Search Results

Search found 37654 results on 1507 pages for 'function prototypes'.

Page 916/1507 | < Previous Page | 912 913 914 915 916 917 918 919 920 921 922 923  | Next Page >

  • masked the pasword input to UITexfield

    - by user262325
    Hello everyone I hope to mask the text input to UITextFiled as: "ABCDE" to "*****" below are my codes without function - (BOOL)textField:(UITextField *)textField shouldChangeCharactersInRange:(NSRange)range replacementString:(NSString *)string { int l=[textField.text length]; range=NSMakeRange(1, l ); string=[[[NSString alloc]initWithString:@"*"] autorelease]; return YES; } Welcome any comment Thanks interdev

    Read the article

  • download file exception handling

    - by klaus-vlad
    Hi, In my application I download several critical files from a server, and I want to write some code that handles the case where the a file download didn't complete for a reason or other ,to retry downloading it at next startup. The function that downloads a file at a time however throws only MalformedURLException and IOException , but if these exceptions are thrown that means that the download didn't even begin. How should I arrange things so I can treat the case where a download failed , even if it began ? download(String file) throws MalformedURLException ,IOException { }

    Read the article

  • img captions based on src value match

    - by Basho
    I am trying t o create img captions based on src value match. JQUERY : What is the best way to extract "Author-ABC" from an img with src value wwww.abcd.com/images/imagename_Author-ABC_.jpg and replace the alt value with this value. DRUPAL : Is there a way to preprocess this a drupal template function and save the value in img alt attribute? Ideas? Basho

    Read the article

  • Win32 C/C++ Load Image from memory buffer

    - by Bruno
    I want to load a image (.bmp) file on a Win32 application, but I do not want to use the standard LoadBitmap/LoadImage from Windows API: I want it to load from a buffer that is already in memory. I can easily load a bitmap directly from file and print it on the screen, but this issue is making me stuck :( What I'm looking for is a function that works like this: HBITMAP LoadBitmapFromBuffer(char* buffer, int width, int height); Thanks.

    Read the article

  • [CakePHP] I am so confused. What should I write in the default.ctp

    - by kwokwai
    Hi all, I am learning cakePHP, everything seems alright except that I am very confused of how to make use of the default.ctp and what should be put inside the Elements folder. Here is the default.ctp file that I have been using since my very first lesson on learning cakePHP: (I copied from this URL http://book.cakephp.org/view/96/Layouts) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title><?php echo $title_for_layout?></title> <link rel="shortcut icon" href="favicon.ico" type="image/x-icon"> <!-- Include external files and scripts here (See HTML helper for more info.) --> <?php echo $scripts_for_layout ?> </head> <body> <!-- If you'd like some sort of menu to show up on all of your views, include it here --> <div id="header"> <div id="menu">...</div> </div> <!-- Here's where I want my views to be displayed --> <?php echo $content_for_layout ?> <!-- Add a footer to each displayed page --> <div id="footer">...</div> </body> </html> But the problem is that the layout will take effect to all web pages that I have created. Let's see the case that I have recently encountered. In one of the .ctp files, I need to use JQuery function and I need to ass some and tags in the .ctp file. Here are the and tags I used: <Script language="javascript"> $(document).ready(function() { // some functions here }); </Script> <style type="text/css"> { #toppage{ width:800px; } But when I followed the default.ctp file, I noticed that these tags (i.e. and ) happened to appear below the tag. As far as I know, the and self-defined Javascript functions should be put inside the tag of the HTML instead. I have considered to add the and in the default.ctp file, but then these codes would appear in every web pages instead of just a particular web page. Please help.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • What does the ^ operator do in Java?

    - by joroj
    What function does the "^" operator serve in Java? When I try this: int a = 5^n; ...it gives me: for n = 5, returns 0 for n = 4, returns 1 for n = 6, returns 3 ...so I guess it doesn't indicate exponentiation. But what is it then?

    Read the article

  • FB Connect going in an infinite loop with google chrome

    - by Mitesh
    Hi, I am having the following php code which i am trying for testing FB Connect <?php define('FACEBOOK_APP_ID', 'YOUR_APP_ID'); define('FACEBOOK_SECRET', 'YOUR_APP_SECRET'); function get_facebook_cookie($app_id, $application_secret) { enter code here $args = array(); parse_str(trim($COOKIE['fbs' . $app_id], '\"'), $args); ksort($args); $payload = ''; foreach ($args as $key = $value) { if ($key != 'sig') { $payload .= $key . '=' . $value; } } if (md5($payload . $application_secret) != $args['sig']) { return null; } return $args; } $cookie = get_facebook_cookie(FACEBOOK_APP_ID, FACEBOOK_SECRET); ? <!DOCTYPE html <html xmlns="http://www.w3.org/1999/xhtml" xmlns:fb="http://www.facebook.com/2008/fbml" <body <?php if ($cookie) { ? Your user ID is <?= $cookie['uid'] ? <br / Your Acess Token is <br / <?php $user = json_decode(file_get_contents( 'https://graph.facebook.com/me?access_token=' . $cookie['access_token'])); if($user) { echo "<br /Display Name = " . $user-name; echo "<br /First Name = " . $user-first_name; echo "<br /Last Name = " . $user-last_name; echo "<br /Birthday = " . $user-birthday; echo "<br /Home Town = " . $user-hometown-name; echo "<br /Location = " . $user-location-name; echo "<br /Email = " . $user-email . "<br /"; } ? <?php } else { ? <fb:login-button perms="email,user_birthday,publish_stream"</fb:login-button <?php } ? <div id="fb-root">&lt;/div> <script src="http://connect.facebook.net/en_US/all.js"></script> <script> FB.init({appId: '<?= FACEBOOK_APP_ID ?>', status: true, cookie: true, xfbml: true}); FB.Event.subscribe('auth.login', function(response) { window.location.reload(); }); </script> </body </html The problem faced by me is it works fine with IE and Firefox, however when done the same with google chrome I am running into an infinite loop when I click on reload/refresh button of chrome after logging in. Any hints as to why is it happening with chrome? Also how can it be avoided. Thanks, Mitesh

    Read the article

  • Marshalling non-Blittable Structs from C# to C++

    - by Greggo
    I'm in the process of rewriting an overengineered and unmaintainable chunk of my company's library code that interfaces between C# and C++. I've started looking into P/Invoke, but it seems like there's not much in the way of accessible help. We're passing a struct that contains various parameters and settings down to unmanaged codes, so we're defining identical structs. We don't need to change any of those parameters on the C++ side, but we do need to access them after the P/Invoked function has returned. My questions are: What is the best way to pass strings? Some are short (device id's which can be set by us), and some are file paths (which may contain Asian characters) Should I pass an IntPtr to the C# struct or should I just let the Marshaller take care of it by putting the struct type in the function signature? Should I be worried about any non-pointer datatypes like bools or enums (in other, related structs)? We have the treat warnings as errors flag set in C++ so we can't use the Microsoft extension for enums to force a datatype. Is P/Invoke actually the way to go? There was some Microsoft documentation about Implicit P/Invoke that said it was more type-safe and performant. For reference, here is one of the pairs of structs I've written so far: C++ /** Struct used for marshalling Scan parameters from managed to unmanaged code. */ struct ScanParameters { LPSTR deviceID; LPSTR spdClock; LPSTR spdStartTrigger; double spinRpm; double startRadius; double endRadius; double trackSpacing; UINT64 numTracks; UINT32 nominalSampleCount; double gainLimit; double sampleRate; double scanHeight; LPWSTR qmoPath; //includes filename LPWSTR qzpPath; //includes filename }; C# /// <summary> /// Struct used for marshalling scan parameters between managed and unmanaged code. /// </summary> [StructLayout(LayoutKind.Sequential)] public struct ScanParameters { [MarshalAs(UnmanagedType.LPStr)] public string deviceID; [MarshalAs(UnmanagedType.LPStr)] public string spdClock; [MarshalAs(UnmanagedType.LPStr)] public string spdStartTrigger; public Double spinRpm; public Double startRadius; public Double endRadius; public Double trackSpacing; public UInt64 numTracks; public UInt32 nominalSampleCount; public Double gainLimit; public Double sampleRate; public Double scanHeight; [MarshalAs(UnmanagedType.LPWStr)] public string qmoPath; [MarshalAs(UnmanagedType.LPWStr)] public string qzpPath; }

    Read the article

  • process.getprocessesbyname()

    - by user181421
    Hello, I would like to use this function in C#, but I need to get 2 types of processes. Is it possible to do something like this: process.getprocessesbyname("process1", "process2"); How can I get the instances of 2 processes with different names? TY

    Read the article

  • how can a firefox extension detect content-type of the page loaded ?

    - by bosky101
    since my extension's pageload is triggered even when I view css or js files, i want to add another check that triggers my extension only when the current page's content-type is text/html . //eg: at my page load handler function onPageload(){ // only want to proceed if content-type reflects a text/html or */html page if ( contentTypeIsHtml() ){ //continue here } } what should contentTypeIsHtml() do ?

    Read the article

  • JS text to array

    - by Sonny
    Hi i got this text 2/92/20 3/32/32 4/62/6 5/22/28 6/60/61 7/33/32 8/34/31 9/31/19 10/19/19 11/34/39 12/32/32 14/19/25 15/45/37 16/32/32 17/84/36 18/72/33 and i need it to be like // 2/92/20 chars[0][0]=2; chars[0][1]=92; chars[0][2]=20; How should i make that PS: the split must be in $.ajax({ type: "POST", url: "char_info2.php", dataType: "html", success: function(data) { //here }

    Read the article

  • Test assertions for tuples with floats

    - by Space_C0wb0y
    I have a function that returns a tuple that, among others, contains a float value. Usually I use assertAlmostEquals to compare those, but this does not work with tuples. Also, the tuple contains other data-types as well. Currently I am asserting every element of the tuple individually, but that gets too much for a list of such tuples. Is there any good way to write assertions for such cases?

    Read the article

  • Unable to get index from jQuery UI slider range

    - by Phil.Wheeler
    I'm having a hell of a time trying to get (what I thought was) a simple index from a collection of multiple sliders. The HTML is as follows: <div id="left-values" class="line"> <span id="l1" style="padding: 0 1.8em;">0</span> <span id="l2" style="padding: 0 1.8em;">0</span> <span id="l3" style="padding: 0 1.8em;">0</span> <span id="l4" style="padding: 0 1.8em;">0</span> <span id="l5" style="padding: 0 1.8em;">0</span> <span id="l6" style="padding: 0 1.8em;">0</span> <span id="l7" style="padding: 0 1.8em;">0</span> <span id="l8" style="padding: 0 1.8em;">0</span> </div> And the jQuery code is: // setup audiometry sliders $("#eq > span").each(function (e) { // read initial values from markup and remove that var value = parseInt($(this).text()); // var index = $(this).index; <- this didn't work. $(this).empty(); $(this).slider({ value: value, slide: function (event, ui) { //console.log($(this).attr('id')); <- neither did this. //console.log(index); $('#left-values span:first').text(ui.value); } }) }); The problem is that jQuery UI - when creating a slider - replaces the existing HTML with its own markup. This includes any ID values and, for whatever reason, I can't get the index for a given slider to surface either. So I'm running out of ideas.

    Read the article

  • Numpy array dimensions

    - by cristian
    Hello, I'm currently trying to learn Numpy and Python. Given the following array: import numpy as N a = N.array([[1,2],[1,2]]) Is there a function that returns the dimensions of a (e.g.a is a 2 by 2 array). size() returns 4 and that doesn't help very much. Thanks.

    Read the article

  • Change video being played in HTML5 video

    - by Krt_Malta
    Hi! I'm using the tags in HTML5 to play a video on a web browser... (and I'm very impressed with this new feature) Is there the functionality to change the video being played through Javascript? Say when I select another video from a list, a Javascript function would be called which would contain something on the lines of MyVideo.VideoLocation = //location of new video to be played. Is this possible please? Thanks and regards, Krt_Malta

    Read the article

  • change password code error

    - by ejah85
    I've created a code to change a password. Now it seem contain an error. When I fill in the form to change password, and click save the error message: Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 Warning: mysql_real_escape_string() expects parameter 2 to be resource, null given in C:\Program Files\xampp\htdocs\e-Complaint(FYP)\userChangePass.php on line 103 I really don’t know what the error message means. Please guys. Help me fix it. Here's is the code: <?php session_start(); ?> <?php # change password.php //set the page title and include the html header. $page_title = 'Change Your Password'; //include('templates/header.inc'); if(isset($_POST['submit'])){//handle the form require_once('connectioncomplaint.php');//connect to the db. //include "connectioncomplaint.php"; //create a function for escaping the data. function escape_data($data){ global $dbc;//need the connection. if(ini_get('magic_quotes_gpc')){ $data=stripslashes($data); } return mysql_real_escape_string($data, $dbc); }//end function $message=NULL;//create the empty new variable. //check for a username if(empty($_POST['userid'])){ $u=FALSE; $message .='<p> You forgot enter your userid!</p>'; }else{ $u=escape_data($_POST['userid']); } //check for existing password if(empty($_POST['password'])){ $p=FALSE; $message .='<p>You forgot to enter your existing password!</p>'; }else{ $p=escape_data($_POST['password']); } //check for a password and match againts the comfirmed password. if(empty($_POST['password1'])) { $np=FALSE; $message .='<p> you forgot to enter your new password!</p>'; }else{ if($_POST['password1'] == $_POST['password2']){ $np=escape_data($_POST['password1']); }else{ $np=FALSE; $message .='<p> your new password did not match the confirmed new password!</p>'; } } if($u && $p && $np){//if everything's ok. $query="SELECT userid FROM access WHERE (userid='$u' AND password=PASSWORD('$p'))"; $result=@mysql_query($query); $num=mysql_num_rows($result); if($num == 1){ $row=mysql_fetch_array($result, MYSQL_NUM); //make the query $query="UPDATE access SET password=PASSWORD('$np') WHERE userid=$row[0]"; $result=@mysql_query($query);//run the query. if(mysql_affected_rows() == 1) {//if it run ok. //send an email,if desired. echo '<p><b>your password has been changed.</b></p>'; include('templates/footer.inc');//include the HTML footer. exit();//quit the script. }else{//if it did not run OK. $message= '<p>Your password could not be change due to a system error.We apolpgize for any inconvenience.</p><p>' .mysql_error() .'</p>'; } }else{ $message= '<p> Your username and password do not match our records.</p>'; } mysql_close();//close the database connection. }else{ $message .='<p>Please try again.</p>'; } }//end oh=f the submit conditional. //print the error message if there is one. if(isset($message)){ echo'<font color="red">' , $message, '</font>'; } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <body> <script language="JavaScript1.2">mmLoadMenus();</script> <table width="604" height="599" border="0" align="center" cellpadding="0" cellspacing="0"> <tr> <td height="130" colspan="7"><img src="images/banner(E-Complaint)-.jpg" width="759" height="130" /></td> </tr> <tr> <td width="100" height="30" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="100" bgcolor="#ABD519"></td> <td width="160" bgcolor="#ABD519"> <?php include "header.php"; ?>&nbsp;</td> </tr> <tr> <td colspan="7" bgcolor="#FFFFFF"> <fieldset><legend> Enter your information in the form below:</legend> <p><b>User ID:</b> <input type="text" name="username" size="10" maxlength="20" value="<?php if(isset($_POST['userid'])) echo $_POST['userid']; ?>" /></p> <p><b>Current Password:</b> <input type="password" name="password" size="20" maxlength="20" /></p> <p><b>New Password:</b> <input type="password" name="password1" size="20" maxlength="20" /></p> <p><b>Confirm New Password:</b> <input type="password" name="password2" size="20" maxlength="20" /></p> </fieldset> <div align="center"> <input type="submit" name="submit" value="Change My Password" /></div> </form><!--End Form--> </td> </tr> </table> </body> </html>

    Read the article

  • How can I tell if the screen is on in android?

    - by user297020
    In Android 2.2 (Level 7) the function PowerManager.IsScreenOn() returns a boolean that is true if the screen is turned on and false if the screen is turned off. I am developing code for Android 1.5 (Level 3). How do I accomplish the same task in older versions of Android? I do not want to turn the screen on or off in my code. I just want to know what it is.

    Read the article

  • Perl :Dumpxs in Data::Dumper

    - by kiruthika
    Hi all, I have went through the source code of Data::Dumper.In this package I didn't understand about Dumpxs.Actually what is the use of this Dumpxs. In net I have searched about this and I read that, it is equal to dump function and it is faster than dump. But I didn't understand well about this.

    Read the article

< Previous Page | 912 913 914 915 916 917 918 919 920 921 922 923  | Next Page >