Search Results

Search found 37654 results on 1507 pages for 'function prototypes'.

Page 915/1507 | < Previous Page | 911 912 913 914 915 916 917 918 919 920 921 922  | Next Page >

  • C#/.NET Project - Am I setting things up correctly?

    - by JustLooking
    1st solution located: \Common\Controls\Controls.sln and its project: \Common\Controls\Common.Controls\Common.Controls.csproj Description: This is a library that contains this class: public abstract class OurUserControl : UserControl { // Variables and other getters/setters common to our UserControls } 2nd solution located: \AControl\AControl.sln and its project: \AControl\AControl\AControl.csproj Description: Of the many forms/classes, it will contain this class: using Common.Controls; namespace AControl { public partial class AControl : OurUserControl { // The implementation } } A note about adding references (not sure if this is relevant): When I add references (for projects I create), using the names above: 1. I add Common.Controls.csproj to AControl.sln 2. In AControl.sln I turn off the build of Common.Controls.csproj 3. I add the reference to Common.Controls (by project) to AControl.csproj. This is the (easiest) way I know how to get Debug versions to match Debug References, and Release versions to match Release References. Now, here is where the issue lies (the 3rd solution/project that actually utilizes the UserControl): 3rd solution located: \MainProj\MainProj.sln and its project: \MainProj\MainProj\MainProj.csproj Description: Here's a sample function in one of the classes: private void TestMethod<T>() where T : Common.Controls.OurUserControl, new() { T TheObject = new T(); TheObject.OneOfTheSetters = something; TheObject.AnotherOfTheSetters = something_else; // Do stuff with the object } We might call this function like so: private void AnotherMethod() { TestMethod<AControl.AControl>(); } This builds, runs, and works. No problem. The odd thing is after I close the project/solution and re-open it, I have red squigglies everywhere. I bring up my error list and I see tons of errors (anything that deals with AControl will be noted as an error). I'll see errors such as: The type 'AControl.AControl' cannot be used as type parameter 'T' in the generic type or method 'MainProj.MainClass.TestMethod()'. There is no implicit reference conversion from 'AControl.AControl' to 'Common.Controls.OurUserControl'. or inside the actual method (the properties located in the abstract class): 'AControl.AControl' does not contain a definition for 'OneOfTheSetters' and no extension method 'OneOfTheSetters' accepting a first argument of type 'AControl.AControl' could be found (are you missing a using directive or an assembly reference?) Meanwhile, I can still build and run the project (then the red squigglies go away until I re-open the project, or close/re-open the file). It seems to me that I might be setting up the projects incorrectly. Thoughts?

    Read the article

  • Win32 C/C++ Load Image from memory buffer

    - by Bruno
    I want to load a image (.bmp) file on a Win32 application, but I do not want to use the standard LoadBitmap/LoadImage from Windows API: I want it to load from a buffer that is already in memory. I can easily load a bitmap directly from file and print it on the screen, but this issue is making me stuck :( What I'm looking for is a function that works like this: HBITMAP LoadBitmapFromBuffer(char* buffer, int width, int height); Thanks.

    Read the article

  • Reset selection of wx.lib.calendar.Calendar control?

    - by Joseph
    I have a wx.lib.calendar.Calendar control (not wx.lib.calendar.CalendarCtrl!). I am selecting a number of days using the following function call: self.cal.AddSelect([days], 'green', 'white') This works, and draws the days highlighted. However, I cannot work out how to reverse this (i.e., clear the selection so the days go back to their normal colouring). Any hints, please?

    Read the article

  • Why can't I put a jquery-ui progressbar inside a div with fixed position?

    - by Matthew
    I started the source from this progressbar example, and it works fine. My only change was to set the width of the progressbar to "20%". <!DOCTYPE html> <html> <head> <link href="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/themes/base/jquery-ui.css" rel="stylesheet" type="text/css"/> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.4/jquery.min.js"></script> <script src="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/jquery-ui.min.js"></script> <script> $(document).ready(function() { $("#progressbar").progressbar({ value: 37 }).css({ width : "20%"}); }); </script> </head> <body style="font-size:62.5%;"> <div id="progressbar"></div> </body> </html> I then put the progressbar inside another div, and used css to fix that div in the upper-right-hand corner. <!DOCTYPE html> <html> <head> <link href="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/themes/base/jquery-ui.css" rel="stylesheet" type="text/css"/> <style type="text/css"> #testContainer { position : fixed; top : 6; right : 6; } </style> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.4/jquery.min.js"></script> <script src="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/jquery-ui.min.js"></script> <script> $(document).ready(function() { $("#progressbar").progressbar({ value: 37 }).css({ width : "20%"}); }); </script> </head> <body style="font-size:62.5%;"> <div id="testContainer"> <div id="progressbar"></div> </div> </body> </html> The progressbar becomes a slim vertical line on the left side of the screen. What am I doing wrong? I'm new to web development in general, and jquery in particular, so please forgive me if this is a stupid question.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • highlighting search results in php error

    - by fusion
    i'm trying to figure out what is wrong in this code. it either doesn't highlight the search result OR it outputs html tags surrounding the highlighted text. . $search_result = ""; $search_result = trim($search_result); $special_cases = array( '%', '_', '+' ); $search_result = str_replace( $special_cases, '', $_GET["q"] ); //Check if the string is empty if ($search_result == "") { echo "<p>Search Error</p><p>Please enter a search...</p>" ; exit(); } $result = mysql_query('SELECT cQuotes, vAuthor, cArabic, vReference FROM thquotes WHERE cQuotes LIKE "%' . mysql_real_escape_string($search_result) .'%" ORDER BY idQuotes DESC', $conn) or die ('Error: '.mysql_error()); //eliminating special characters function h($s) { echo htmlspecialchars($s, ENT_QUOTES); } function highlightWords($string, $word) { $string = str_replace($word, "<span style='background-color: #FFE066;font-weight:bold;'>".$word."</span>", $string); /*** return the highlighted string ***/ return $string; } ?> <div class="caption">Search Results</div> <div class="center_div"> <table> <?php while ($row= mysql_fetch_array($result, MYSQL_ASSOC)) { $cQuote = highlightWords($row['cQuotes'], $search_result); ?> <tr> <td style="text-align:right; font-size:15px;"><?php h($row['cArabic']); ?></td> <td style="font-size:16px;"><?php h($cQuote); ?></td> <td style="font-size:12px;"><?php h($row['vAuthor']); ?></td> <td style="font-size:12px; font-style:italic; text-align:right;"><?php h($row['vReference']); ?></td> </tr> <?php } ?> </table> </div> on the browser, it is outputted as: A good <span style='background-color: #FFE066;font-weight:bold;'>action</span> is an ever-remaining store and a pure yield or if a div is used with class: A good <div class='highlight'>action</div> is an ever-remaining store and a pure yield

    Read the article

  • Count subset of binary pattern ..

    - by mr.bio
    Hi there . I have a A=set of strings and a B=seperate string. I want to count the number of occurences in from B in A. Example : A: 10001 10011 11000 10010 10101 B: 10001 result would be 3.(10001 is a subset of 10001,10011,10101) So i need a function that takes a set and string and returns an int. int myfunc(set<string> , string){ int result; // My Brain is melting return result ; }

    Read the article

  • how can a firefox extension detect content-type of the page loaded ?

    - by bosky101
    since my extension's pageload is triggered even when I view css or js files, i want to add another check that triggers my extension only when the current page's content-type is text/html . //eg: at my page load handler function onPageload(){ // only want to proceed if content-type reflects a text/html or */html page if ( contentTypeIsHtml() ){ //continue here } } what should contentTypeIsHtml() do ?

    Read the article

  • Template render callback

    - by Zsolt Németh
    I'm using Handlebar's {{#each}} to render out my collection to the DOM. After each item is rendered, I want to run a script on these elements. I'm trying to find a callabck function wich fires only once, when the whole render is completed. Meteor's Template.rendered() run's each time a new item is inserted, so it runs as many times as much item I have in my collection. Is there any solution for this? Thanks a lot!

    Read the article

  • FB Connect going in an infinite loop with google chrome

    - by Mitesh
    Hi, I am having the following php code which i am trying for testing FB Connect <?php define('FACEBOOK_APP_ID', 'YOUR_APP_ID'); define('FACEBOOK_SECRET', 'YOUR_APP_SECRET'); function get_facebook_cookie($app_id, $application_secret) { enter code here $args = array(); parse_str(trim($COOKIE['fbs' . $app_id], '\"'), $args); ksort($args); $payload = ''; foreach ($args as $key = $value) { if ($key != 'sig') { $payload .= $key . '=' . $value; } } if (md5($payload . $application_secret) != $args['sig']) { return null; } return $args; } $cookie = get_facebook_cookie(FACEBOOK_APP_ID, FACEBOOK_SECRET); ? <!DOCTYPE html <html xmlns="http://www.w3.org/1999/xhtml" xmlns:fb="http://www.facebook.com/2008/fbml" <body <?php if ($cookie) { ? Your user ID is <?= $cookie['uid'] ? <br / Your Acess Token is <br / <?php $user = json_decode(file_get_contents( 'https://graph.facebook.com/me?access_token=' . $cookie['access_token'])); if($user) { echo "<br /Display Name = " . $user-name; echo "<br /First Name = " . $user-first_name; echo "<br /Last Name = " . $user-last_name; echo "<br /Birthday = " . $user-birthday; echo "<br /Home Town = " . $user-hometown-name; echo "<br /Location = " . $user-location-name; echo "<br /Email = " . $user-email . "<br /"; } ? <?php } else { ? <fb:login-button perms="email,user_birthday,publish_stream"</fb:login-button <?php } ? <div id="fb-root">&lt;/div> <script src="http://connect.facebook.net/en_US/all.js"></script> <script> FB.init({appId: '<?= FACEBOOK_APP_ID ?>', status: true, cookie: true, xfbml: true}); FB.Event.subscribe('auth.login', function(response) { window.location.reload(); }); </script> </body </html The problem faced by me is it works fine with IE and Firefox, however when done the same with google chrome I am running into an infinite loop when I click on reload/refresh button of chrome after logging in. Any hints as to why is it happening with chrome? Also how can it be avoided. Thanks, Mitesh

    Read the article

  • pandas read rotated csv files

    - by EricCoding
    Is there any function in pandas that can directly read a rotated csv file? To be specific, the header information in the first col instead of the first row. For example: A 1 2 B 3 5 C 6 7 and I would like the final DataFrame this way A B C 1 3 5 2 5 7 Of corse we can get around this problem using some data wangling techniques like transpose and slicing. I am wondering there should be a quick way in API but I could not find it.

    Read the article

  • Is rand() predictable in C++

    - by singh
    When I run the below program I always get the same values each time. Is rand not a true random function? int main() { while(1) { getch(); cout<<rand()<<endl; } } In each run I am getting the below values. 41 18467 6334 26500 19169 15724 ......

    Read the article

  • Looking for interesting formula

    - by Thinker
    I'm creating a game where players can make an alloy. To make it less predictable and more interesting, I thought that the durability and hardness of an alloy should not be calculated by a simple formula, because it will be extremely easy to find extrema, where alloy have best statistics. So the questions is, is there any formula for a function where extrema can be found only by investigating all points? Input values will be in percents: 0.0%-100.0%. I think it should look like this: half sound wave

    Read the article

  • Hide multiple PictureBox except clicked

    - by gadirzade
    HI Let me explain what i wont to do.I have a form and there is 10 picturebox on it.when I click one of them I wont to hide all other except clicked.It is possible that on click event of all of them hide others.but I ask for efficent way.forexample with a single function call from click event maybe

    Read the article

  • div popup inside td

    - by sims
    I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

    Read the article

  • is rand() is perdicatable in C++

    - by singh
    Hi When i run below program i always get same values each time..Is rand is not a true random function. int main() { while(1) { getch(); cout<<rand()<<endl; } } In each run i am getting below values. 41 18467 6334 26500 19169 15724 ......

    Read the article

  • C# Serialization Surrogate - Cannot access a disposed object

    - by crushhawk
    I have an image class (VisionImage) that is a black box to me. I'm attempting to serialize the image object to file using Serialization Surrogates as explained on this page. Below is my surrogate code. sealed class VisionImageSerializationSurrogate : ISerializationSurrogate { public void GetObjectData(Object obj, SerializationInfo info, StreamingContext context) { VisionImage image = (VisionImage)obj; byte[,] temp = image.ImageToArray().U8; info.AddValue("width", image.Width); info.AddValue("height", image.Height); info.AddValue("pixelvalues", temp, temp.GetType()); } public Object SetObjectData(Object obj, SerializationInfo info, StreamingContext context, ISurrogateSelector selector) { VisionImage image = (VisionImage)obj; Int32 width = info.GetInt32("width"); Int32 height = info.GetInt32("height"); byte[,] temp = new byte[height, width]; temp = (byte[,])info.GetValue("pixelvalues", temp.GetType()); PixelValue2D tempPixels = new PixelValue2D(temp); image.ArrayToImage(tempPixels); return image; } } I've stepped through it to write to binary. It seems to be working fine (file is getting bigger as the images are captured). I tried to test it read the file back in. The values read back in are correct as far as the "info" object is concerned. When I get to the line image.ArrayToImage(tempPixels); It throws the "Cannot access a disposed object" exception. Upon further inspection, the object and the resulting image are both marked as disposed. My code behind the form spawns an "acquisitionWorker" and runs the following code. void acquisitionWorker_LoadImages(object sender, DoWorkEventArgs e) { // This is the main function of the acquisition background worker thread. // Perform image processing here instead of the UI thread to avoid a // sluggish or unresponsive UI. BackgroundWorker worker = (BackgroundWorker)sender; try { uint bufferNumber = 0; // Loop until we tell the thread to cancel or we get an error. When this // function completes the acquisitionWorker_RunWorkerCompleted method will // be called. while (!worker.CancellationPending) { VisionImage savedImage = (VisionImage) formatter.Deserialize(fs); CommonAlgorithms.Copy(savedImage, imageViewer.Image); // Update the UI by calling ReportProgress on the background worker. // This will call the acquisition_ProgressChanged method in the UI // thread, where it is safe to update UI elements. Do not update UI // elements directly in this thread as doing so could result in a // deadlock. worker.ReportProgress(0, bufferNumber); bufferNumber++; } } catch (ImaqException ex) { // If an error occurs and the background worker thread is not being // cancelled, then pass the exception along in the result so that // it can be handled in the acquisition_RunWorkerCompleted method. if (!worker.CancellationPending) e.Result = ex; } } What am I missing here? Why would the object be immediately disposed?

    Read the article

  • Test assertions for tuples with floats

    - by Space_C0wb0y
    I have a function that returns a tuple that, among others, contains a float value. Usually I use assertAlmostEquals to compare those, but this does not work with tuples. Also, the tuple contains other data-types as well. Currently I am asserting every element of the tuple individually, but that gets too much for a list of such tuples. Is there any good way to write assertions for such cases?

    Read the article

< Previous Page | 911 912 913 914 915 916 917 918 919 920 921 922  | Next Page >