Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 910/1408 | < Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to configure SVN access list for directory/repository ?

    - by abatishchev
    I have next SVN repositories structure running Apache 2.2 under Windows Server 2008: http://example.com/svn/ is targeted to e:\svn (root) http://example.com/svn/dir/ is targeted to e:\svn\dir (some directory with a number of repositories) http://example.com/svn/dir/repo/ is targeted to e:\svn\dir\repo (a repository itself) How to access list so group @foo had rw access to repo? I have next access list: [groups] @foo = user1, user2 [/] * = r [dir/repo:/] @foo = rw The last string doesn't work in any combination I tried

    Read the article

  • passing nsdata in stringwithformat

    - by milanjansari
    hello, How to pass nsdata in below of the string NSData *myData = [NSData dataWithContentsOfFile:pathDoc]; pathDoc = [NSString stringWithFormat:@"<size>%d</size><type>%d</type><cdate>%@</cdate><file>%c</file><fname>File</fname>",fileSizeVal,filetype,creationDate,file]; Any idea about this? Thanks you, Milan

    Read the article

  • Where to put the application ID in YQL

    - by earlyriser
    I'm trying to read an xml response from YQL: $url = 'http://query.yahooapis.com/v1/public/yql?q=select%20*%20from%20geo.places%20where%20woeid%3D%22'.$woeid.'%22'; if (!$xml=simplexml_load_file($url) ) { //DO STUFF } This code works. Now i'm trying to put my application ID in the url string but I don't know how it should be done. Thanks.

    Read the article

  • Java: Preventing array going out of bounds.

    - by Troy
    I'm working on a game of checkers, if you want to read more about you can view it here; http://minnie.tuhs.org/I2P/Assessment/assig2.html When I am doing my test to see if the player is able to get to a certain square on the grid (i.e. +1 +1, +1 -1 .etc) from it's current location, I get an java.lang.ArrayIndexOutOfBoundsException error. This is the code I am using to make the move; public static String makeMove(String move, int playerNumber) { // variables to contain the starting and destination coordinates, subtracting 1 to match array size int colStart = move.charAt(1) - FIRSTCOLREF - 1; int rowStart = move.charAt(0) - FIRSTROWREF - 1; int colEnd = move.charAt(4) - FIRSTCOLREF - 1; int rowEnd = move.charAt(3) - FIRSTROWREF - 1; // variable to contain which player is which char player, enemy; if (playerNumber==1) { player= WHITEPIECE; enemy= BLACKPIECE; } else { player= BLACKPIECE; enemy= WHITEPIECE; } // check that the starting square contains a player piece if (grid [ colStart ] [ rowStart ] == player) { // check that the player is making a diagonal move if (grid [ colEnd ] [ rowEnd ] == grid [ (colStart++) ] [ (rowEnd++) ] && grid [ colEnd ] [ rowEnd ] == grid [ (colStart--) ] [ (rowEnd++) ] && grid [ colEnd ] [ rowEnd ] == grid [ (colStart++) ] [ (rowEnd--) ] && grid [ colEnd ] [ rowEnd ] == grid [ (colStart--) ] [ (rowEnd--) ]) { // check that the destination square is free if (grid [ colEnd ] [ rowEnd ] == BLANK) { grid [ colStart ] [ rowStart ] = BLANK; grid [ colEnd ] [ rowEnd ] = player; } } // check if player is jumping over a piece else if (grid [ colEnd ] [ rowEnd ] == grid [ (colStart+2) ] [ (rowEnd+2) ] && grid [ colEnd ] [ rowEnd ] == grid [ (colStart-2) ] [ (rowEnd+2) ] && grid [ colEnd ] [ rowEnd ] == grid [ (colStart+2) ] [ (rowEnd-2) ] && grid [ colEnd ] [ rowEnd ] == grid [ (colStart-2) ] [ (rowEnd-2) ]) { // check that the piece in between contains an enemy if ((grid [ (colStart++) ] [ (rowEnd++) ] == enemy ) && (grid [ (colStart--) ] [ (rowEnd++) ] == enemy ) && (grid [ (colStart++) ] [ (rowEnd--) ] == enemy ) && (grid [ (colStart--) ] [ (rowEnd--) ] == enemy )) { // check that the destination is free if (grid [ colEnd ] [ rowEnd ] == BLANK) { grid [ colStart ] [ rowStart ] = BLANK; grid [ colEnd ] [ rowEnd ] = player; } } } } I'm not sure how I can prevent the error from happening, what do you recommend?

    Read the article

  • displaying data from database in to text box

    - by srinayak
    I have 2 JSP pages as below: projectcategory.jsp <% Connection con = DbConnect.connect(); Statement s = con.createStatement(); ResultSet rs = s.executeQuery("select * from projectcategory"); %> <DIV class="TabbedPanelsContent" align="center"> <TABLE border="1"> <TR> <TH>CATEGORY ID</TH> <TH>CATEGORY NAME</TH> <TH>Edit/Update</TH> </TR> <% while (rs.next()) { %> <%String p=rs.getString(1);%> <TR> <TD><%=rs.getString(1)%></TD> <TD><%=rs.getString(2)%></TD> <TD> <FORM action="EditPcat.jsp?pcatid=p"><INPUT type="submit" value='edit/update'></INPUT> </FORM> </TD> </TR> <% } %> </TABLE> </DIV> another is Editpcat.jsp: </head> <body> <%String s=request.getParameter("p"); %> <form action="ProjCatServlet" method="post"> <div align="right"><a href="projectcategory.jsp">view</a></div> <fieldset> <legend>Edit category</legend> <table cellspacing="2" cellpadding="2" border="0"> <tr> <td align="left">Category Id</td> <td><input type="text" name="pcatid" value="<%=s%>" ></td> </tr> <tr> <td align="right">Category Name</td> <td><input type="text" name="pcatname"></td> </tr> <tr> <td><input type="submit" value="submit"></td> </tr> </table> <input type="hidden" name="FUNCTION_ID" value="UPDATE"> </fieldset> </form> How to display value from one JSP page which we get from database in to text box of another JSP?

    Read the article

  • Huge Graph Structure

    - by Harph
    I'm developing an application in which I need a structure for represent a huge graph (between 1000000 and 6000000 nodes and 100 or 600 edges) in memory. The edges representation will contain some attribute of the relation. I have tried a memory map representation, arrays, dictionaries and string for represent that structure in memory, but this always crash because the memory limit. I would to get an advice of how can I represent this, or something similar. By the way, I'm using python.

    Read the article

  • Why do sockets not die when server dies? Why does a socket die when server is alive?

    - by Roman
    I try to play with sockets a bit. For that I wrote very simple "client" and "server" applications. Client: import java.net.*; public class client { public static void main(String[] args) throws Exception { InetAddress localhost = InetAddress.getLocalHost(); System.out.println("before"); Socket clientSideSocket = null; try { clientSideSocket = new Socket(localhost,12345,localhost,54321); } catch (ConnectException e) { System.out.println("Connection Refused"); } System.out.println("after"); if (clientSideSocket != null) { clientSideSocket.close(); } } } Server: import java.net.*; public class server { public static void main(String[] args) throws Exception { ServerSocket listener = new ServerSocket(12345); while (true) { Socket serverSideSocket = listener.accept(); System.out.println("A client-request is accepted."); } } } And I found a behavior that I cannot explain: I start a server, than I start a client. Connection is successfully established (client stops running and server is running). Then I close the server and start it again in a second. After that I start a client and it writes "Connection Refused". It seems to me that the server "remember" the old connection and does not want to open the second connection twice. But I do not understand how it is possible. Because I killed the previous server and started a new one! I do not start the server immediately after the previous one was killed (I wait like 20 seconds). In this case the server "forget" the socket from the previous server and accepts the request from the client. I start the server and then I start the client. Connection is established (server writes: "A client-request is accepted"). Then I wait a minute and start the client again. And server (which was running the whole time) accept the request again! Why? The server should not accept the request from the same client-IP and client-port but it does!

    Read the article

  • How do I get the Jetty 6 FileServerXml example to work?

    - by Norm
    I have followed along with the Tutorial and the examples. Yet I always get this error when I copy and paste the code: Exception in thread "main" java.lang.NullPointerException at net.test.FileServerXml.main(FileServerXml.java:13) In Eclipse I have the directory structured as such: package net.test -FileServerXml.java -fileserver.xml -index.html FileServerXml.java package net.test; import org.mortbay.jetty.Server; import org.mortbay.resource.Resource; import org.mortbay.xml.XmlConfiguration; public class FileServerXml { public static void main(String[] args) throws Exception { Resource fileserver_xml = Resource.newSystemResource("fileserver.xml"); XmlConfiguration configuration = new XmlConfiguration(fileserver_xml.getInputStream()); Server server = (Server)configuration.configure(); server.start(); server.join(); } } ` fileserver.xml `<?xml version="1.0"?> <Call name="addConnector"> <Arg> <New class="org.eclipse.jetty.server.nio.SelectChannelConnector"> <Set name="port">8080</Set> </New> </Arg> </Call> <Set name="handler"> <New class="org.eclipse.jetty.server.handler.HandlerList"> <Set name="handlers"> <Array type="org.eclipse.jetty.server.Handler"> <Item> <New class="org.eclipse.jetty.server.handler.ResourceHandler"> <Set name="directoriesListed">true</Set> <Set name="welcomeFiles"> <Array type="String"><Item>index.html</Item></Array> </Set> <Set name="resourceBase">.</Set> </New> </Item> <Item> <New class="org.eclipse.jetty.server.handler.DefaultHandler"> </New> </Item> </Array> </Set> </New> </Set> ` Thanks for your input. Norm

    Read the article

  • How do you get the host address and port from a System.Net.EndPoint?

    - by cyclotis04
    I'm using a TcpClient passed to me from a TcpListener, and for the life of me I can't figure out a simple way to get the address and port it's connected to. The best I have so far is _client.Client.RemoteEndPoint.ToString(); which returns a string in the form FFFF::FFFF:FFFF:FFF:FFFF%00:0000. I've managed to extract the address and port using Regular Expressions, but this seems like overkill. What am I missing?

    Read the article

  • PHP Getting XPath of a DOMNode

    - by user256007
    I am creating an XML document on the fly. and I need to know the XPath of the Node I've just created. I don't see any such function like DOMNode::calculateXPath(void):string and I am not willing to write one by my own. is there any known lite 3rd party Solution ??

    Read the article

  • How to maintain decimal precision in calculations

    - by Blankman
    I need to sum 2 decimal values together, then divide by 2 and convert to string. My calculation currently is trimming to 2 decimal places, but I want to keep as many decimals as I can. city.Latitude = ( (lat.North + lat.South) / 2 ).ToString(); the values for lat.North and lat.Souch are like: 55.32342322

    Read the article

  • Download file using ajax and webservice

    - by megabyte
    Hi All There is this 3rd party webservice. One of the public webmethods available is a GetDocument() method. This method returns a Document object. The Document object has properties for File(byte[]), ContentType(string) ect. My Question : Can I subscribe to this service using javascript(mootools) + ajax + JSON, return the document object, in this case an excel document, and force the file download?

    Read the article

  • Where can I find a library that parses source code and is able to extract the scope of where your cursor is currently in the code?

    - by Anthony
    In SublimeText(2), when you press [ctrl + shift + p] (mac osx) you are shown a scope of where your caret/cursor is in the source code at the given moment e.g.: entity.name.tag.inline.any.html meta.tag.inline.any.html text.html.basic I am curious about what library or script is used to parse the document/file and create that scope string. A sidenote: Typing view.syntax_name(view.sel()[0].b) into Sublime's console will output the scope as well.

    Read the article

  • Confused about NoMethodError in Ruby

    - by E L
    In a simple Ruby example, I'm getting an error that does not occur in irb. name = "Joe" def say_hi "\"Hi there!\" said #{self}" end response = name.say_hi puts response This code should return, "Hi there!" said Joe. It works perfectly fine in irb. However, when I attempt to put the same code in a file and run the file, I get this error: say_hi.rb:8:in `<main>': private method `say_hi' called for "Joe":String (NoMethodError) Any suggestion about why this happens?

    Read the article

  • Linux distro name parsing

    - by Ockonal
    Hello, I chose this way to get linux distro name: ls /etc/*release And now I have to parse it for name: /etc/<name>-release def checkDistro(): p = Popen('ls /etc/*release' , shell = True, stdout = PIPE) distroRelease = p.stdout.read() distroName = re.search( ur"\/etc\/(.*)\-release", distroRelease).group() print distroName But this prints the same string that is in distroRelease.

    Read the article

  • Drop shadow on a div container?

    - by Mike
    I have a searchbox with auto-suggest that pops a div up underneath it with multiple search string suggestions (like google). Is it possible to have drop shadow on the auto-suggest box with CSS or will I need a script of some sort? I tried a background image but the number of suggests can vary from 1 to 10 or 15. I'd prefer something that works in IE6+ and FF2+ if possible. Thanks!

    Read the article

  • Append to list of lists

    - by Joel
    Hello, I am trying to build a list of lists using the following code: list=3*[[]] Now I am trying to append a string to the list in position 0: list[0].append("hello") However, instead of receiving the list [ ["hello"] , [], [] ] I am receiving the list: [ ["hello"] ,["hello"] , ["hello"] ] Am I missing something? Thanks, Joel

    Read the article

  • Is it possible to have 'sub-templates' when using MailDefinition

    - by Dan
    I am using the MailDefinition class to create html emails for my site. The only problem I am having is that there is alot of repetition in the string templates. For example the email footer along with all the associated html and css has to be repeated in each template type. Is there a way to have sub-template? or some mechanism for avoiding this repetition?

    Read the article

  • Java: file write on finalize method

    - by sowrov
    In my understanding a singleton object will destroy only when the application is about to terminate. So in C++ I write a Singleton class to log my application and in that Singleton logger's destructor I log the time when my application was terminated. Things worked perfectly in C++. Now I want to have that same logger in Java, as in java there is no destructor so I implemented the finalize method for that singleton logger. But it seem that finalize method actually never get called. So, I add that System.runFinalizersOnExit(true); line, somewhere in my code (though I know it is deprecated) and that finalize method get called every time before termination of the app. But still there is a problem! If I try to write anything on file in that finalize method, It does not work, though System.out work without any problem! :( Can you guys help me on this problem? Here is a sample code of what I am try to do: Singleton Logger Class: public class MyLogger { FileWriter writer; private MyLogger() { try { this.writer = new FileWriter("log.txt"); } catch (IOException ex) { } } public static MyLogger getInstance() { return MyLoggerHolder.INSTANCE; } private static class MyLoggerHolder { private static final MyLogger INSTANCE = new MyLogger(); } @Override protected void finalize () { try { super.finalize(); System.out.println("Here"); //worked correctly. this.writer.write(new Date().toString()+System.getProperty("line.separator")); this.writer.write("End"); this.writer.flush(); //does not work! this.writer.close(); } catch (Throwable ex) { } } public synchronized void log(String str) { try { this.writer.write(new Date().toString()+System.getProperty("line.separator")); this.writer.write(str+"\n"); this.writer.flush(); } catch (IOException ex) { } } } Main: public class Main { public static void main(String[] args) { System.runFinalizersOnExit(true); MyLogger logger = MyLogger.getInstance(); logger.log("test"); } }

    Read the article

  • How to check if numbers are in correct sequence?

    - by Nazariy
    I have a two dimensional array that contain range of numbers that have to be validated using following rules, range should start from 0 and follow in arithmetic progression. For example: $array = array(); $array[] = array(0);//VALID $array[] = array(0,1,2,3,4,5);//VALID $array[] = array("0","1");//VALID $array[] = array(0,1,3,4,5,6);//WRONG $array[] = array(1,2,3,4,5);//WRONG $array[] = array(0,0,1,2,3,4);//WRONG what is most efficient way to do that in php? UPDATE I forgot to add that numbers can be represented as string

    Read the article

< Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >