Search Results

Search found 37654 results on 1507 pages for 'function prototypes'.

Page 916/1507 | < Previous Page | 912 913 914 915 916 917 918 919 920 921 922 923  | Next Page >

  • is rand() is perdicatable in C++

    - by singh
    Hi When i run below program i always get same values each time..Is rand is not a true random function. int main() { while(1) { getch(); cout<<rand()<<endl; } } In each run i am getting below values. 41 18467 6334 26500 19169 15724 ......

    Read the article

  • code to identify the number

    - by [email protected]
    Hi All, I got one problem while doing one TAPI application based project in C#. I'm using ITAPI3.dll My problem is.. i'm not getting incoming call information. To get the incoming call information, i'm using the getcallinfo function, but it is showing empty message.

    Read the article

  • Qt send signal to main application window

    - by dumbquestion
    I need a QDialog to send a signal to redraw the main window. But connect needs an object to connect to. So I must create each dialog with new and explicitly put a connect() every time. What I really need is a way of just sending MainWindow::Redraw() from inside any function and having a single connect() inside Mainwindow to receive them. But you can't make a signal static and dialogs obviously don't inherit from MainWindow.

    Read the article

  • Sanitising user input using Python

    - by Steve
    What's the best way to sanitise user input for a Python-based web application? Is there a single function to remove HTML characters and any other necessary characters combinations to ensure that an XSS or SQL injection attack isn't possible?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • GA Framework for Virtual Machines

    - by PeanutPower
    Does anyone know of any .NET genetic algorithm frameworks for evolving instructions sets in virtual machines to solve abstract problems? I would be particularly interested in a framework which allows virtual machines to self propagate within a pool and evolve against a fitness function determined by a data set with "good" outputs given expected inputs.

    Read the article

  • HTML_Template_IT and wordpress

    - by David Ryder
    I want to use PEAR's HTML_Template_IT in one of my Wordpress page templates so I can separate the HTML from the PHP. I got it working, except I am not sure about one thing. Wordpress's built-in function get_header() actually echo's HTML - so I can't technically set it as a template variable. Is this considered acceptable or is there another way to put the contents of get_header() in a variable? Thanks!

    Read the article

  • pandas read rotated csv files

    - by EricCoding
    Is there any function in pandas that can directly read a rotated csv file? To be specific, the header information in the first col instead of the first row. For example: A 1 2 B 3 5 C 6 7 and I would like the final DataFrame this way A B C 1 3 5 2 5 7 Of corse we can get around this problem using some data wangling techniques like transpose and slicing. I am wondering there should be a quick way in API but I could not find it.

    Read the article

  • C# Serialization Surrogate - Cannot access a disposed object

    - by crushhawk
    I have an image class (VisionImage) that is a black box to me. I'm attempting to serialize the image object to file using Serialization Surrogates as explained on this page. Below is my surrogate code. sealed class VisionImageSerializationSurrogate : ISerializationSurrogate { public void GetObjectData(Object obj, SerializationInfo info, StreamingContext context) { VisionImage image = (VisionImage)obj; byte[,] temp = image.ImageToArray().U8; info.AddValue("width", image.Width); info.AddValue("height", image.Height); info.AddValue("pixelvalues", temp, temp.GetType()); } public Object SetObjectData(Object obj, SerializationInfo info, StreamingContext context, ISurrogateSelector selector) { VisionImage image = (VisionImage)obj; Int32 width = info.GetInt32("width"); Int32 height = info.GetInt32("height"); byte[,] temp = new byte[height, width]; temp = (byte[,])info.GetValue("pixelvalues", temp.GetType()); PixelValue2D tempPixels = new PixelValue2D(temp); image.ArrayToImage(tempPixels); return image; } } I've stepped through it to write to binary. It seems to be working fine (file is getting bigger as the images are captured). I tried to test it read the file back in. The values read back in are correct as far as the "info" object is concerned. When I get to the line image.ArrayToImage(tempPixels); It throws the "Cannot access a disposed object" exception. Upon further inspection, the object and the resulting image are both marked as disposed. My code behind the form spawns an "acquisitionWorker" and runs the following code. void acquisitionWorker_LoadImages(object sender, DoWorkEventArgs e) { // This is the main function of the acquisition background worker thread. // Perform image processing here instead of the UI thread to avoid a // sluggish or unresponsive UI. BackgroundWorker worker = (BackgroundWorker)sender; try { uint bufferNumber = 0; // Loop until we tell the thread to cancel or we get an error. When this // function completes the acquisitionWorker_RunWorkerCompleted method will // be called. while (!worker.CancellationPending) { VisionImage savedImage = (VisionImage) formatter.Deserialize(fs); CommonAlgorithms.Copy(savedImage, imageViewer.Image); // Update the UI by calling ReportProgress on the background worker. // This will call the acquisition_ProgressChanged method in the UI // thread, where it is safe to update UI elements. Do not update UI // elements directly in this thread as doing so could result in a // deadlock. worker.ReportProgress(0, bufferNumber); bufferNumber++; } } catch (ImaqException ex) { // If an error occurs and the background worker thread is not being // cancelled, then pass the exception along in the result so that // it can be handled in the acquisition_RunWorkerCompleted method. if (!worker.CancellationPending) e.Result = ex; } } What am I missing here? Why would the object be immediately disposed?

    Read the article

  • Appending a prefix when using join in Perl

    - by syker
    I have an array of strings that I would like to use the join function on. However, I would like to prefix each string with the same string. Can I do this in one line as opposed to iterating through the array first and changing each value before using join?

    Read the article

  • jqeury: best way to place dom element in the center of viewport

    - by Anthony Koval'
    hello! i'm looking for a proper way of placing popup div-elemnt in the center of current view area. for example: we have some div element with {display:none; position:absolute} and few buttons, one on the top of document, second in the center and last one, somewhere in the bottom. By clicking on any of this button, div should appear in the center of current viewing area $(".btnClass").click(function(){ //some actions for positioning here $(div_id).show() })

    Read the article

  • img captions based on src value match

    - by Basho
    I am trying t o create img captions based on src value match. JQUERY : What is the best way to extract "Author-ABC" from an img with src value wwww.abcd.com/images/imagename_Author-ABC_.jpg and replace the alt value with this value. DRUPAL : Is there a way to preprocess this a drupal template function and save the value in img alt attribute? Ideas? Basho

    Read the article

  • How do I reference sqlite db column to use in update statement

    - by user244190
    I am trying to update a datetime column in an android sqlite db to use international date format (yyyy-mm-dd) instead of the current format (mm/dd/yyyy). I want to use the sqlite date() function to reformat the current value of the column. I thought it would be as simple as the following: update tblename set thedate = date(thedate) but the above does not work. How would i write the sql statement to accomplish this? thanks patrick

    Read the article

  • Test assertions for tuples with floats

    - by Space_C0wb0y
    I have a function that returns a tuple that, among others, contains a float value. Usually I use assertAlmostEquals to compare those, but this does not work with tuples. Also, the tuple contains other data-types as well. Currently I am asserting every element of the tuple individually, but that gets too much for a list of such tuples. Is there any good way to write assertions for such cases?

    Read the article

  • c++ global operator not playing well with template class

    - by John
    ok, i found some similar posts on stackoverflow, but I couldn't find any that pertained to my exact situation and I was confused with some of the answers given. Ok, so here is my problem: I have a template matrix class as follows: template <typename T, size_t ROWS, size_t COLS> class Matrix { public: template<typename, size_t, size_t> friend class Matrix; Matrix( T init = T() ) : _matrix(ROWS, vector<T>(COLS, init)) { /*for( int i = 0; i < ROWS; i++ ) { _matrix[i] = new vector<T>( COLS, init ); }*/ } Matrix<T, ROWS, COLS> & operator+=( const T & value ) { for( vector<T>::size_type i = 0; i < this->_matrix.size(); i++ ) { for( vector<T>::size_type j = 0; j < this->_matrix[i].size(); j++ ) { this->_matrix[i][j] += value; } } return *this; } private: vector< vector<T> > _matrix; }; and I have the following global function template: template<typename T, size_t ROWS, size_t COLS> Matrix<T, ROWS, COLS> operator+( const Matrix<T, ROWS, COLS> & lhs, const Matrix<T, ROWS, COLS> & rhs ) { Matrix<T, ROWS, COLS> returnValue = lhs; return returnValue += lhs; } To me, this seems to be right. However, when I try to compile the code, I get the following error (thrown from the operator+ function): binary '+=' : no operator found which takes a right-hand operand of type 'const matrix::Matrix<T,ROWS,COLS>' (or there is no acceptable conversion) I can't figure out what to make of this. Any help if greatly appreciated!

    Read the article

  • Is it true that one should not use NSLog() on production code?

    - by jpm
    I was told this a few times in this very site, but I wanted to make sure this is really the case. I was expecting to be able to sprinkle NSLog function calls throughout my code, and that Xcode/gcc would automatically strip those calls out when building my Release/Distribution builds. Should I avoid using this? If so, what alternatives are most common between experienced Objective-C programmers?

    Read the article

  • PHP array pointer craziness

    - by JMan
    I'm trying to create a "GetCurrentLevel" method that takes a point value as an input and returns what "Level" that corresponds to. I'm storing the Level = Points mapping in an array, but the array pointer is not moving logically when I use it a foreach loop. I've added echo statements for debugging. Here's my class definition: class Levels extends Model { protected $_map = array ( 'None' => 0, 'Bronze' => 50, 'Silver' => 200, 'Gold' => 500 ); public function __construct() { parent::__construct(); } public function GetCurrentLevel($points) { foreach ($this->_map as $name => $threshold) { echo "Level Name: $name<br/>"; echo "Level Threshold: $threshold<br/>"; echo "Current Level: " . key($this->_map) . "<br/>"; echo "Current Threshold: " . current($this->_map) . "<br/>"; if ($points < $threshold) /* Threshold is now above the points, so need to go back one level */ { $previousThreshold = prev($this->_map); echo "Previous Threshold: $previousThreshold<br/>"; echo "Final Level: " . key($this->_map) . "<br/>"; return key($this->_map); } echo "Go to next level <br/>"; } } And here is what I see when I call GetCurrentLevel(60): Level Name: None Level Threshold: 0 Current Level: Bronze //* Looks like foreach immediately moves the array pointer *// Current Threshold: 50 Go to next level Level Name: Bronze Level Threshold: 50 Current Level: Bronze //* WTF? Why hasn't the array pointer moved? *// Current Threshold: 50 Go to next level Level Name: Silver Level Threshold: 200 Current Level: Bronze //* WTF? Why hasn't the array pointer moved? *// Current Threshold: 50 Previous Threshold: 0 Final Level: None But the "Final Level" should be 'Bronze' since 60 points is above the 50 points needed for a Bronze medal, but below the 200 points needed for a Silver medal. Sorry for the long post. Thanks for your help!

    Read the article

  • NET USE command And Network Provider interface.

    - by Benjamin
    When we command "net use" on command prompt, the result has four columns. Status Local Remote Network OK Z: \\10.x.x.x\Public Microsoft Windows Network X: \\10.y.y.y\Public My Network Redirector The Microsoft Windows Network(SMB)'s Status has OK value, but we don't. It's just empty. We implemented NPEnumResource function in our Network Provider dll. But I don't know how can I set the value(OK). How can I do that? Thanks

    Read the article

  • Can I create class properties during __new__ or __init__?

    - by 007brendan
    I want to do something like this. The _print_attr function is designed to be called lazily, so I don't want to evaluate it in the init and set the value to attr. I would like to make attr a property that computes _print_attr only when accessed: class Base(object): def __init__(self): for attr in self._edl_uniform_attrs: setattr(self, attr, property(lambda self: self._print_attr(attr))) def _print_attr(self, attr): print attr class Child(Base): _edl_uniform_attrs = ['foo', 'bar'] me = Child() me.foo me.bar #output: #"foo" #"bar"

    Read the article

  • drupal how to show custom profile field

    - by Arun
    i added a profile field to registration form. how to show in edit registration (account) form . i wrote a module for edit account in that $form [function editregistration_form_user_profile_form_alter(&$form, &$form_state) ] doesn't contain the values of custom profile fields.

    Read the article

  • Get just the hour of day from DateTime using either 12 or 24 hour format as defined by the current c

    - by InvisibleBacon
    .Net has the built in ToShortDateString() function for DateTime that uses the CultureInfo.CurrentCulture.DateTimeFormat.ShortTimePattern format. It returns something like this for en-US: "5:00 pm". For a 24 hour culture such as de-DE it would return "17:00". What I want is a way to just return just the hour (So "5 pm" and "17" in the cases above) that works with every culture. What's the best/cleanest way to do this? Thanks!

    Read the article

< Previous Page | 912 913 914 915 916 917 918 919 920 921 922 923  | Next Page >