Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 910/1408 | < Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >

  • PHP regular expression for positive number with 0 or 2 decimal places

    - by Peter
    Hi I am trying to use the following regular expression to check whether a string is a positive number with either zero decimal places, or 2: ^\d+(\.(\d{2}))?$ When I try to match this using preg_match, I get the error: Warning: preg_match(): No ending delimiter '^' found in /Library/WebServer/Documents/lib/forms.php on line 862 What am I doing wrong?

    Read the article

  • I need to speed this code at least 2 times!

    - by Dominating
    include include include include using namespace std; inline void PrintMapName(multimap pN, string s) { pair::iterator, multimap::iterator ii; multimap::iterator it; ii = pN.equal_range(s); multimap tmp; for(it = ii.first; it != ii.second; ++it) { tmp.insert(pair(it-second,1)); } multimap::iterator i; bool flag = false; for(i = tmp.begin(); i != tmp.end(); i++) { if(flag) { cout<<" "; } cout<first; if(flag) { cout<<" "; } flag = true; } cout< int main() { multimap phoneNums; multimap numPhones; int N; cinN; int tests; string tmp, tmp1,tmp2; while(N 0) { cintests; while(tests 0) { cintmp; if(tmp == "add") { cintmp1tmp2; phoneNums.insert(pair(tmp1,tmp2)); numPhones.insert(pair(tmp2,tmp1)); } else { if(tmp == "delnum") { cintmp1; multimap::iterator it; multimap::iterator tmpr; for(it = phoneNums.begin(); it != phoneNums.end();it++) { tmpr = it; if(it-second == tmp1) { phoneNums.erase(it,tmpr); } } numPhones.erase(tmp1); } else { if(tmp == "delname") { cintmp1; phoneNums.erase(tmp1); multimap::iterator it; multimap::iterator tmpr; for(it = numPhones.begin(); it != numPhones.end();it++) { tmpr = it; if(it-second == tmp1) { numPhones.erase(it,tmpr); } } } else { if(tmp =="queryname") { cintmp1; PrintMapName(phoneNums, tmp1); } else//querynum { cintmp1; PrintMapName(numPhones, tmp1); } } } } tests--; } N--; } return 0; }

    Read the article

  • What makes an input vulnerable to XSS?

    - by vtortola
    Hi! I've been reading about XSS and I made a simple form with a text and submit input, but when I execute <script>alert();</script> on it, nothing happens, the server gets that string and that's all. What do I have to do for make it vulnerable?? (then I'll learn what I shouldn't do hehe) Cheers.

    Read the article

  • PHP Getting XPath of a DOMNode

    - by user256007
    I am creating an XML document on the fly. and I need to know the XPath of the Node I've just created. I don't see any such function like DOMNode::calculateXPath(void):string and I am not willing to write one by my own. is there any known lite 3rd party Solution ??

    Read the article

  • How should I parse this simple text file in Java?

    - by Winston
    I have a text file that looks like this: grn129 agri- ac-214 ahss hud114 ahss lov1150 ahss lov1160 ahss lov1170 ahss lov1210 ahss What is the best way to parse this file using Java if I want to create a HashMap with the first column as the key and the second column as the value. Should I use the Scanner class? Try to read in the whole file as a string and split it? What is the best way?

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • Linux distro name parsing

    - by Ockonal
    Hello, I chose this way to get linux distro name: ls /etc/*release And now I have to parse it for name: /etc/<name>-release def checkDistro(): p = Popen('ls /etc/*release' , shell = True, stdout = PIPE) distroRelease = p.stdout.read() distroName = re.search( ur"\/etc\/(.*)\-release", distroRelease).group() print distroName But this prints the same string that is in distroRelease.

    Read the article

  • HTML Encoding with ASP.NET

    - by Corin
    I am currently html encoding all user entered text before inserting/updating a db table record. The problem is that on any subsequent updates, the previously encoded string is reencoded. This endless loop is starting to eat up alot of column space in my tables. I am using parameterized queries for all sql statements but am wondering would it be safe to just let the .NET Framework handle this part without the HTML Encoding?

    Read the article

  • TouchCode XML parsing error

    - by itsaboutcode
    Hi, I have a xml document which has only one element in the document, which is <error>error string<error> But when i try to parse it, it says this document has no element at all. In other words when i try to access the rootElement it says "null" CXMLDocument *rssParser = [[[CXMLDocument alloc] initWithContentsOfURL:url options:0 error:nil] autorelease]; NSLog(@"Root: %@",[[rssParser rootElement] name]); Please tell me what is wroing with this. Thanks

    Read the article

  • How to do a proper search with nhibernate

    - by Denis Rosca
    Hello everyone, i'm working on a small project that is supposed to allow basic searches of the database. Currently i'm using nhibernate for the database interaction. In the database i have 2 tables: Person and Address. The Person table has a many-to-one relationship with Address. The code i've come up with for doing searches is: public IList<T> GetByParameterList(List<QueryParameter> parameterList) { if (parameterList == null) { return GetAll(); } using (ISession session = NHibernateHelper.OpenSession()) { ICriteria criteria = session.CreateCriteria<T>(); foreach (QueryParameter param in parameterList) { switch (param.Constraint) { case ConstraintType.Less: criteria.Add(Expression.Lt(param.ParameterName, param.ParameterValue)); break; case ConstraintType.More: criteria.Add(Expression.Gt(param.ParameterName, param.ParameterValue)); break; case ConstraintType.LessOrEqual: criteria.Add(Expression.Le(param.ParameterName, param.ParameterValue)); break; case ConstraintType.EqualOrMore: criteria.Add(Expression.Ge(param.ParameterName, param.ParameterValue)); break; case ConstraintType.Equals: criteria.Add(Expression.Eq(param.ParameterName, param.ParameterValue)); break; case ConstraintType.Like: criteria.Add(Expression.Like(param.ParameterName, param.ParameterValue)); break; } } try { IList<T> result = criteria.List<T>(); return result; } catch { //TODO: Implement some exception handling throw; } } } The query parameter is a helper object that i use to create criterias and send it to the dal, it looks like this: public class QueryParameter { public QueryParameter(string ParameterName, Object ParameterValue, ConstraintType constraintType) { this.ParameterName = ParameterName; this.ParameterValue = ParameterValue; this.Constraint = constraintType; } public string ParameterName { get; set; } public Object ParameterValue { get; set; } public ConstraintType Constraint { get; set; } } Now this works well if i'm doing a search like FirstName = "John" , but not when i try to give a parameter like Street = "Some Street". It seems that nhibernate is looking for a street column in the Person table but not in the Address table. Any idea on how should i change my code for so i could do a proper search? Tips? Maybe some alternatives? Disclaimer: i'm kind of a noob so please be gentle ;) Thanks, Denis.

    Read the article

  • how to save byte[] value to varbinary(64) field on database

    - by shamim
    byte[] a = HashEncript("a"); public byte[] HashEncript(string Password) { SHA512Managed sha = new SHA512Managed(); byte[] hash = sha.ComputeHash(UnicodeEncoding.Unicode.GetBytes(Password)); return hash; } i want to save byte[] a this value on my database .My database field is varbinary(64).i use msSQL2008 .how to save ,want to know the insert query with C# code.

    Read the article

  • error C2297: '<<' : illegal, right operand has type 'double'

    - by Gopal Sharma
    string mesag=""; mesag="aDoubleArray value at 0------->"<<aDoubleArray[0]<<" aDoubleArray value at 1 is "<<aDoubleArray[1]; addLog(AMR_LT_WARN, mesag);// this part not working addLog(AMR_LT_WARN, "this works well"); i dont know anythng about c++ just want to print aDoubleArray values to log file but it throws error C2297: '<<' : illegal, right operand has type 'double'

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Can't change Joomla Default language

    - by Moak
    On this site http://www.bostonteaclub.com I want the default language to be Chinese. I set the default language to Chinese in the backend (it's got the star next to it) but when you went to the page you probably noticed that the site is in english. If you check the source code you will see on the very bottom hidden a var_dump of the language object, and by the looks of it the default is still en-GB ["_default"]=> string(5) "en-GB" Why is this? Thanks

    Read the article

  • Huge Graph Structure

    - by Harph
    I'm developing an application in which I need a structure for represent a huge graph (between 1000000 and 6000000 nodes and 100 or 600 edges) in memory. The edges representation will contain some attribute of the relation. I have tried a memory map representation, arrays, dictionaries and string for represent that structure in memory, but this always crash because the memory limit. I would to get an advice of how can I represent this, or something similar. By the way, I'm using python.

    Read the article

  • how to update an Android ListActivity on changing data of the connected SimpleCursorAdapter

    - by 4485670
    I have the following code. What I want to achieve is to update the shown list when I click an entry so I can traverse through the list. I found the two uncommented ways to do it here on stackoverflow, but neither works. I also got the advice to create a new ListActivity on the data update, but that sounds like wasting resources? EDIT: I found the solution myself. All you need to do is call "SimpleCursorAdapter.changeCursor(new Cursor);". No notifying, no things in UI-Thread or whatever. import android.app.ListActivity; import android.database.Cursor; import android.os.Bundle; import android.util.Log; import android.view.View; import android.widget.ListView; import android.widget.SimpleCursorAdapter; public class MyActivity extends ListActivity { private DepartmentDbAdapter mDbHelper; private Cursor cursor; private String[] from = new String[] { DepartmentDbAdapter.KEY_NAME }; private int[] to = new int[] { R.id.text1 }; private SimpleCursorAdapter notes; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.departments_list); mDbHelper = new DepartmentDbAdapter(this); mDbHelper.open(); // Get all of the departments from the database and create the item list cursor = mDbHelper.fetchSubItemByParentId(1); this.startManagingCursor(cursor); // Now create an array adapter and set it to display using our row notes = new SimpleCursorAdapter(this, R.layout.department_row, cursor, from, to); this.setListAdapter(notes); } @Override protected void onListItemClick(ListView l, View v, int position, long id) { super.onListItemClick(l, v, position, id); // get new data and update the list this.updateData(safeLongToInt(id)); } /** * update data for the list * * @param int departmentId id of the parent department */ private void updateData(int departmentId) { // close the old one, get a new one cursor.close(); cursor = mDbHelper.fetchSubItemByParentId(departmentId); // change the cursor of the adapter to the new one notes.changeCursor(cursor); } /** * safely convert long to in to save memory * * @param long l the long variable * * @return integer */ public static int safeLongToInt(long l) { if (l < Integer.MIN_VALUE || l > Integer.MAX_VALUE) { throw new IllegalArgumentException (l + " cannot be cast to int without changing its value."); } return (int) l; } }

    Read the article

  • regular expression for letters, numbers and - _ .

    - by Jorre
    I'm having trouble checking in PHP if a value is is any of the following combinations letters (upper or lowercase) numbers (0-9) underscore (_) dash (-) point (.) no spaces! or other characters a few examples: OK: "screen123.css" OK: "screen-new-file.css" OK: "screen_new.js" NOT OK: "screen new file.css" I guess I need a regex for this, since I need to throw an error when a give string has other characters in it than the ones mentioned above.

    Read the article

  • Creating a unique URL safe hash

    - by Ben Foster
    I want to hash/encode a unique integer (database ID) to create a similarly unique string. It needs to meet the following requirements: Must start with a letter or number, and can contain only letters and numbers. All letters in a container name must be lowercase. Must be from 3 through 63 characters long (although the shorter the better) The result does not need to be reversible, just repeatable - so a 1-way hash would be fine.

    Read the article

  • HttpSessionState as parameter

    - by HeavyWave
    What is the highest class in the hierarchy I can use to pass HttpSessionState as a parameter and add values to it? For instance to a method like public void MyMethod(IDictionary<string, object> input) { input.Add("something", something); } I see that implements ICollection and IEnumerable, but that only allows me to read values, not add them.

    Read the article

  • Ad-hoc retreival of data from SQL Server varbinary column

    - by Daniel Fortunov
    I would like to retreive some binary data from a varbinary(max) column in a SQL Server database for debugging purposes. What is the easiest way to get this data into a local binary file, preferably without having to write a throw-away console application? I have tried using SQL Server Management Studio but this returns a hex encoded binary string, rather than raw binary data (even with the "results to file" option).

    Read the article

  • Passing dynamic parameters to a stored procedure in SQL Server 2008

    - by themhz
    I have this procedure that executes another procedure passed by a parameter and its parameters datefrom and dateto. CREATE procedure [dbo].[execute_proc] @procs varchar(200), @pdatefrom date, @pdateto date as exec @procs @datefrom=@pdatefrom,@dateto=@pdateto But I need to also pass the parameters dynamically without the need to edit them in the procedure. For example, what I am imagining is something like this CREATE procedure [dbo].[execute_proc] @procs varchar(200), @params varchar(max) as exec @procs @params where @params is a string like @param1=1,@param2='somethingelse' Is there a way to do this?

    Read the article

< Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >