Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 910/1408 | < Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >

  • How can I detect if an iPhone OS device has a proximity sensor?

    - by Batgar
    The docs related to proximity sensing state that if the proximity sensing APIs are used on a device without a proximity sensor (i.e. iPod touch, iPad) they will just return as if the proximity sensor has fired. Aside from checking the [[UIDevice currentDevice].model] string and parsing for "iPhone", "iPod touch", or "iPad" is there a slicker way to determine if a proximity sensor is on a given device?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • console.log is not working in Android 2.1 emulator

    - by R_Dhorawat
    i'm running one web application... in android emulator browser in one java script file i trying to output some string as console.log("android"); but i didn't got this log using adb logcat even i tried to start adb logcat firstly and then tun the app. but didn't got log message which i used in console.log is there any way so i can get my log message ...

    Read the article

  • TouchCode XML parsing error

    - by itsaboutcode
    Hi, I have a xml document which has only one element in the document, which is <error>error string<error> But when i try to parse it, it says this document has no element at all. In other words when i try to access the rootElement it says "null" CXMLDocument *rssParser = [[[CXMLDocument alloc] initWithContentsOfURL:url options:0 error:nil] autorelease]; NSLog(@"Root: %@",[[rssParser rootElement] name]); Please tell me what is wroing with this. Thanks

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • What makes an input vulnerable to XSS?

    - by vtortola
    Hi! I've been reading about XSS and I made a simple form with a text and submit input, but when I execute <script>alert();</script> on it, nothing happens, the server gets that string and that's all. What do I have to do for make it vulnerable?? (then I'll learn what I shouldn't do hehe) Cheers.

    Read the article

  • HttpSessionState as parameter

    - by HeavyWave
    What is the highest class in the hierarchy I can use to pass HttpSessionState as a parameter and add values to it? For instance to a method like public void MyMethod(IDictionary<string, object> input) { input.Add("something", something); } I see that implements ICollection and IEnumerable, but that only allows me to read values, not add them.

    Read the article

  • Finding process count in Linux via command line

    - by Moev4
    I was looking for the best way to find the number of running processes with the same name via the command line in Linux. For example if I wanted to find the number of bash processes running and get "5". Currently I have a script that does a 'pidof ' and then does a count on the tokenized string. This works fine but I was wondering if there was a better way that can be done entirely via the command line. Thanks in advance for your help.

    Read the article

  • Passing dynamic parameters to a stored procedure in SQL Server 2008

    - by themhz
    I have this procedure that executes another procedure passed by a parameter and its parameters datefrom and dateto. CREATE procedure [dbo].[execute_proc] @procs varchar(200), @pdatefrom date, @pdateto date as exec @procs @datefrom=@pdatefrom,@dateto=@pdateto But I need to also pass the parameters dynamically without the need to edit them in the procedure. For example, what I am imagining is something like this CREATE procedure [dbo].[execute_proc] @procs varchar(200), @params varchar(max) as exec @procs @params where @params is a string like @param1=1,@param2='somethingelse' Is there a way to do this?

    Read the article

  • HTML Encoding with ASP.NET

    - by Corin
    I am currently html encoding all user entered text before inserting/updating a db table record. The problem is that on any subsequent updates, the previously encoded string is reencoded. This endless loop is starting to eat up alot of column space in my tables. I am using parameterized queries for all sql statements but am wondering would it be safe to just let the .NET Framework handle this part without the HTML Encoding?

    Read the article

  • regular expression for letters, numbers and - _ .

    - by Jorre
    I'm having trouble checking in PHP if a value is is any of the following combinations letters (upper or lowercase) numbers (0-9) underscore (_) dash (-) point (.) no spaces! or other characters a few examples: OK: "screen123.css" OK: "screen-new-file.css" OK: "screen_new.js" NOT OK: "screen new file.css" I guess I need a regex for this, since I need to throw an error when a give string has other characters in it than the ones mentioned above.

    Read the article

  • PHP regular expression for positive number with 0 or 2 decimal places

    - by Peter
    Hi I am trying to use the following regular expression to check whether a string is a positive number with either zero decimal places, or 2: ^\d+(\.(\d{2}))?$ When I try to match this using preg_match, I get the error: Warning: preg_match(): No ending delimiter '^' found in /Library/WebServer/Documents/lib/forms.php on line 862 What am I doing wrong?

    Read the article

  • Lisp's "some" in Python?

    - by Mark Probst
    I have a list of strings and a list of filters (which are also strings, to be interpreted as regular expressions). I want a list of all the elements in my string list that are accepted by at least one of the filters. Ideally, I'd write [s for s in strings if some (lambda f: re.match (f, s), filters)] where some is defined as def some (pred, list): for x in list: res = pred (x) if res: return res return False Is something like that already available in Python, or is there a more idiomatic way to do this?

    Read the article

  • PHP - JSON Steam API query

    - by Hunter
    First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

    Read the article

  • How should I parse this simple text file in Java?

    - by Winston
    I have a text file that looks like this: grn129 agri- ac-214 ahss hud114 ahss lov1150 ahss lov1160 ahss lov1170 ahss lov1210 ahss What is the best way to parse this file using Java if I want to create a HashMap with the first column as the key and the second column as the value. Should I use the Scanner class? Try to read in the whole file as a string and split it? What is the best way?

    Read the article

  • Can't change Joomla Default language

    - by Moak
    On this site http://www.bostonteaclub.com I want the default language to be Chinese. I set the default language to Chinese in the backend (it's got the star next to it) but when you went to the page you probably noticed that the site is in english. If you check the source code you will see on the very bottom hidden a var_dump of the language object, and by the looks of it the default is still en-GB ["_default"]=> string(5) "en-GB" Why is this? Thanks

    Read the article

  • Huge Graph Structure

    - by Harph
    I'm developing an application in which I need a structure for represent a huge graph (between 1000000 and 6000000 nodes and 100 or 600 edges) in memory. The edges representation will contain some attribute of the relation. I have tried a memory map representation, arrays, dictionaries and string for represent that structure in memory, but this always crash because the memory limit. I would to get an advice of how can I represent this, or something similar. By the way, I'm using python.

    Read the article

  • Linux distro name parsing

    - by Ockonal
    Hello, I chose this way to get linux distro name: ls /etc/*release And now I have to parse it for name: /etc/<name>-release def checkDistro(): p = Popen('ls /etc/*release' , shell = True, stdout = PIPE) distroRelease = p.stdout.read() distroName = re.search( ur"\/etc\/(.*)\-release", distroRelease).group() print distroName But this prints the same string that is in distroRelease.

    Read the article

  • How Does One Differentiate Between Routes POSTed To In Asp.Net MVC?

    - by Laz
    I have two actions, one that accepts a ViewModel and one that accepts two parameters a string and an int, when I try to post to the action, it gives me an error telling me that the current request is ambiguous between the two actions. Is it possible to indicate to the routing system which action is the relevant one, and if it is how is it done?

    Read the article

  • What's the difference between these two calls to a function taking a collection of structural types?

    - by James Moore
    Why does the call to fn(Iterator("foo") compile, but the call to fn(fooIterator) fail with an error "type mismatch; found : Iterator[java.lang.String] required: scala.Iterator[com.banshee.Qx.HasLength]" object Qx { type HasLength = {def length: Int} def fn(xs: Iterator[HasLength]) = 3 var tn = fn(Iterator("foo")) var fooIterator = Iterator("foo") var tnFails = fn(fooIterator) //doesn't compile } Aren't they the same thing?

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • Creating a unique URL safe hash

    - by Ben Foster
    I want to hash/encode a unique integer (database ID) to create a similarly unique string. It needs to meet the following requirements: Must start with a letter or number, and can contain only letters and numbers. All letters in a container name must be lowercase. Must be from 3 through 63 characters long (although the shorter the better) The result does not need to be reversible, just repeatable - so a 1-way hash would be fine.

    Read the article

  • How to get the Queue name that NServiceBus pulled the message from.

    - by Simon
    I can use this code to get the return address. string returnAddress = Bus.CurrentMessageContext.ReturnAddress; But how do i get the "to address" of the message. i.e. the Queue that NServiceBus pulled the message from. I had a look through the source and it seems Bus.Transport.Address is what i want but there is no get on Transport Note: I am within the "Handle" method of a message handler.

    Read the article

< Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >