Search Results

Search found 35200 results on 1408 pages for 't string'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 914/1408 | < Previous Page | 910 911 912 913 914 915 916 917 918 919 920 921  | Next Page >

  • I want to trace logs using a Macro multi parameter always null. problem c++ windows

    - by sxingfeng
    I am using the following way to cout a function's time: #define TIME_COST(message, ...)\ char szMessageBuffer[2048] = {0};\ va_list ArgList;\ va_start(ArgList, message);\ vsprintf_s(szMessageBuffer, 2048, message, ArgList);\ va_end(ArgList); \ string strMessage(szMessageBuffer);\ CQLogTimer t(strMessage); // CQLogTimer is a self destructor,which will cout life time of its own and print szMessageBuffer. However when I use the macro this : void fun { TIME_COST("hello->%s", filePath); XXXXXX } The message generated always is hello-(null) Can Any one help? Many thanks!

    Read the article

  • rawurlencode() and urlencode() not working in CodeIgniter

    - by Keith Chason
    I am trying to encode a string into a safe url for generic purposes, and neither rawurlencode() nor urlencode() work when using CodeIgniter. I have used them and they work pefectly fine with straight PHP, but for whatever reason, it doesn't work. I haven't been able to find any others with this problem and thus no solution. Code: <a href="/search/degree/<?=rawurlencode($row->degree)?>" class="element_link"><?=$row->degree?></a>

    Read the article

  • Reusing a NSString variable - does it cause a memory leak?

    - by Chris S
    Coming from a .NET background I'm use to reusing string variables for storage, so is the code below likely to cause a memory leak? The code is targeting OS X on the iphone/itouch so no automatic GC. -(NSString*) stringExample { NSString *result = @"example"; result = [result stringByAppendingString:@" test"]; // where does "example" go? return result; } What confuses me is an NSStrings are immutable, but you can reuse an 'immutable' variable with no problem.

    Read the article

  • download file exception handling

    - by klaus-vlad
    Hi, In my application I download several critical files from a server, and I want to write some code that handles the case where the a file download didn't complete for a reason or other ,to retry downloading it at next startup. The function that downloads a file at a time however throws only MalformedURLException and IOException , but if these exceptions are thrown that means that the download didn't even begin. How should I arrange things so I can treat the case where a download failed , even if it began ? download(String file) throws MalformedURLException ,IOException { }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Contravariant Delegates Value Types

    - by ChloeRadshaw
    Can anyone shed light on why contravariance does not work with C# value types? The below does not work private delegate Asset AssetDelegate(int m); internal string DoMe() { AssetDelegate aw = new AssetDelegate(DelegateMethod); aw(32); return "Class1"; } private static House DelegateMethod(object m) { return null; }

    Read the article

  • how could I store data within a GUID

    - by Mark
    I have an application that I want to represent a users session (just small pieces of data here and there) within a GUID. Its a 16 HEX characters (so 16^16 possible values) string and I want to 'encode' some data within that GUID. How can I achieve this? I am really after any ideas and implementations here, Ive not yet decided on the best mechanism for it yet. I would also like encryption to be involved if possible... Thanks a lot Mark

    Read the article

  • How to compute palindrome from a stream of characters in sub-linear space/time?

    - by wrick
    I don't even know if a solution exists or not. Here is the problem in detail. You are a program that is accepting an infinitely long stream of characters (for simplicity you can assume characters are either 1 or 0). At any point, I can stop the stream (let's say after N characters were passed through) and ask you if the string received so far is a palindrome or not. How can you do this using less sub-linear space and/or time.

    Read the article

  • Parameter has no walue

    - by Simon
    string queryString = "SELECT SUM(skupaj_kalorij)as Skupaj_Kalorij " + "FROM (obroki_save LEFT JOIN users ON obroki_save.ID_uporabnika=users.ID)" + "WHERE users.ID= " + a.ToString() + " AND obroki_save.datum =?"; using (OleDbCommand cmd = new OleDbCommand(queryString,database)) { cmd.Parameters.Add("@datum", OleDbType.Char).Value = DateTime.Now.ToShortDateString(); } Why doesn't the parametr datum get the date value? (the value of at least one complex parameter has not been determined )

    Read the article

  • xml error: Object reference not set to an instance of an object after SelectSingleNode

    - by every_answer_gets_a_point
    here's my code: XmlDocument doc = new XmlDocument(); foreach (string c in colorList) { doc.Load(@"http://whoisxmlapi.com/whoisserver/WhoisService?domainName=" + c + @"&username=user&password=pass"); textBox1.Text += doc.SelectSingleNode("WhoisRecord/registrant/email").InnerText + ","; } for the second line of code (textbox1...) is generating this error what am i doing wrong?

    Read the article

  • excluding posts in Wordpress

    - by Ayrton
    I wondered how I could exclude posts in Wordpress. E.g. I have a string $exclude_ids (= "4,5,6") or (="-4,-5,-6") and I would like to prevent these posts from showing up. How would I do that? I already tried: query_posts('p=' . $exclude_ids); but that didn't really work out and I didn't really find any information regarding this topic on google. Cheers

    Read the article

  • Using @Resource to load environment entries

    - by a1ex07
    Hi, I'm trying to load bean runtime configuration. @Stateless public class MyBean implements MyLocal{ @Resource String runtimeSetting1="default_value"; //.... } I cannot find out how to create custom resource on app server side (Glassfish) - I have no idea what I should enter in "Factory Class" field. Maybe there is a better way of loading configuration... Thanks.

    Read the article

  • Delegates And Cross Thread Exception

    - by Neo
    Whenever i am updating UI in windows form using delegate it gives me cross thread exception why it is happening like this? is there new thread started for each delegate call ? void Port_DataReceived(object sender, SerialDataReceivedEventArgs e) { //this call delegate to display data clsConnect(statusMsg); } protected void displayResponse(string resp) { //here cross thread exception occur if directly set to lblMsgResp.Text="Test"; if (lblMsgResp.InvokeRequired) { lblMsgResp.Invoke(new MethodInvoker(delegate { lblMsgResp.Text = resp; })); } }

    Read the article

  • Datable.Select sort expression

    - by xyz
    Hi, I have datatable with column name tag and 100 rows of data.I need to filter this table with tag starting with "UNKNOWN". What should my sortexpression for datatable.select be ? I'm trying the following. Datarow[] abc = null; abc = dtTagList.Select(string.format("tag='{0}'","UNKNOWN")) How can I achieve tag startswith 'UNKNOWN' in the above code ?

    Read the article

  • jQuery question

    - by Fuxi
    hi all, i'm having the following string <img alt="over 40 world famous brandedWATCHES BRANDs to choose from " src="http://www.fastblings.com/images/logo.jpg"></strong></a><br> i want to define a regex pattern like <img alt="(.+?)" src="http://(.+?).(jpg|gif)"> but as u can see the target strings has a linebreak in the alt attribute - so how can i incorporate this? the rule should be like "anything in the alt-attribute including linebreaks" thx

    Read the article

  • sql query not executing

    - by sarah
    Hi, Not able to execute a query ,i need to check if end date is greater than today in the following query Getting an error invalid query select * from table1 where user in ('a') and END_DATE >'2010-05-22' getting an error liter string does not match

    Read the article

  • whats wrong with this php mysql_real_escape_string

    - by skyhigh
    Hi Atomic Number Latin English Abbreviation * check the variables for content */ /*** a list of filters ***/ $filters = array( 'searchtext' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string'), 'fieldname' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string') ); /*** escape all POST variables ***/ $input = filter_input_array(INPUT_POST, $filters); /*** check the values are not empty ***/ if(empty($input['fieldname']) || empty($input['searchtext'])) { echo 'Invalid search'; } else { /*** mysql hostname ***/ $hostname = 'localhost'; /*** mysql username ***/ $username = 'username'; /*** mysql password ***/ $password = 'password'; /*** mysql database name ***/ $dbname = 'periodic_table'; /*** connect to the database ***/ $link = @mysql_connect($hostname, $username, $password); /*** check if the link is a valid resource ***/ if(is_resource($link)) { /*** select the database we wish to use ***/ if(mysql_select_db($dbname, $link) === TRUE) { /*** sql to SELECT information***/ $sql = sprintf("SELECT * FROM elements WHERE %s = '%s'", $input['fieldname'], $input['searchtext']); /*** echo the sql query ***/ echo '<h3>'.$sql.'</h3>'; /*** run the query ***/ $result = mysql_query($sql); /*** check if the result is a valid resource ***/ if(is_resource($result)) { /*** check if we have more than zero rows ***/ if(mysql_num_rows($result) !== 0) { echo '<table>'; while($row=mysql_fetch_array($result)) { echo '<tr> <td>'.$row['atomicnumber'].'</td> <td>'.$row['latin'].'</td> <td>'.$row['english'].'</td> <td>'.$row['abbr'].'</td> </tr>'; } echo '</table>'; } else { /*** if zero results are found.. ***/ echo 'Zero results found'; } } else { /*** if the resource is not valid ***/ 'No valid resource found'; } } /*** if we are unable to select the database show an error ****/ else { echo 'Unable to select database '.$dbname; } /*** close the connection ***/ mysql_close($link); } else { /*** if we fail to connect ***/ echo 'Unable to connect'; } } } else { echo 'Please Choose An Element'; } ? I got this code from phppro.org tutorials site and i tried to run it. It gives Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: A link to the server could not be established. .... Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: Access denied for user 'ODBC'@'localhost' (using password: NO).... I went to php.net and look it up "Note: A MySQL connection is required before using mysql_real_escape_string() otherwise an error of level E_WARNING is generated, and FALSE is returned. If link_identifier isn't defined, the last MySQL connection is used." My questions are: 1-why they put single quotation around mysql_real_escape_string ? 2-They should establish a connection first, then use the $filter array statement with mysql_real_escape_string ?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 910 911 912 913 914 915 916 917 918 919 920 921  | Next Page >