Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 910/1408 | < Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >

  • displaying data from database in to text box

    - by srinayak
    I have 2 JSP pages as below: projectcategory.jsp <% Connection con = DbConnect.connect(); Statement s = con.createStatement(); ResultSet rs = s.executeQuery("select * from projectcategory"); %> <DIV class="TabbedPanelsContent" align="center"> <TABLE border="1"> <TR> <TH>CATEGORY ID</TH> <TH>CATEGORY NAME</TH> <TH>Edit/Update</TH> </TR> <% while (rs.next()) { %> <%String p=rs.getString(1);%> <TR> <TD><%=rs.getString(1)%></TD> <TD><%=rs.getString(2)%></TD> <TD> <FORM action="EditPcat.jsp?pcatid=p"><INPUT type="submit" value='edit/update'></INPUT> </FORM> </TD> </TR> <% } %> </TABLE> </DIV> another is Editpcat.jsp: </head> <body> <%String s=request.getParameter("p"); %> <form action="ProjCatServlet" method="post"> <div align="right"><a href="projectcategory.jsp">view</a></div> <fieldset> <legend>Edit category</legend> <table cellspacing="2" cellpadding="2" border="0"> <tr> <td align="left">Category Id</td> <td><input type="text" name="pcatid" value="<%=s%>" ></td> </tr> <tr> <td align="right">Category Name</td> <td><input type="text" name="pcatname"></td> </tr> <tr> <td><input type="submit" value="submit"></td> </tr> </table> <input type="hidden" name="FUNCTION_ID" value="UPDATE"> </fieldset> </form> How to display value from one JSP page which we get from database in to text box of another JSP?

    Read the article

  • How do I get the Jetty 6 FileServerXml example to work?

    - by Norm
    I have followed along with the Tutorial and the examples. Yet I always get this error when I copy and paste the code: Exception in thread "main" java.lang.NullPointerException at net.test.FileServerXml.main(FileServerXml.java:13) In Eclipse I have the directory structured as such: package net.test -FileServerXml.java -fileserver.xml -index.html FileServerXml.java package net.test; import org.mortbay.jetty.Server; import org.mortbay.resource.Resource; import org.mortbay.xml.XmlConfiguration; public class FileServerXml { public static void main(String[] args) throws Exception { Resource fileserver_xml = Resource.newSystemResource("fileserver.xml"); XmlConfiguration configuration = new XmlConfiguration(fileserver_xml.getInputStream()); Server server = (Server)configuration.configure(); server.start(); server.join(); } } ` fileserver.xml `<?xml version="1.0"?> <Call name="addConnector"> <Arg> <New class="org.eclipse.jetty.server.nio.SelectChannelConnector"> <Set name="port">8080</Set> </New> </Arg> </Call> <Set name="handler"> <New class="org.eclipse.jetty.server.handler.HandlerList"> <Set name="handlers"> <Array type="org.eclipse.jetty.server.Handler"> <Item> <New class="org.eclipse.jetty.server.handler.ResourceHandler"> <Set name="directoriesListed">true</Set> <Set name="welcomeFiles"> <Array type="String"><Item>index.html</Item></Array> </Set> <Set name="resourceBase">.</Set> </New> </Item> <Item> <New class="org.eclipse.jetty.server.handler.DefaultHandler"> </New> </Item> </Array> </Set> </New> </Set> ` Thanks for your input. Norm

    Read the article

  • PHP Getting XPath of a DOMNode

    - by user256007
    I am creating an XML document on the fly. and I need to know the XPath of the Node I've just created. I don't see any such function like DOMNode::calculateXPath(void):string and I am not willing to write one by my own. is there any known lite 3rd party Solution ??

    Read the article

  • Finding process count in Linux via command line

    - by Moev4
    I was looking for the best way to find the number of running processes with the same name via the command line in Linux. For example if I wanted to find the number of bash processes running and get "5". Currently I have a script that does a 'pidof ' and then does a count on the tokenized string. This works fine but I was wondering if there was a better way that can be done entirely via the command line. Thanks in advance for your help.

    Read the article

  • How to configure SVN access list for directory/repository ?

    - by abatishchev
    I have next SVN repositories structure running Apache 2.2 under Windows Server 2008: http://example.com/svn/ is targeted to e:\svn (root) http://example.com/svn/dir/ is targeted to e:\svn\dir (some directory with a number of repositories) http://example.com/svn/dir/repo/ is targeted to e:\svn\dir\repo (a repository itself) How to access list so group @foo had rw access to repo? I have next access list: [groups] @foo = user1, user2 [/] * = r [dir/repo:/] @foo = rw The last string doesn't work in any combination I tried

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • MODX parse error function implode (is it me or modx?)

    - by Ian
    Hi, I cannot for the life of me figure this out, maybe someone can help. Using MODX a form takes user criteria to create a filter and return a list of documents. The form is one text field and a few checkboxes. If both text field and checkbox data is posted, the function works fine; if just the checkbox data is posted the function works fine; but if just the text field data is posted, modx gives me the following error: Error: implode() [function.implode]: Invalid arguments passed. I've tested this outside of modx with flat files and it all works fine leading me to assume a bug exists within modx. But I'm not convinced. Here's my code: <?php $order = array('price ASC'); //default sort order if(!empty($_POST['tour_finder_duration'])){ //duration submitted $days = htmlentities($_POST['tour_finder_duration']); //clean up post array_unshift($order,"duration DESC"); //add duration sort before default $filter[] = 'duration,'.$days.',4'; //add duration to filter[] (field,criterion,mode) $criteria[] = 'Number of days: <strong>'.$days.'</strong>'; //displayed on results page } if(!empty($_POST['tour_finder_dests'])){ //destination/s submitted $dests = $_POST['tour_finder_dests']; foreach($dests as $value){ //iterate through dests array $filter[] = 'searchDests,'.htmlentities($value).',7'; //add dests to filter[] $params['docid'] = $value; $params['field'] = 'pagetitle'; $pagetitle = $modx->runSnippet('GetField',$params); $dests_array[] = '<a href="[~'.$value.'~]" title="Read more about '.$pagetitle.'" class="tourdestlink">'.$pagetitle.'</a>'; } $dests_array = implode(', ',$dests_array); $criteria[] = 'Destinations: '.$dests_array; //displayed on results page } if(is_array($filter)){ $filter = implode('|',$filter);//pipe-separated string } if(is_array($order)){ $order = implode(',',$order);//comma-separated string } if(is_array($criteria)){ $criteria = implode('<br />',$criteria); } echo '<br />Order: '.$order.'<br /> Filter: '.$filter.'<br /> Criteria: '.$criteria; //next: extract docs using $filter and $order, display user's criteria using $criteria... ?> The echo statement is displayed above the MODX error message and the $filter array is correctly imploded. Any help will save my computer from flying out the window. Thanks

    Read the article

  • Linux distro name parsing

    - by Ockonal
    Hello, I chose this way to get linux distro name: ls /etc/*release And now I have to parse it for name: /etc/<name>-release def checkDistro(): p = Popen('ls /etc/*release' , shell = True, stdout = PIPE) distroRelease = p.stdout.read() distroName = re.search( ur"\/etc\/(.*)\-release", distroRelease).group() print distroName But this prints the same string that is in distroRelease.

    Read the article

  • passing nsdata in stringwithformat

    - by milanjansari
    hello, How to pass nsdata in below of the string NSData *myData = [NSData dataWithContentsOfFile:pathDoc]; pathDoc = [NSString stringWithFormat:@"<size>%d</size><type>%d</type><cdate>%@</cdate><file>%c</file><fname>File</fname>",fileSizeVal,filetype,creationDate,file]; Any idea about this? Thanks you, Milan

    Read the article

  • Java: file write on finalize method

    - by sowrov
    In my understanding a singleton object will destroy only when the application is about to terminate. So in C++ I write a Singleton class to log my application and in that Singleton logger's destructor I log the time when my application was terminated. Things worked perfectly in C++. Now I want to have that same logger in Java, as in java there is no destructor so I implemented the finalize method for that singleton logger. But it seem that finalize method actually never get called. So, I add that System.runFinalizersOnExit(true); line, somewhere in my code (though I know it is deprecated) and that finalize method get called every time before termination of the app. But still there is a problem! If I try to write anything on file in that finalize method, It does not work, though System.out work without any problem! :( Can you guys help me on this problem? Here is a sample code of what I am try to do: Singleton Logger Class: public class MyLogger { FileWriter writer; private MyLogger() { try { this.writer = new FileWriter("log.txt"); } catch (IOException ex) { } } public static MyLogger getInstance() { return MyLoggerHolder.INSTANCE; } private static class MyLoggerHolder { private static final MyLogger INSTANCE = new MyLogger(); } @Override protected void finalize () { try { super.finalize(); System.out.println("Here"); //worked correctly. this.writer.write(new Date().toString()+System.getProperty("line.separator")); this.writer.write("End"); this.writer.flush(); //does not work! this.writer.close(); } catch (Throwable ex) { } } public synchronized void log(String str) { try { this.writer.write(new Date().toString()+System.getProperty("line.separator")); this.writer.write(str+"\n"); this.writer.flush(); } catch (IOException ex) { } } } Main: public class Main { public static void main(String[] args) { System.runFinalizersOnExit(true); MyLogger logger = MyLogger.getInstance(); logger.log("test"); } }

    Read the article

  • Why do sockets not die when server dies? Why does a socket die when server is alive?

    - by Roman
    I try to play with sockets a bit. For that I wrote very simple "client" and "server" applications. Client: import java.net.*; public class client { public static void main(String[] args) throws Exception { InetAddress localhost = InetAddress.getLocalHost(); System.out.println("before"); Socket clientSideSocket = null; try { clientSideSocket = new Socket(localhost,12345,localhost,54321); } catch (ConnectException e) { System.out.println("Connection Refused"); } System.out.println("after"); if (clientSideSocket != null) { clientSideSocket.close(); } } } Server: import java.net.*; public class server { public static void main(String[] args) throws Exception { ServerSocket listener = new ServerSocket(12345); while (true) { Socket serverSideSocket = listener.accept(); System.out.println("A client-request is accepted."); } } } And I found a behavior that I cannot explain: I start a server, than I start a client. Connection is successfully established (client stops running and server is running). Then I close the server and start it again in a second. After that I start a client and it writes "Connection Refused". It seems to me that the server "remember" the old connection and does not want to open the second connection twice. But I do not understand how it is possible. Because I killed the previous server and started a new one! I do not start the server immediately after the previous one was killed (I wait like 20 seconds). In this case the server "forget" the socket from the previous server and accepts the request from the client. I start the server and then I start the client. Connection is established (server writes: "A client-request is accepted"). Then I wait a minute and start the client again. And server (which was running the whole time) accept the request again! Why? The server should not accept the request from the same client-IP and client-port but it does!

    Read the article

  • Append to list of lists

    - by Joel
    Hello, I am trying to build a list of lists using the following code: list=3*[[]] Now I am trying to append a string to the list in position 0: list[0].append("hello") However, instead of receiving the list [ ["hello"] , [], [] ] I am receiving the list: [ ["hello"] ,["hello"] , ["hello"] ] Am I missing something? Thanks, Joel

    Read the article

  • Where to put the application ID in YQL

    - by earlyriser
    I'm trying to read an xml response from YQL: $url = 'http://query.yahooapis.com/v1/public/yql?q=select%20*%20from%20geo.places%20where%20woeid%3D%22'.$woeid.'%22'; if (!$xml=simplexml_load_file($url) ) { //DO STUFF } This code works. Now i'm trying to put my application ID in the url string but I don't know how it should be done. Thanks.

    Read the article

  • Drop shadow on a div container?

    - by Mike
    I have a searchbox with auto-suggest that pops a div up underneath it with multiple search string suggestions (like google). Is it possible to have drop shadow on the auto-suggest box with CSS or will I need a script of some sort? I tried a background image but the number of suggests can vary from 1 to 10 or 15. I'd prefer something that works in IE6+ and FF2+ if possible. Thanks!

    Read the article

  • PostgreSQL + Rails citext

    - by glebm
    I am trying to move to heroku which uses PostgreSQL 8.4 which has a citext column type which is nice since the app was written for MySQL. Is there any way to use :citext with rails (so that if the migrations are run on MySQL the citext would just use string/text? I found this ticket, but it seems like it isn't going to be a part of rails for a while: https://rails.lighthouseapp.com/projects/8994/tickets/3174-add-support-for-postgresql-citext-column-type

    Read the article

  • Wordpress - Set post_date

    - by danit
    I'm trying to set the post_date of a blog post to Wordpress via XMLRPC. I'm sending the data as a string: $pubdate = '2010-04-08 13:46:43'; 'post_date'=>$pubdate, It appears 'post_date' is correct? I also found this post losely related to the issue: http://wordpress.org/support/topic/330597 Can anyone suggest how I would post the date as: dateTime.iso8601

    Read the article

  • Reverse regular expressions to generate data

    - by Anton Gogolev
    In one of the StackOverflow Podcasts (the one where guys were discussing data generation for testing DBs -- either #11 or #12), Jeff mentioned something like "reverse regular expressions", which are used exactly for that purpose: given a regex, produce a string which will eventually match said regex. What is the correct term for this whole concept? Is this a well-known concept?

    Read the article

  • Huge Graph Structure

    - by Harph
    I'm developing an application in which I need a structure for represent a huge graph (between 1000000 and 6000000 nodes and 100 or 600 edges) in memory. The edges representation will contain some attribute of the relation. I have tried a memory map representation, arrays, dictionaries and string for represent that structure in memory, but this always crash because the memory limit. I would to get an advice of how can I represent this, or something similar. By the way, I'm using python.

    Read the article

  • WPF ClickOnce Bootstrap Dection Failure on One Machine

    - by Dexter Morgan
    Hello Friend, I've decided to use ClickOnce technology to deploy my new WPF application. By and large, ClickOnce works as advertised but I've hit a minor glitch regarding Bootstrapping and framework detection. Some background: - I'm using the standard Visual Studio-generated publish.htm page as my launch page. - The only prerequisite is the .NET Framework 4.0 Client Profile. - All clients using IE 8. - All clients already have the .NET 4.0 Client Profile installed. ClickOnce works as advertised on the vast majority of machines. The VS-generated JScript correctly detects that the framework is installed and presents the user with a Run button. The app launches just fine. I'm getting odd results on one of the machines, however. On the offending machine, the VS-generated JScript tells the user that the prereqs may not be installed -- or rather, it FAILS to detect that the framework is already installed. The "launch" link successfully launches the application but the Run link points to the bootstrapper setup.exe. Why is it failing to detect the framework on this one machine? It occurred to me that framework detection is largely a matter of examining the useragent string that's submitted by the browser. So, what you see below are two UserAgent strings. The first is from a machine where things are working properly. The second is from the offending machine. THIS ONE WORKS: 2011-01-11 15:14:14 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 72.130.187.100 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.0;+Trident/4.0;+SLCC1;+.NET+CLR+2.0.50727;+Media+Center+PC+5.0;+.NET+CLR+3.5.21022;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+.NET4.0C) 304 0 0 THIS ONE DOESN'T: 2011-01-11 18:49:12 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 76.212.204.169 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.1;+WOW64;+Trident/4.0;+GTB6.6;+SLCC2;+.NET+CLR+2.0.50727;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+Media+Center+PC+6.0;+.NET4.0C) 200 0 0 The useragent string of both machines clearly states, "hey the .NET 4.0 client profile is installed here" -- yet the second machine seems unable to detect it. I don't know enough about useragent strings to understand why the former works and the latter fails. The only difference as far as I can tell is that the offending machine is running 64bit. But that shouldn't make a difference. Should it? Any ideas? Dexter Morgan

    Read the article

  • Download file using ajax and webservice

    - by megabyte
    Hi All There is this 3rd party webservice. One of the public webmethods available is a GetDocument() method. This method returns a Document object. The Document object has properties for File(byte[]), ContentType(string) ect. My Question : Can I subscribe to this service using javascript(mootools) + ajax + JSON, return the document object, in this case an excel document, and force the file download?

    Read the article

  • html.actionlink doesn't passing parameter to controller action

    - by FosterZ
    hi, m having problem in passing parameter to controller action, i have done the following Url.Action("SchoolDetails","School",new{id=item.SchoolId}) and my controller action follows public ActionResult SchoolDetails(string schoolId,_ASI_School schoolDetail) { schoolDetail = SchoolRepository.GetSchoolById(schoolId); return View(schoolDetail); } i dn't know why the schoolId above in action is getting null..

    Read the article

  • regular expression for letters, numbers and - _ .

    - by Jorre
    I'm having trouble checking in PHP if a value is is any of the following combinations letters (upper or lowercase) numbers (0-9) underscore (_) dash (-) point (.) no spaces! or other characters a few examples: OK: "screen123.css" OK: "screen-new-file.css" OK: "screen_new.js" NOT OK: "screen new file.css" I guess I need a regex for this, since I need to throw an error when a give string has other characters in it than the ones mentioned above.

    Read the article

< Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >