Search Results

Search found 35200 results on 1408 pages for 't string'.

Page 910/1408 | < Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >

  • How to configure SVN access list for directory/repository ?

    - by abatishchev
    I have next SVN repositories structure running Apache 2.2 under Windows Server 2008: http://example.com/svn/ is targeted to e:\svn (root) http://example.com/svn/dir/ is targeted to e:\svn\dir (some directory with a number of repositories) http://example.com/svn/dir/repo/ is targeted to e:\svn\dir\repo (a repository itself) How to access list so group @foo had rw access to repo? I have next access list: [groups] @foo = user1, user2 [/] * = r [dir/repo:/] @foo = rw The last string doesn't work in any combination I tried

    Read the article

  • Lisp's "some" in Python?

    - by Mark Probst
    I have a list of strings and a list of filters (which are also strings, to be interpreted as regular expressions). I want a list of all the elements in my string list that are accepted by at least one of the filters. Ideally, I'd write [s for s in strings if some (lambda f: re.match (f, s), filters)] where some is defined as def some (pred, list): for x in list: res = pred (x) if res: return res return False Is something like that already available in Python, or is there a more idiomatic way to do this?

    Read the article

  • Control characters as delimiters

    - by Gio Borje
    I have a nodejs TCP server and a client. Basic network communication happens. Client sends "data + STX_CHARACTER + data + ETX_CHARACTER" (just an example). How do I split the string using the STX Control Character as a delimiter or how do I reference the character at all in Javascript.

    Read the article

  • Is it possible to have 'sub-templates' when using MailDefinition

    - by Dan
    I am using the MailDefinition class to create html emails for my site. The only problem I am having is that there is alot of repetition in the string templates. For example the email footer along with all the associated html and css has to be repeated in each template type. Is there a way to have sub-template? or some mechanism for avoiding this repetition?

    Read the article

  • HttpSessionState as parameter

    - by HeavyWave
    What is the highest class in the hierarchy I can use to pass HttpSessionState as a parameter and add values to it? For instance to a method like public void MyMethod(IDictionary<string, object> input) { input.Add("something", something); } I see that implements ICollection and IEnumerable, but that only allows me to read values, not add them.

    Read the article

  • PHP Getting XPath of a DOMNode

    - by user256007
    I am creating an XML document on the fly. and I need to know the XPath of the Node I've just created. I don't see any such function like DOMNode::calculateXPath(void):string and I am not willing to write one by my own. is there any known lite 3rd party Solution ??

    Read the article

  • How can I progrommatically change the target framework from 4.0 to 3.5 of a project/solution?

    - by scott
    Edit 3: After more googling it looks like you can't have the TargetFrameworkMoniker property in a .NET 3.5 application. So I guess I should be asking a different question. How do I change the Target framework from 4.0 to 3.5? Unfortunately, I can only find stuff on how to go the other way. or better yet how do i progrommatically set the target framework version of a project to something other than 4.0? Original question: I just switched to vs2010. I have an application that uses .net 3.5. It loads plugins which are generated by a different app. The plugins are using .net 4 and there for cannot be loaded. I'm using EnvDTE.Project to create a project and set the settings. I can't find what setting needs to be set for this. Edit 1: I'm generating code for about 50 solutions. When I made the switch from vs2005 to vs2010 the projects in those solutions are defaulting to .NET Framework 4.0. So I need to set the .NET Framework to 3.5 when I am generating the code for these solutions. Edit 2: After a lot of googling I found this. so then I tried this: loProp = vsGetProperty("TargetFrameworkMoniker"); vsSetValue(loProp, ".NETFramework,Version=v3.5"); the definitions for those two methods are below. as far as I can tell they do the same this as project.Properties.Item("TargetFrameworkMoniker").Value = ".NETFramework,Version=v4.0,Profile=Client"; I start getting an Property Unavailable Exception later in the code. When I remove the new lines everything works except the projects target framework is still 4.0. The code generators target framework is 3.5 so I can't use the FrameworkName class like shown in the second example in that link. here is vsGetProperty protected Property vsGetProperty(string aProperty) { bool lbDone = false; int liCount = 0; Property loProp; while (!lbDone && liCount < pMaxRetries) { try { loProp = pProject.Properties.Item(aProperty); lbDone = true; return loProp; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } return null; } and vsSetValue protected void vsSetValue(Property aProperty, string aValue) { bool lbDone = false; int liCount = 0; while (!lbDone && liCount < pMaxRetries) { try { aProperty.Value = aValue; lbDone = true; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } }

    Read the article

  • Best way to return result from business layer to presentation layer when using LINQ-to-SQL

    - by samsur
    I have a business layer that has DTOs that are used in the presentation layer. This application uses entity framework. Here is an example of a class called RoleDTO: public class RoleDTO { public Guid RoleId { get; set; } public string RoleName { get; set; } public string RoleDescription { get; set; } public int? OrganizationId { get; set; } } In the BLL I want to have a method that returns a list of DTO. I would like to know which is the better approach: returning IQueryable or list of DTOs. Although I feel that returning IQueryable is not a good idea because the connection needs to be open. Here are the 2 different methods using the different approaches: First approach public class RoleBLL { private servicedeskEntities sde; public RoleBLL() { sde = new servicedeskEntities(); } public IQueryable<RoleDTO> GetAllRoles() { IQueryable<RoleDTO> role = from r in sde.Roles select new RoleDTO() { RoleId = r.RoleID, RoleName = r.RoleName, RoleDescription = r.RoleDescription, OrganizationId = r.OrganizationId }; return role; } Note: in the above method the DataContext is a private attribute and set in the constructor, so that the connection stays opened. Second approach public static List<RoleDTO> GetAllRoles() { List<RoleDTO> roleDTO = new List<RoleDTO>(); using (servicedeskEntities sde = new servicedeskEntities()) { var roles = from pri in sde.Roles select new { pri.RoleID, pri.RoleName, pri.RoleDescription }; //Add the role entites to the DTO list and return. This is necessary as anonymous types can be returned acrosss methods foreach (var item in roles) { RoleDTO roleItem = new RoleDTO(); roleItem.RoleId = item.RoleID; roleItem.RoleDescription = item.RoleDescription; roleItem.RoleName = item.RoleName; roleDTO.Add(roleItem); } return roleDTO; } } Please let me know, if there is a better approach.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how to update an Android ListActivity on changing data of the connected SimpleCursorAdapter

    - by 4485670
    I have the following code. What I want to achieve is to update the shown list when I click an entry so I can traverse through the list. I found the two uncommented ways to do it here on stackoverflow, but neither works. I also got the advice to create a new ListActivity on the data update, but that sounds like wasting resources? EDIT: I found the solution myself. All you need to do is call "SimpleCursorAdapter.changeCursor(new Cursor);". No notifying, no things in UI-Thread or whatever. import android.app.ListActivity; import android.database.Cursor; import android.os.Bundle; import android.util.Log; import android.view.View; import android.widget.ListView; import android.widget.SimpleCursorAdapter; public class MyActivity extends ListActivity { private DepartmentDbAdapter mDbHelper; private Cursor cursor; private String[] from = new String[] { DepartmentDbAdapter.KEY_NAME }; private int[] to = new int[] { R.id.text1 }; private SimpleCursorAdapter notes; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.departments_list); mDbHelper = new DepartmentDbAdapter(this); mDbHelper.open(); // Get all of the departments from the database and create the item list cursor = mDbHelper.fetchSubItemByParentId(1); this.startManagingCursor(cursor); // Now create an array adapter and set it to display using our row notes = new SimpleCursorAdapter(this, R.layout.department_row, cursor, from, to); this.setListAdapter(notes); } @Override protected void onListItemClick(ListView l, View v, int position, long id) { super.onListItemClick(l, v, position, id); // get new data and update the list this.updateData(safeLongToInt(id)); } /** * update data for the list * * @param int departmentId id of the parent department */ private void updateData(int departmentId) { // close the old one, get a new one cursor.close(); cursor = mDbHelper.fetchSubItemByParentId(departmentId); // change the cursor of the adapter to the new one notes.changeCursor(cursor); } /** * safely convert long to in to save memory * * @param long l the long variable * * @return integer */ public static int safeLongToInt(long l) { if (l < Integer.MIN_VALUE || l > Integer.MAX_VALUE) { throw new IllegalArgumentException (l + " cannot be cast to int without changing its value."); } return (int) l; } }

    Read the article

  • Can't change Joomla Default language

    - by Moak
    On this site http://www.bostonteaclub.com I want the default language to be Chinese. I set the default language to Chinese in the backend (it's got the star next to it) but when you went to the page you probably noticed that the site is in english. If you check the source code you will see on the very bottom hidden a var_dump of the language object, and by the looks of it the default is still en-GB ["_default"]=> string(5) "en-GB" Why is this? Thanks

    Read the article

  • I need to speed this code at least 2 times!

    - by Dominating
    include include include include using namespace std; inline void PrintMapName(multimap pN, string s) { pair::iterator, multimap::iterator ii; multimap::iterator it; ii = pN.equal_range(s); multimap tmp; for(it = ii.first; it != ii.second; ++it) { tmp.insert(pair(it-second,1)); } multimap::iterator i; bool flag = false; for(i = tmp.begin(); i != tmp.end(); i++) { if(flag) { cout<<" "; } cout<first; if(flag) { cout<<" "; } flag = true; } cout< int main() { multimap phoneNums; multimap numPhones; int N; cinN; int tests; string tmp, tmp1,tmp2; while(N 0) { cintests; while(tests 0) { cintmp; if(tmp == "add") { cintmp1tmp2; phoneNums.insert(pair(tmp1,tmp2)); numPhones.insert(pair(tmp2,tmp1)); } else { if(tmp == "delnum") { cintmp1; multimap::iterator it; multimap::iterator tmpr; for(it = phoneNums.begin(); it != phoneNums.end();it++) { tmpr = it; if(it-second == tmp1) { phoneNums.erase(it,tmpr); } } numPhones.erase(tmp1); } else { if(tmp == "delname") { cintmp1; phoneNums.erase(tmp1); multimap::iterator it; multimap::iterator tmpr; for(it = numPhones.begin(); it != numPhones.end();it++) { tmpr = it; if(it-second == tmp1) { numPhones.erase(it,tmpr); } } } else { if(tmp =="queryname") { cintmp1; PrintMapName(phoneNums, tmp1); } else//querynum { cintmp1; PrintMapName(numPhones, tmp1); } } } } tests--; } N--; } return 0; }

    Read the article

  • assistance required, hangman game.

    - by Phillip Gibson
    I am making a hangman game and am having trouble with part of it. I have selected a random word from a file, but I want to display the word as a series of undersocres __ and then match the letter chosen to a position in the undersocres. Can anyone help me? cout <<"1. Select to play the game\n"; cout <<"2. Ask for help\n"; cout <<"3. Select to quit the game\n"; cout << "Enter a selection: "; int number; cin >> number; while(number < 1 || number > 3 || cin.fail()) { if(cin.fail()) { cin.sync(); cin.clear(); cout << "You have not entered a number, please enter a menu selection between 1 and 3\n"; cin >> number; } else { cout << "Your selection must be between 1 and 3!\n"; cin >> number; } } switch (number) { case 1: { string word; string name; cout << " Whats your name? "; cin >> name; Player player(); ifstream FileReader; FileReader.open("words.txt"); if(!FileReader.is_open()) cout << "Error"; //this is for the random selection of words srand(time(0)); int randnum = rand()%10+1; for(int counter = 0; counter < randnum; counter++) { getline(FileReader, word, '\n'); } cout << "my word: " << word << "\n"; // get length of word int length; //create for loop for(int i = 0; i < length; i++) cout << "_"; //_ _ _ _ _ SetCursorPos(2,10); FileReader.close(); break;

    Read the article

  • Why does Python array moduel handle strings and lists differently?

    - by Casey
    I'm having trouble understanding the result of the following statements: >>> from array import array >>> array('L',[0xff,0xff,0xff,0xff]) array('L', [255L, 255L, 255L, 255L]) >>> from array import array >>> array('L','\xff\xff\xff\xff') Traceback (most recent call last): File "<stdin>", line 1, in <module> ValueError: string length not a multiple of item size

    Read the article

  • PHP regular expression for positive number with 0 or 2 decimal places

    - by Peter
    Hi I am trying to use the following regular expression to check whether a string is a positive number with either zero decimal places, or 2: ^\d+(\.(\d{2}))?$ When I try to match this using preg_match, I get the error: Warning: preg_match(): No ending delimiter '^' found in /Library/WebServer/Documents/lib/forms.php on line 862 What am I doing wrong?

    Read the article

  • PHP - JSON Steam API query

    - by Hunter
    First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

    Read the article

  • What makes an input vulnerable to XSS?

    - by vtortola
    Hi! I've been reading about XSS and I made a simple form with a text and submit input, but when I execute <script>alert();</script> on it, nothing happens, the server gets that string and that's all. What do I have to do for make it vulnerable?? (then I'll learn what I shouldn't do hehe) Cheers.

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • Finding process count in Linux via command line

    - by Moev4
    I was looking for the best way to find the number of running processes with the same name via the command line in Linux. For example if I wanted to find the number of bash processes running and get "5". Currently I have a script that does a 'pidof ' and then does a count on the tokenized string. This works fine but I was wondering if there was a better way that can be done entirely via the command line. Thanks in advance for your help.

    Read the article

  • Convert month number to month short name

    - by Roland
    I have a variable with the following value $month = 201002; the first 4 numbers represent the year, and the last 2 numbers represent the month. I need to get the last 2 numbers in the month string name eg. Feb My code looks like this <?php echo date('M',substr($month,4,6)); ?> I can I go about to obtain the month name

    Read the article

< Previous Page | 906 907 908 909 910 911 912 913 914 915 916 917  | Next Page >