Search Results

Search found 37654 results on 1507 pages for 'function prototypes'.

Page 915/1507 | < Previous Page | 911 912 913 914 915 916 917 918 919 920 921 922  | Next Page >

  • Determining CPU usage in WinCE

    - by Chris
    I want to be able to get the current % CPU usage in a C++ program running under Wince. I found this link that states where the source code is but I cannot find it in my platform builder installation - I expect this is because it isn't the Windows Automotive platform. Does anyone know where I can find this source code or (even better) know how I can get this information directly? i.e. what DLL / function calls to make etc.

    Read the article

  • How do I reference sqlite db column to use in update statement

    - by user244190
    I am trying to update a datetime column in an android sqlite db to use international date format (yyyy-mm-dd) instead of the current format (mm/dd/yyyy). I want to use the sqlite date() function to reformat the current value of the column. I thought it would be as simple as the following: update tblename set thedate = date(thedate) but the above does not work. How would i write the sql statement to accomplish this? thanks patrick

    Read the article

  • begin time and start time query

    - by shanks
    I have following data and using SQL Server 2005 UserID UserName LogTime LogDate 1 S 9:00 21/5/2010 1 S 10:00 21/5/2010 1 S 11:00 21/5/2010 1 S 12:00 21/5/2010 1 S 14:00 21/5/2010 1 S 17:00 21/5/2010 Need Output as:- 1 S 9:00 10:00 21/5/2010 1 S 11:00 12:00 21/5/2010 1 S 14:00 17:: 21/5/2010 I had used ROW_NUMBER function in query but its showing error

    Read the article

  • can i get the font information from Graphics System.Drawing.Graphics in c#

    - by Bahgat Mashaly
    Hello i get the Graphics from Graphics g= System.Drawing.Graphics.FromHwnd(button1.Handle); can i get the font information from this Graphics i was try to get a font by using GetTextFace api function but it return "system" it mean default font in OS and i was try to use SendMessage(button1.Handle, WM_GETFONT, 0, 0); bu it return me 0 also it is mean default font in OS I have known the cause of the problem, it due to FlatStyle property See this link http://blogs.msdn.com/b/michkap/archive/2008/09/26/8965526.aspx thanks

    Read the article

  • Using the jQuery Validator

    - by ScG
    I am using $.validator.addMethod How can I print the validation message in a control. I have a div id="err" where I want to print the message Here is what my method looks like $.validator.addMethod('something', function(value, element) { return false; }, 'I want to display this message in a Div with ID=error')

    Read the article

  • my layout breaks in IE7 and javascript page reloads make the screen blink

    - by chibineku
    My layout breaks if I change the window size in IE7/AOL, so I added a simple javascript function that fires on window.onresize, but no matter how I change the location I get problems. It was suggested I post a link and here it is: link text I already use PHP to detect browser and include an IE7-only inline stylesheet (and for mobile browsers), and my page looks nearly identical to the way it does in FF, Opera, Chrome, Safari and IE8, but when I change the window size, some things go wonky, and come back into line if you refresh. Any advice is welcome :)

    Read the article

  • MooTools - DOM Inserted Event

    - by Steve
    I would like an element to receive an event and perform some action when an element is injected into the DOM. Is there any event available to perform this? Something like the following: new Element('div', { events : { insertedIntoDom : function() { // Do something } } }) Thanks

    Read the article

  • img captions based on src value match

    - by Basho
    I am trying t o create img captions based on src value match. JQUERY : What is the best way to extract "Author-ABC" from an img with src value wwww.abcd.com/images/imagename_Author-ABC_.jpg and replace the alt value with this value. DRUPAL : Is there a way to preprocess this a drupal template function and save the value in img alt attribute? Ideas? Basho

    Read the article

  • Sanitising user input using Python

    - by Steve
    What's the best way to sanitise user input for a Python-based web application? Is there a single function to remove HTML characters and any other necessary characters combinations to ensure that an XSS or SQL injection attack isn't possible?

    Read the article

  • Can someone explain this 'double negative' trick?

    - by ProfessionalAmateur
    Hello, I am by no means an expert at javascript, but I have been reading Dave Pilgrim's "Dive into HTML5" webpage and he mentioned something that I would like a better understanding of. He states: "Finally, you use the double-negative trick to force the result to a Boolean value (true or false)." function supports_canvas() { return !!document.createElement('canvas').getContext; } If anyone can explain this a little better I would appreciate it!

    Read the article

  • Is rand() predictable in C++

    - by singh
    When I run the below program I always get the same values each time. Is rand not a true random function? int main() { while(1) { getch(); cout<<rand()<<endl; } } In each run I am getting the below values. 41 18467 6334 26500 19169 15724 ......

    Read the article

  • how to know when a work in a thread is complete?

    - by seinkraft
    I need to create multiple threads when a button is clicked and i've done that with this: Dim myThread As New Threading.Thread(AddressOf getFile) myThread.IsBackground = True myThread.Start() but i need to update a picture box with the downloaded file, buy if i set an event in the function getFile and raise it to notify that the files was downloaded and then update the picturebox.

    Read the article

  • div popup inside td

    - by sims
    I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

    Read the article

  • Problem with regular expression for some special parttern.

    - by SpawnCxy
    Hi all, I got a problem when I tried to find some characters with following code: preg_match_all('/[\w\uFF10-\uFF19\uFF21-\uFF3A\uFF41-\uFF5A]/',$str,$match); //line 5 print_r($match); And I got error as below: Warning: preg_match_all() [function.preg-match-all]: Compilation failed: PCRE does not support \L, \l, \N, \U, or \u at offset 4 in E:\mycake\app\webroot\re.php on line 5 I'm not so familiar with reg expression and have no idea about this error.How can I fix this?Thanks.

    Read the article

  • Windows7 Installer takes priority how to move it back during installation using C#?

    - by shahjapan
    I've a custom Action on Deployment project of .NET Applicaiton, which contains custom dialogbox to enter certain parameters, on invalid parameters I've shown MessageBox.Show - but its being hide by installer window, I tried windows forms too with Activate, TopMost, Focus,bring2front, etc serveral options but it comes by default behind the windows installer window and due to this user is not able to identify why installing process is not finishing - because actually its waiting for user to read the MessageBox and press OK. I've tried to implement IWin32Window with the handler of MsiExec Process, and shown the Messagebox but still its not working, anyone has idea ??? Here is my installer.cs function defination, public override void Install(IDictionary stateSaver)

    Read the article

  • Marshalling non-Blittable Structs from C# to C++

    - by Greggo
    I'm in the process of rewriting an overengineered and unmaintainable chunk of my company's library code that interfaces between C# and C++. I've started looking into P/Invoke, but it seems like there's not much in the way of accessible help. We're passing a struct that contains various parameters and settings down to unmanaged codes, so we're defining identical structs. We don't need to change any of those parameters on the C++ side, but we do need to access them after the P/Invoked function has returned. My questions are: What is the best way to pass strings? Some are short (device id's which can be set by us), and some are file paths (which may contain Asian characters) Should I pass an IntPtr to the C# struct or should I just let the Marshaller take care of it by putting the struct type in the function signature? Should I be worried about any non-pointer datatypes like bools or enums (in other, related structs)? We have the treat warnings as errors flag set in C++ so we can't use the Microsoft extension for enums to force a datatype. Is P/Invoke actually the way to go? There was some Microsoft documentation about Implicit P/Invoke that said it was more type-safe and performant. For reference, here is one of the pairs of structs I've written so far: C++ /** Struct used for marshalling Scan parameters from managed to unmanaged code. */ struct ScanParameters { LPSTR deviceID; LPSTR spdClock; LPSTR spdStartTrigger; double spinRpm; double startRadius; double endRadius; double trackSpacing; UINT64 numTracks; UINT32 nominalSampleCount; double gainLimit; double sampleRate; double scanHeight; LPWSTR qmoPath; //includes filename LPWSTR qzpPath; //includes filename }; C# /// <summary> /// Struct used for marshalling scan parameters between managed and unmanaged code. /// </summary> [StructLayout(LayoutKind.Sequential)] public struct ScanParameters { [MarshalAs(UnmanagedType.LPStr)] public string deviceID; [MarshalAs(UnmanagedType.LPStr)] public string spdClock; [MarshalAs(UnmanagedType.LPStr)] public string spdStartTrigger; public Double spinRpm; public Double startRadius; public Double endRadius; public Double trackSpacing; public UInt64 numTracks; public UInt32 nominalSampleCount; public Double gainLimit; public Double sampleRate; public Double scanHeight; [MarshalAs(UnmanagedType.LPWStr)] public string qmoPath; [MarshalAs(UnmanagedType.LPWStr)] public string qzpPath; }

    Read the article

  • Win32 C/C++ Load Image from memory buffer

    - by Bruno
    I want to load a image (.bmp) file on a Win32 application, but I do not want to use the standard LoadBitmap/LoadImage from Windows API: I want it to load from a buffer that is already in memory. I can easily load a bitmap directly from file and print it on the screen, but this issue is making me stuck :( What I'm looking for is a function that works like this: HBITMAP LoadBitmapFromBuffer(char* buffer, int width, int height); Thanks.

    Read the article

  • JS text to array

    - by Sonny
    Hi i got this text 2/92/20 3/32/32 4/62/6 5/22/28 6/60/61 7/33/32 8/34/31 9/31/19 10/19/19 11/34/39 12/32/32 14/19/25 15/45/37 16/32/32 17/84/36 18/72/33 and i need it to be like // 2/92/20 chars[0][0]=2; chars[0][1]=92; chars[0][2]=20; How should i make that PS: the split must be in $.ajax({ type: "POST", url: "char_info2.php", dataType: "html", success: function(data) { //here }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • What does the ^ operator do in Java?

    - by joroj
    What function does the "^" operator serve in Java? When I try this: int a = 5^n; ...it gives me: for n = 5, returns 0 for n = 4, returns 1 for n = 6, returns 3 ...so I guess it doesn't indicate exponentiation. But what is it then?

    Read the article

  • FB Connect going in an infinite loop with google chrome

    - by Mitesh
    Hi, I am having the following php code which i am trying for testing FB Connect <?php define('FACEBOOK_APP_ID', 'YOUR_APP_ID'); define('FACEBOOK_SECRET', 'YOUR_APP_SECRET'); function get_facebook_cookie($app_id, $application_secret) { enter code here $args = array(); parse_str(trim($COOKIE['fbs' . $app_id], '\"'), $args); ksort($args); $payload = ''; foreach ($args as $key = $value) { if ($key != 'sig') { $payload .= $key . '=' . $value; } } if (md5($payload . $application_secret) != $args['sig']) { return null; } return $args; } $cookie = get_facebook_cookie(FACEBOOK_APP_ID, FACEBOOK_SECRET); ? <!DOCTYPE html <html xmlns="http://www.w3.org/1999/xhtml" xmlns:fb="http://www.facebook.com/2008/fbml" <body <?php if ($cookie) { ? Your user ID is <?= $cookie['uid'] ? <br / Your Acess Token is <br / <?php $user = json_decode(file_get_contents( 'https://graph.facebook.com/me?access_token=' . $cookie['access_token'])); if($user) { echo "<br /Display Name = " . $user-name; echo "<br /First Name = " . $user-first_name; echo "<br /Last Name = " . $user-last_name; echo "<br /Birthday = " . $user-birthday; echo "<br /Home Town = " . $user-hometown-name; echo "<br /Location = " . $user-location-name; echo "<br /Email = " . $user-email . "<br /"; } ? <?php } else { ? <fb:login-button perms="email,user_birthday,publish_stream"</fb:login-button <?php } ? <div id="fb-root">&lt;/div> <script src="http://connect.facebook.net/en_US/all.js"></script> <script> FB.init({appId: '<?= FACEBOOK_APP_ID ?>', status: true, cookie: true, xfbml: true}); FB.Event.subscribe('auth.login', function(response) { window.location.reload(); }); </script> </body </html The problem faced by me is it works fine with IE and Firefox, however when done the same with google chrome I am running into an infinite loop when I click on reload/refresh button of chrome after logging in. Any hints as to why is it happening with chrome? Also how can it be avoided. Thanks, Mitesh

    Read the article

< Previous Page | 911 912 913 914 915 916 917 918 919 920 921 922  | Next Page >