Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 910/1408 | < Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >

  • Assign value to HTML textbox from JSP

    - by prakash_d22
    Hello I am creating a web page to add some information about given product.I need to enter id,name,description and image as information.I need the id to be auto generated.I am using jsp and database as access.I am fetching the count(*)+1 value from database and assigning to my html text box but its showing as null.can i get some help? Code: <body> <%@page import="java.sql.*"%> <%! String no; %> <% try{ Class.forName("sun.jdbc.odbc.JdbcOdbcDriver"); Connection con = DriverManager.getConnection("jdbc:odbc:pd"); ResultSet rs = null; Statement st = con.createStatement(); String sql = ("select count(*)+1 from products"); st.executeUpdate(sql); while (rs.next()) { no=rs.getString("count(*)+1"); } rs.close(); st.close(); con.close(); } catch(Exception e){} %> <Form name='Form1' action="productcode.jsp" method="post"> <table width="1024" border="0"> <tr> <td width="10">&nbsp;</td> <td width="126">Add Product: </td> <td width="277">&nbsp;</td> <td width="583">&nbsp;</td> </tr> <tr> <td>&nbsp;</td> <td>Product Id:</td> <td><label> <input type="text" name="id" value="<%= no%>"/> </label></td> <td>&nbsp;</td> .... and so on

    Read the article

  • displaying data from database in to text box

    - by srinayak
    I have 2 JSP pages as below: projectcategory.jsp <% Connection con = DbConnect.connect(); Statement s = con.createStatement(); ResultSet rs = s.executeQuery("select * from projectcategory"); %> <DIV class="TabbedPanelsContent" align="center"> <TABLE border="1"> <TR> <TH>CATEGORY ID</TH> <TH>CATEGORY NAME</TH> <TH>Edit/Update</TH> </TR> <% while (rs.next()) { %> <%String p=rs.getString(1);%> <TR> <TD><%=rs.getString(1)%></TD> <TD><%=rs.getString(2)%></TD> <TD> <FORM action="EditPcat.jsp?pcatid=p"><INPUT type="submit" value='edit/update'></INPUT> </FORM> </TD> </TR> <% } %> </TABLE> </DIV> another is Editpcat.jsp: </head> <body> <%String s=request.getParameter("p"); %> <form action="ProjCatServlet" method="post"> <div align="right"><a href="projectcategory.jsp">view</a></div> <fieldset> <legend>Edit category</legend> <table cellspacing="2" cellpadding="2" border="0"> <tr> <td align="left">Category Id</td> <td><input type="text" name="pcatid" value="<%=s%>" ></td> </tr> <tr> <td align="right">Category Name</td> <td><input type="text" name="pcatname"></td> </tr> <tr> <td><input type="submit" value="submit"></td> </tr> </table> <input type="hidden" name="FUNCTION_ID" value="UPDATE"> </fieldset> </form> How to display value from one JSP page which we get from database in to text box of another JSP?

    Read the article

  • Java accessing variables using extends

    - by delo
    So here I have two classes: Customer Order Class and Confirmation Class. I want to access the data stored in LastNameTextField (Customer Order Class) and set it as the text for UserLastNameLabel (Confirmation Class) after clicking a "Submit" button. For some reason however, the output displays nothing. Snippet of my code: package customer_order; public class customer_order extends Frame{ private static final long serialVersionUID = 1L; private JPanel jPanel = null; private JLabel LastNameLabel = null; protected JTextField LastNameTextField = null; private JButton SubmitButton = null; public String s; public customer_order() { super(); initialize(); } private void initialize() { this.setSize(729, 400); this.setTitle("Customer Order"); this.add(getJPanel(), BorderLayout.CENTER); } /** * This method initializes LastNameTextField * * @return javax.swing.JTextField */ public JTextField getLastNameTextField() { if (LastNameTextField == null) { LastNameTextField = new JTextField(); LastNameTextField.setBounds(new Rectangle(120, 100, 164, 28)); LastNameTextField.setName("LastNameTextField"); } return LastNameTextField; } /** * This method initializes SubmitButton * * @return javax.swing.JButton */ private JButton getSubmitButton() { if (SubmitButton == null) { SubmitButton = new JButton(); SubmitButton.setBounds(new Rectangle(501, 225, 96, 29)); SubmitButton.setName("SubmitButton"); SubmitButton.setText("Submit"); SubmitButton.addActionListener(new java.awt.event.ActionListener() { public void actionPerformed(java.awt.event.ActionEvent e) { System.out.println("actionPerformed()"); // TODO Auto-generated Event stub actionPerformed() //THE STRING I WANT s = LastNameTextField.getText(); java.awt.EventQueue.invokeLater(new Runnable() { public void run() { new confirmation().setVisible(true); } }); } }); } return SubmitButton; } package customer_order; public class confirmation extends customer_order{ private static final long serialVersionUID = 1L; private JPanel jPanel = null; // @jve:decl-index=0:visual-constraint="58,9" private JLabel LastNameLabel = null; private JLabel UserLastNameLabel = null; // @jve:decl-index=0: /** * This method initializes frame * * @return java.awt.Frame */ public confirmation() { super(); initialize(); } private void initialize() { this.setSize(729, 400); this.setTitle("Confirmation"); this.add(getJPanel(), BorderLayout.CENTER); } /** * This method initializes jPanel * * @return javax.swing.JPanel */ private JPanel getJPanel() { if (jPanel == null) { UserLastNameLabel = new JLabel(); UserLastNameLabel.setBounds(new Rectangle(121, 60, 167, 26)); //THE PROBLEM? UserLastNameLabel.setText(s); } return jPanel; }

    Read the article

  • Reverse regular expressions to generate data

    - by Anton Gogolev
    In one of the StackOverflow Podcasts (the one where guys were discussing data generation for testing DBs -- either #11 or #12), Jeff mentioned something like "reverse regular expressions", which are used exactly for that purpose: given a regex, produce a string which will eventually match said regex. What is the correct term for this whole concept? Is this a well-known concept?

    Read the article

  • How should I parse this simple text file in Java?

    - by Winston
    I have a text file that looks like this: grn129 agri- ac-214 ahss hud114 ahss lov1150 ahss lov1160 ahss lov1170 ahss lov1210 ahss What is the best way to parse this file using Java if I want to create a HashMap with the first column as the key and the second column as the value. Should I use the Scanner class? Try to read in the whole file as a string and split it? What is the best way?

    Read the article

  • Where can I find a library that parses source code and is able to extract the scope of where your cursor is currently in the code?

    - by Anthony
    In SublimeText(2), when you press [ctrl + shift + p] (mac osx) you are shown a scope of where your caret/cursor is in the source code at the given moment e.g.: entity.name.tag.inline.any.html meta.tag.inline.any.html text.html.basic I am curious about what library or script is used to parse the document/file and create that scope string. A sidenote: Typing view.syntax_name(view.sel()[0].b) into Sublime's console will output the scope as well.

    Read the article

  • Confused about NoMethodError in Ruby

    - by E L
    In a simple Ruby example, I'm getting an error that does not occur in irb. name = "Joe" def say_hi "\"Hi there!\" said #{self}" end response = name.say_hi puts response This code should return, "Hi there!" said Joe. It works perfectly fine in irb. However, when I attempt to put the same code in a file and run the file, I get this error: say_hi.rb:8:in `<main>': private method `say_hi' called for "Joe":String (NoMethodError) Any suggestion about why this happens?

    Read the article

  • Releasing the keyboard stops shake events. Why?

    - by Moshe
    1) How do I make a UITextField resign the keyboard and hide it? The keyboard is in a dynamically created subview whose superview looks for shake events. Resigning first responder seems to break the shake event handler. 2) how do you make the view holding the keyboard transparent, like see through glass? I have seen this done before. This part has been taken care of thanks guys. As always, code samples are appreciated. I've added my own to help explain the problem. EDIT: Basically, - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event; gets called in my main view controller to handle shaking. When a user taps on the "edit" icon (a pen, in the bottom of the screen - not the traditional UINavigationBar edit button), the main view adds a subview to itself and animates it on to the screen using a custom animation. This subview contains a UINavigationController which holds a UITableView. The UITableView, when a cell is tapped on, loads a subview into itself. This second subview is the culprit. For some reason, a UITextField in this second subview is causing problems. When a user taps on the view, the main view will not respond to shakes unless the UITextField is active (in editing mode?). Additional info: My Motion Event Handler: - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event { NSLog(@"%@", [event description]); SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"shake" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); [self genRandom:TRUE]; } The genRandom: Method: /* Generate random label and apply it */ -(void)genRandom:(BOOL)deviceWasShaken{ if(deviceWasShaken == TRUE){ decisionText.text = [NSString stringWithFormat: (@"%@", [shakeReplies objectAtIndex:(arc4random() % [shakeReplies count])])]; }else{ SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"string" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); decisionText.text = [NSString stringWithFormat: (@"%@", [pokeReplies objectAtIndex:(arc4random() % [pokeReplies count])])]; } } shakeReplies and pokeReplies are both NSArrays of strings. One is used for when a certain part of the screen is poked and one is for when the device is shaken. The app will randomly choose a string from the NSArray and display onscreen. For those of you who work graphically, here is a diagram of the view hierarchy: Root View -> UINavigationController -> UITableView -> Edit View -> Problem UITextfield

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Placeholder for UITextView

    - by Gill Bates
    Anyone ever implements something in UITextView that stopping it from receiving future inputs when the text length is smaller than certain threshold? I plan to implement a textview like we have in the mail composer interface. We have a placeholder "Subject" there, and the cursor starts after. Placeholder in UITextView Inspired from this question, I wonder if there are some methods which could be used to stop changing the text in the UITextView once the cursor is moving back to the placeholder string. Any ideas?

    Read the article

  • How to check if numbers are in correct sequence?

    - by Nazariy
    I have a two dimensional array that contain range of numbers that have to be validated using following rules, range should start from 0 and follow in arithmetic progression. For example: $array = array(); $array[] = array(0);//VALID $array[] = array(0,1,2,3,4,5);//VALID $array[] = array("0","1");//VALID $array[] = array(0,1,3,4,5,6);//WRONG $array[] = array(1,2,3,4,5);//WRONG $array[] = array(0,0,1,2,3,4);//WRONG what is most efficient way to do that in php? UPDATE I forgot to add that numbers can be represented as string

    Read the article

  • Best way to return result from business layer to presentation layer when using LINQ-to-SQL

    - by samsur
    I have a business layer that has DTOs that are used in the presentation layer. This application uses entity framework. Here is an example of a class called RoleDTO: public class RoleDTO { public Guid RoleId { get; set; } public string RoleName { get; set; } public string RoleDescription { get; set; } public int? OrganizationId { get; set; } } In the BLL I want to have a method that returns a list of DTO. I would like to know which is the better approach: returning IQueryable or list of DTOs. Although I feel that returning IQueryable is not a good idea because the connection needs to be open. Here are the 2 different methods using the different approaches: First approach public class RoleBLL { private servicedeskEntities sde; public RoleBLL() { sde = new servicedeskEntities(); } public IQueryable<RoleDTO> GetAllRoles() { IQueryable<RoleDTO> role = from r in sde.Roles select new RoleDTO() { RoleId = r.RoleID, RoleName = r.RoleName, RoleDescription = r.RoleDescription, OrganizationId = r.OrganizationId }; return role; } Note: in the above method the DataContext is a private attribute and set in the constructor, so that the connection stays opened. Second approach public static List<RoleDTO> GetAllRoles() { List<RoleDTO> roleDTO = new List<RoleDTO>(); using (servicedeskEntities sde = new servicedeskEntities()) { var roles = from pri in sde.Roles select new { pri.RoleID, pri.RoleName, pri.RoleDescription }; //Add the role entites to the DTO list and return. This is necessary as anonymous types can be returned acrosss methods foreach (var item in roles) { RoleDTO roleItem = new RoleDTO(); roleItem.RoleId = item.RoleID; roleItem.RoleDescription = item.RoleDescription; roleItem.RoleName = item.RoleName; roleDTO.Add(roleItem); } return roleDTO; } } Please let me know, if there is a better approach.

    Read the article

  • Download file using ajax and webservice

    - by megabyte
    Hi All There is this 3rd party webservice. One of the public webmethods available is a GetDocument() method. This method returns a Document object. The Document object has properties for File(byte[]), ContentType(string) ect. My Question : Can I subscribe to this service using javascript(mootools) + ajax + JSON, return the document object, in this case an excel document, and force the file download?

    Read the article

  • C++ Class Access Specifier Verbosity

    - by PolyTex
    A "traditional" C++ class (just some random declarations) might resemble the following: class Foo { public: Foo(); explicit Foo(const std::string&); ~Foo(); enum FooState { Idle, Busy, Unknown }; FooState GetState() const; bool GetBar() const; void SetBaz(int); private: struct FooPartialImpl; void HelperFunction1(); void HelperFunction2(); void HelperFunction3(); FooPartialImpl* m_impl; // smart ptr FooState m_state; bool m_bar; int m_baz; }; I always found this type of access level specification ugly and difficult to follow if the original programmer didn't organize his "access regions" neatly. Taking a look at the same snippet in a Java/C# style, we get: class Foo { public: Foo(); public: explicit Foo(const std::string&); public: ~Foo(); public: enum FooState { Idle, Busy, Unknown }; public: FooState GetState() const; public: bool GetBar() const; public: void SetBaz(int); private: struct FooPartialImpl; private: void HelperFunction1(); private: void HelperFunction2(); private: void HelperFunction3(); private: FooPartialImpl* m_impl; // smart ptr private: FooState m_state; private: bool m_bar; private: int m_baz; }; In my opinion, this is much easier to read in a header because the access specifier is right next to the target, and not a bunch of lines away. I found this especially true when working with header-only template code that wasn't separated into the usual "*.hpp/*.inl" pair. In that scenario, the size of the function implementations overpowered this small but important information. My question is simple and stems from the fact that I've never seen anyone else actively do this in their C++ code. Assuming that I don't have a "Class View" capable IDE, are there any obvious drawbacks to using this level of verbosity? Any other style recommendations are welcome!

    Read the article

  • Java Method declaration

    - by user1701604
    I'm trying to declare a method for my program that takes only a 5 digit integer and for each digit of the integer, reads a value from the program and prints it out. I understand this isn't very clear but im having trouble relaying what I mean. I understand it will be some sort of for loop to read each digit of the integer individually until something reaches 5. Something like the charAt() string method but works for digits.

    Read the article

  • Why does Python array moduel handle strings and lists differently?

    - by Casey
    I'm having trouble understanding the result of the following statements: >>> from array import array >>> array('L',[0xff,0xff,0xff,0xff]) array('L', [255L, 255L, 255L, 255L]) >>> from array import array >>> array('L','\xff\xff\xff\xff') Traceback (most recent call last): File "<stdin>", line 1, in <module> ValueError: string length not a multiple of item size

    Read the article

  • Linux distro name parsing

    - by Ockonal
    Hello, I chose this way to get linux distro name: ls /etc/*release And now I have to parse it for name: /etc/<name>-release def checkDistro(): p = Popen('ls /etc/*release' , shell = True, stdout = PIPE) distroRelease = p.stdout.read() distroName = re.search( ur"\/etc\/(.*)\-release", distroRelease).group() print distroName But this prints the same string that is in distroRelease.

    Read the article

  • Where to put the application ID in YQL

    - by earlyriser
    I'm trying to read an xml response from YQL: $url = 'http://query.yahooapis.com/v1/public/yql?q=select%20*%20from%20geo.places%20where%20woeid%3D%22'.$woeid.'%22'; if (!$xml=simplexml_load_file($url) ) { //DO STUFF } This code works. Now i'm trying to put my application ID in the url string but I don't know how it should be done. Thanks.

    Read the article

  • passing nsdata in stringwithformat

    - by milanjansari
    hello, How to pass nsdata in below of the string NSData *myData = [NSData dataWithContentsOfFile:pathDoc]; pathDoc = [NSString stringWithFormat:@"<size>%d</size><type>%d</type><cdate>%@</cdate><file>%c</file><fname>File</fname>",fileSizeVal,filetype,creationDate,file]; Any idea about this? Thanks you, Milan

    Read the article

  • Sqlite issues with HTC Desire HD

    - by Greg
    Recently I have been getting a lot of complaints about the HTC Desire series and it failing while invoking sql statements. I have received reports from users with log snapshots that contain the following. I/Database( 2348): sqlite returned: error code = 8, msg = statement aborts at 1: [pragma journal_mode = WAL;] E/Database( 2348): sqlite3_exec to set journal_mode of /data/data/my.app.package/files/localized_db_en_uk-1.sqlite to WAL failed followed by my app basically burning in flames because the call to open the database results in a serious runtime error that manifests itself as the cursor being left open. There shouldn't be a cursor at this point as we are trying to open it. This only occurs with the HTC Desire HD and Z. My code basically does the following (changed a little to isolate the problem area). SQLiteDatabase db; String dbName; public SQLiteDatabase loadDb(Context context) throws IOException{ //Close any old db handle if (db != null && db.isOpen()) { db.close(); } // The name of the database to use from the bundled assets. String dbAsset = "/asset_dir/"+dbName+".sqlite"; InputStream myInput = context.getAssets().open(dbAsset, Context.MODE_PRIVATE); // Create a file in the app's file directory since sqlite requires a path // Not ideal but we will copy the file out of our bundled assets and open it // it in another location. FileOutputStream myOutput = context.openFileOutput(dbName, Context.MODE_PRIVATE); byte[] buffer = new byte[1024]; int length; while ((length = myInput.read(buffer)) > 0) { myOutput.write(buffer, 0, length); } // Close the streams myOutput.flush(); // Guarantee Write! myOutput.getFD().sync(); myOutput.close(); myInput.close(); // Not grab the newly written file File fileObj = context.getFileStreamPath(dbName); // and open the database return db = SQLiteDatabase.openDatabase(fileObj.getAbsolutePath(), null, SQLiteDatabase.OPEN_READONLY | SQLiteDatabase.NO_LOCALIZED_COLLATORS); } Sadly this phone is only available in the UK and I don't have one in my inventory. I am only getting reports of this type from the HTC Desire series. I don't know what changed as this code has been working without any problem. Is there something I am missing?

    Read the article

  • Java: Preventing array going out of bounds.

    - by Troy
    I'm working on a game of checkers, if you want to read more about you can view it here; http://minnie.tuhs.org/I2P/Assessment/assig2.html When I am doing my test to see if the player is able to get to a certain square on the grid (i.e. +1 +1, +1 -1 .etc) from it's current location, I get an java.lang.ArrayIndexOutOfBoundsException error. This is the code I am using to make the move; public static String makeMove(String move, int playerNumber) { // variables to contain the starting and destination coordinates, subtracting 1 to match array size int colStart = move.charAt(1) - FIRSTCOLREF - 1; int rowStart = move.charAt(0) - FIRSTROWREF - 1; int colEnd = move.charAt(4) - FIRSTCOLREF - 1; int rowEnd = move.charAt(3) - FIRSTROWREF - 1; // variable to contain which player is which char player, enemy; if (playerNumber==1) { player= WHITEPIECE; enemy= BLACKPIECE; } else { player= BLACKPIECE; enemy= WHITEPIECE; } // check that the starting square contains a player piece if (grid [ colStart ] [ rowStart ] == player) { // check that the player is making a diagonal move if (grid [ colEnd ] [ rowEnd ] == grid [ (colStart++) ] [ (rowEnd++) ] && grid [ colEnd ] [ rowEnd ] == grid [ (colStart--) ] [ (rowEnd++) ] && grid [ colEnd ] [ rowEnd ] == grid [ (colStart++) ] [ (rowEnd--) ] && grid [ colEnd ] [ rowEnd ] == grid [ (colStart--) ] [ (rowEnd--) ]) { // check that the destination square is free if (grid [ colEnd ] [ rowEnd ] == BLANK) { grid [ colStart ] [ rowStart ] = BLANK; grid [ colEnd ] [ rowEnd ] = player; } } // check if player is jumping over a piece else if (grid [ colEnd ] [ rowEnd ] == grid [ (colStart+2) ] [ (rowEnd+2) ] && grid [ colEnd ] [ rowEnd ] == grid [ (colStart-2) ] [ (rowEnd+2) ] && grid [ colEnd ] [ rowEnd ] == grid [ (colStart+2) ] [ (rowEnd-2) ] && grid [ colEnd ] [ rowEnd ] == grid [ (colStart-2) ] [ (rowEnd-2) ]) { // check that the piece in between contains an enemy if ((grid [ (colStart++) ] [ (rowEnd++) ] == enemy ) && (grid [ (colStart--) ] [ (rowEnd++) ] == enemy ) && (grid [ (colStart++) ] [ (rowEnd--) ] == enemy ) && (grid [ (colStart--) ] [ (rowEnd--) ] == enemy )) { // check that the destination is free if (grid [ colEnd ] [ rowEnd ] == BLANK) { grid [ colStart ] [ rowStart ] = BLANK; grid [ colEnd ] [ rowEnd ] = player; } } } } I'm not sure how I can prevent the error from happening, what do you recommend?

    Read the article

  • How Does One Differentiate Between Routes POSTed To In Asp.Net MVC?

    - by Laz
    I have two actions, one that accepts a ViewModel and one that accepts two parameters a string and an int, when I try to post to the action, it gives me an error telling me that the current request is ambiguous between the two actions. Is it possible to indicate to the routing system which action is the relevant one, and if it is how is it done?

    Read the article

< Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >