I've got a GET method that looks like the following: GetMethod method = new GetMethod("http://host/path/?key=[\"item\",\"item\"]"); Such a path works just fine when typed directly into a browser, but the above line when run causes an IllegalArgumentException : Invalid URI. I've looked at using the URIUtils class, but without success. Is there a way to automatically encode this (or to add a query string onto the URL without causing HttpClient to barf?).

    Read the article

  • How should I parse this simple text file in Java?

    - by Winston
    I have a text file that looks like this: grn129 agri- ac-214 ahss hud114 ahss lov1150 ahss lov1160 ahss lov1170 ahss lov1210 ahss What is the best way to parse this file using Java if I want to create a HashMap with the first column as the key and the second column as the value. Should I use the Scanner class? Try to read in the whole file as a string and split it? What is the best way?

    Read the article

  • Reverse regular expressions to generate data

    - by Anton Gogolev
    In one of the StackOverflow Podcasts (the one where guys were discussing data generation for testing DBs -- either #11 or #12), Jeff mentioned something like "reverse regular expressions", which are used exactly for that purpose: given a regex, produce a string which will eventually match said regex. What is the correct term for this whole concept? Is this a well-known concept?

    Read the article

  • PHP - preg_replace with multiple matches

    - by Neil
    Let's say I have a string like: $text = "<object>item_id1a2b3</object>xxx<object>item_id4c5d6</object>" I want to convert it to: %ITEM:1a2b3xxx%ITEM:4c5d6 Here's what I've got: $text = preg_replace("/<object.*item_id([a-zA-Z0-9]+).*<\/object/","%ITEM:$1",$text); This isn't quite right, as the search is greedy. Thoughts? Thanks!

    Read the article

  • How do I reflect over the members of dynamic object?

    - by Flatliner DOA
    I need to get a dictionary of properties and their values from an object declared with the dynamic keyword in .NET 4? It seems using reflection for this will not work. Example: dynamic s = new ExpandoObject(); s.Path = "/Home"; s.Name = "Home"; // How do I enumerate the Path and Name properties and get their values? IDictionary<string, object> propertyValues = ???

    Read the article

  • Flex: Constant strings in metadata

    - by Daniel Engmann
    I have something like public class Controller { [Observer("fetchEmployeesEvent")] public function fetchEmployees() : void { //doSomething } } and I want something like public class Controller { public static const FETCH_EMPLOYEES_EVENT : String = "fetchEmployeesEvent"; [Observer(FETCH_EMPLOYEES_EVENT)] public function fetchEmployees() : void { //doSomething } } My problem is that only the first code snippet works. Flex seems to ignore the constant FETCH_EMPLOYEES_EVENT in the metadata-tag. My question is: Is it somehow possible to use constant strings in metadata?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 910 911 912 913 914 915 916 917 918 919 920 921  | Next Page >