Search Results

Search found 7034 results on 282 pages for 'inverse match'.

Page 92/282 | < Previous Page | 88 89 90 91 92 93 94 95 96 97 98 99  | Next Page >

  • Arrays not matching correctly

    - by Nick Gibson
    userAnswer[] holds the string of the answer the user types in and is comparing it to answers[] to see if they match up and then spits out correct or wrong. j is equal to the question number. So if j was question 6, answers[j] should refer to answers[6] right? Then userAnswer[6] should compare to answers[6] and match if its correct. But its giving me wrong answers and displaying the answer I typed as correct. int abc, loopCount = 100; int j = quesNum, overValue, forLoop = 100; for (int loop = 1; loop < loopCount; loop++) { aa = r.nextInt(10+1); abc = (int) aa; String[] userAnswer = new String[x]; JOptionPane.showMessageDialog(null,abc); if(abc < x) { userAnswer[j] = JOptionPane.showInputDialog(null,"Question "+quesNum+"\n"+questions[abc]+"\n\nA: "+a[abc]+"\nB: "+b[abc]+"\nC: "+c[abc]+"\nD: "+d[abc]); if(userAnswer[j].equals(answers[j])) { JOptionPane.showMessageDialog(null,"Correct. \nThe Correct Answer is "+answers[abc]); } else { JOptionPane.showMessageDialog(null,"Wrong. \n The Correct Answer is "+answers[abc]); }//else }//if }//for

    Read the article

  • figuring out which field to look for a value in with SQL and perl

    - by Micah
    I'm not too good with SQL and I know there's probably a much more efficient way to accomplish what I'm doing here, so any help would be much appreciated. Thanks in advance for your input! I'm writing a short program for the local school high school. At this school, juniors and seniors who have driver's licenses and cars can opt to drive to school rather than ride the bus. Each driver is assigned exactly one space, and their DLN is used as the primary key of the driver's table. Makes, models, and colors of cars are stored in a separate cars table, related to the drivers table by the License plate number field. My idea is to have a single search box on the main GUI of the program where the school secretary can type in who/what she's looking for and pull up a list of results. Thing is, she could be typing a license plate number, a car color, make, and model, someone driver's name, some student driver's DLN, or a space number. As the programmer, I don't know what exactly she's looking for, so a couple of options come to mind for me to build to be certain I check everywhere for a match: 1) preform a couple of SELECT * FROM [tablename] SQL statements, one per table and cram the results into arrays in my program, then search across the arrays one element at a time with regex, looking for a matched pattern similar to the search term, and if I find one, add the entire record that had a match in it to a results array to display on screen at the end of the search. 2) take whatever she's looking for into the program as a scaler and prepare multiple select statements around it, such as SELECT * FROM DRIVERS WHERE DLN = $Search_Variable SELECT * FROM DRIVERS WHERE First_Name = $Search_Variable SELECT * FROM CARS WHERE LICENSE = $Search_Variable and so on for each attribute of each table, sticking the results into a results array to show on screen when the search is done. Is there a cleaner way to go about this lookup without having to make her specify exactly what she's looking for? Possibly some kind of SQL statement I've never seen before?

    Read the article

  • import csv file/excel into sql database asp.net

    - by kiev
    Hi everyone! I am starting a project with asp.net visual studio 2008 / SQL 2000 (2005 in future) using c#. The tricky part for me is that the existing DB schema changes often and the import files columns will all have to me matched up with the existing db schema since they may not be one to one match on column names. (There is a lookup table that provides the tables schema with column names I will use) I am exploring different ways to approach this, and need some expert advice. Is there any existing controls or frameworks that I can leverage to do any of this? So far I explored FileUpload .NET control, as well as some 3rd party upload controls to accomplish the upload such as SlickUpload but the files uploaded should be < 500mb Next part is reading of my csv /excel and parsing it for display to the user so they can match it with our db schema. I saw CSVReader and others but for excel its more difficult since I will need to support different versions. Essentially The user performing this import will insert and/or update several tables from this import file. There are other more advance requirements like record matching but and preview of the import records, but I wish to get through understanding how to do this first. Update: I ended up using csvReader with LumenWorks.Framework for uploading the csv files.

    Read the article

  • Hibernate without primary keys generated by db?

    - by Michael Jones
    I'm building a data warehouse and want to use InfiniDB as the storage engine. However, it doesn't allow primary keys or foreign key constraints (or any constraints for that matter). Hibernate complains "The database returned no natively generated identity value" when I perform an insert. Each table is relational, and contains a unique integer column that was previously used as the primary key - I want to keep that, but just not have the constraint in the db that the column is the primary key. I'm assuming the problem is that Hibernate expects the db to return a generated key. Is it possible to override this behaviour so I can set the primary key field's value myself and keep Hibernate happy? -- edit -- Two of the mappings are as follows: <?xml version="1.0"?> <!DOCTYPE hibernate-mapping PUBLIC "-//Hibernate/Hibernate Mapping DTD 3.0//EN" "http://hibernate.sourceforge.net/hibernate-mapping-3.0.dtd"> <!-- Generated Jun 1, 2010 2:49:51 PM by Hibernate Tools 3.2.1.GA --> <hibernate-mapping> <class name="com.example.project.Visitor" table="visitor" catalog="orwell"> <id name="id" type="java.lang.Long"> <column name="id" /> <generator class="identity" /> </id> <property name="firstSeen" type="timestamp"> <column name="first_seen" length="19" /> </property> <property name="lastSeen" type="timestamp"> <column name="last_seen" length="19" /> </property> <property name="sessionId" type="string"> <column name="session_id" length="26" unique="true" /> </property> <property name="userId" type="java.lang.Long"> <column name="user_id" /> </property> <set name="visits" inverse="true"> <key> <column name="visitor_id" /> </key> <one-to-many class="com.example.project.Visit" /> </set> </class> </hibernate-mapping> and: <?xml version="1.0"?> <!DOCTYPE hibernate-mapping PUBLIC "-//Hibernate/Hibernate Mapping DTD 3.0//EN" "http://hibernate.sourceforge.net/hibernate-mapping-3.0.dtd"> <!-- Generated Jun 1, 2010 2:49:51 PM by Hibernate Tools 3.2.1.GA --> <hibernate-mapping> <class name="com.example.project.Visit" table="visit" catalog="orwell"> <id name="id" type="java.lang.Long"> <column name="id" /> <generator class="identity" /> </id> <many-to-one name="visitor" class="com.example.project.Visitor" fetch="join" cascade="all"> <column name="visitor_id" /> </many-to-one> <property name="visitId" type="string"> <column name="visit_id" length="20" unique="true" /> </property> <property name="startTime" type="timestamp"> <column name="start_time" length="19" /> </property> <property name="endTime" type="timestamp"> <column name="end_time" length="19" /> </property> <property name="userAgent" type="string"> <column name="user_agent" length="65535" /> </property> <set name="pageViews" inverse="true"> <key> <column name="visit_id" /> </key> <one-to-many class="com.example.project.PageView" /> </set> </class> </hibernate-mapping>

    Read the article

  • How to handle this type of model validation in Ruby on Rails

    - by randombits
    I have a controller/model hypothetically named Pets. Pets has the following declarations: :belongs_to owner :has_many dogs :has_many cats Not the best example, but again, it demonstrates what I'm trying to solve. Now when a request comes in as an HTTP POST to http://127.0.0.1/pets, I want to create an instance of Pets. The restriction here is, if the user doesn't submit at least one dog or one cat, it should fail validation. It can have both, but it can't be missing both. How does one handle this in Ruby on Rails? Dogs don't care if cats exists and the inverse is also true. Can anyone show some example code of what the Pets model would look like to ensure that one or the other exists, or fail otherwise? errors.add also takes an attribute, in this case, there is no particular attribute that's failing. It's almost a 'virtual' combination that's missing.

    Read the article

  • PHP - dynamic page via subdomain

    - by Phil Jackson
    Hi, im creating profile pages based on a subdomains using the wildcard DNS setting. Problem being, if the subdomain is incorrect, I want it to redirect to the same page but without the subdomain infront ie; if ( preg_match('/^(www\.)?([^.]+)\.domainname\.co.uk$/', $_SERVER['HTTP_HOST'], $match)) { $DISPLAY_NAME = $match[2]; $query = "SELECT * FROM `" . ACCOUNT_TABLE . "` WHERE DISPLAY_NAME = '$DISPLAY_NAME' AND ACCOUNT_TYPE = 'premium_account'"; $q = mysql_query( $query, $CON ) or die( "_error_" . mysql_error() ); if( mysql_num_rows( $q ) != 0 ) { }else{ mysql_close( $CON ); header("location: http://www.domainname.co.uk"); exit; } } I get a browser error: Firefox has detected that the server is redirecting the request for this address in a way that will never complete. I think its because when using header("location: http://www.domainname.co.uk"); it still puts the sub domain infront i.e. ; header("location: http://www.sub.domainname.co.uk"); Does anyone know how to sort this and/or what is the problem. Regards, Phil

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Django: Extending User Model - Inline User fields in UserProfile

    - by Jack Sparrow
    Is there a way to display User fields under a form that adds/edits a UserProfile model? I am extending default Django User model like this: class UserProfile(models.Model): user = models.OneToOneField(User, unique=True) about = models.TextField(blank=True) I know that it is possible to make a: class UserProfileInlineAdmin(admin.TabularInline): and then inline this in User ModelAdmin but I want to achieve the opposite effect, something like inverse inlining, displaying the fields of the model pointed by the OneToOne Relationship (User) in the page of the model defining the relationship (UserProfile). I don't care if it would be in the admin or in a custom view/template. I just need to know how to achieve this. I've been struggling with ModelForms and Formsets, I know the answer is somewhere there, but my little experience in Django doesn't allow me to come up with the solution yet. A little example would be really helpful!

    Read the article

  • Basic question in XSL regarding preceding text

    - by Rachel
    I am new to XSL and i have a basic question on the context of using preceding text. My template match is on the text node. I am iterating over an xml file and within my for loop i am trying to take the preceding text of the text node. Unfortunately preceding::text() is not working if i use it within a for loop. I want to use it within the for loop but how can do it? <xsl:template match="text()"> <xsl:variable name="this" as="text()" select="."/> <xsl:for-each select="$input[@id = generate-id(current())]"> <xsl:variable name="preText" as="xsd:integer" select="sum(preceding::text()[. >> //*[@id=@name]]/string-length(.))"/> ... ... </xsl:for-each> </xsl:template>

    Read the article

  • Why this C# Regular Expression crashes my program?

    - by robert_d
    using System; using System.IO; using System.Net; using System.Text.RegularExpressions; namespace Working { class Program4 { static string errorurl = "http://www.realtor.ca/propertyDetails.aspx?propertyId=8692663"; static void Main(string[] args) { string s; s = getWebpageContent(errorurl); s = removeNewLineCharacters(s); getFields(s); Console.WriteLine("End"); } public static void getFields(string html) { Match m; string fsRE = @"ismeasurement.*?>.*?(\d+).*?sqft"; m = Regex.Match(html, fsRE, RegexOptions.IgnoreCase); } private static string removeNewLineCharacters(string str) { string[] charsToRemove = new string[] { "\n", "\r" }; foreach (string c in charsToRemove) { str = str.Replace(c, ""); } return str; } static string getWebpageContent(string url) { WebClient client = new WebClient(); client.Headers.Add("user-agent", "Mozilla/4.0 (compatible; MSIE 6.0; Windows NT 5.2; .NET CLR 1.0.3705;)"); Stream data = client.OpenRead(url); StreamReader reader = new StreamReader(data); string s = reader.ReadToEnd(); data.Close(); reader.Close(); return s; } } } This program hangs. It runs correctly when I remove RegexOptions.IgnoreCase option or when I remove call to removeNewLineCharacters() function. Could someone tell me what is going on, please?

    Read the article

  • HTML, CSS: overbar matching square root symbol

    - by Pindatjuh
    Is there a way in HTML and/or CSS to do the following, but then correctly: √¯¯¯¯¯¯φ·(2π−γ) Such that there is an overbar above the expression, which neatly aligns with the &radic;? I know there is the Unicode &macr;, that looks like the overbar I need (as used in the above example, though as you can see – it doesn't align well with the root symbol). The solution I'm looking for works at least for one standard font, on most sizes, and all modern browsers. I can't use images; I'd like to have a pure HTML4/CSS way, without client scripting. Here is my current code, thank you Matthew Jones (+1) for the text-decoration: overline! Still some problems <div style="font-family: Georgia; font-size: 200%"> <span style="vertical-align: -15%;">&radic;</span><span style="text-decoration: overline;">&nbsp;x&nbsp;+&nbsp;1&nbsp;</span> </div> The line doesn't match the &radic; because I lowered it with 15% baseline height. (Because the default placement is not nice) The line thickness doesn't match the thickness of the &radic;. Thanks!

    Read the article

  • How to implement a collection (list, map?) of complicated strings in Java?

    - by Alex Cheng
    Hi all. I'm new here. Problem -- I have something like the following entries, 1000 of them: args1=msg args2=flow args3=content args4=depth args6=within ==> args5=content args1=msg args2=flow args3=content args4=depth args6=within args7=distance ==> args5=content args1=msg args2=flow args3=content args6=within ==> args5=content args1=msg args2=flow args3=content args6=within args7=distance ==> args5=content args1=msg args2=flow args3=flow ==> args4=flowbits args1=msg args2=flow args3=flow args5=content ==> args4=flowbits args1=msg args2=flow args3=flow args6=depth ==> args4=flowbits args1=msg args2=flow args3=flow args6=depth ==> args5=content args1=msg args2=flow args4=depth ==> args3=content args1=msg args2=flow args4=depth args5=content ==> args3=content args1=msg args2=flow args4=depth args5=content args6=within ==> args3=content args1=msg args2=flow args4=depth args5=content args6=within args7=distance ==> args3=content I'm doing some sort of suggestion method. Say, args1=msg args2=flow args3=flow == args4=flowbits If the sentence contains msg, flow, and another flow, then I should return the suggestion of flowbits. How can I go around doing it? I know I should scan (whenever a character is pressed on the textarea) a list or array for a match and return the result, but, 1000 entries, how should I implement it? I'm thinking of HashMap, but can I do something like this? <"msg,flow,flow","flowbits" Also, in a sentence the arguments might not be in order, so assuming that it's flow,flow,msg then I can't match anything in the HashMap as the key is "msg,flow,flow". What should I do in this case? Please help. Thanks a million!

    Read the article

  • Is there a better way to change user password in cakephp using Auth?

    - by sipiatti
    Hi, I am learning cakephp by myself. I tried to create a user controller with a changepassword function. It works, but I am not sure if this is the best way, and I could not googled up useful tutorials on this. Here is my code: class UsersController extends AppController { var $name = 'Users'; function login() { } function logout() { $this->redirect($this->Auth->logout()); } function changepassword() { $session=$this->Session->read(); $id=$session['Auth']['User']['id']; $user=$this->User->find('first',array('conditions' => array('id' => $id))); $this->set('user',$user); if (!empty($this->data)) { if ($this->Auth->password($this->data['User']['password'])==$user['User']['password']) { if ($this->data['User']['passwordn']==$this->data['User']['password2']) { // Passwords match, continue processing $data=$this->data; $this->data=$user; $this->data['User']['password']=$this->Auth->password($data['User']['passwordn']); $this->User->id=$id; $this->User->save($this->data); $this->Session->setFlash('Password changed.'); $this->redirect(array('controller'=>'Toners','action' => 'index')); } else { $this->Session->setFlash('New passwords differ.'); } } else { $this->Session->setFlash('Typed passwords did not match.'); } } } } password is the old password, passwordn is the new one, password2 is the new one retyped. Is there any other, more coomon way to do it in cake?

    Read the article

  • Uncommitted reads in SSIS

    - by OldBoy
    I'm trying to debug some legacy Integration Services code, and really want some confirmation on what I think the problem is: We have a very large data task inside a control flow container. This control flow container is set up with TransactionOption = supported - i.e. it will 'inherit' transactions from parent containers, but none are set up here. Inside the data flow there is a call to a stored proc that writes to a table with pseudo code something like: "If a record doesn't exist that matches these parameters then write it" Now, the issue is that there are three records being passed into this proc all with the same parameters, so logically the first record doesn't find a match and a record is created. The second record (with the same parameters) also doesn't find a match and another record is created. My understanding is that the first 'record' passed to the proc in the dataflow is uncommitted and therefore can't be 'read' by the second call. The upshot being that all three records create a row, when logically only the first should. In this scenario am I right in thinking that it is the uncommitted transaction that stops the second call from seeing the first? Even setting the isolation level on the container doesn't help because it's not being wrapped in a transaction anyway.... Hope that makes sense, and any advice gratefully received. Work-arounds confer god-like status on you.

    Read the article

  • Namespaced controller redirect urls

    - by bajki
    Hello, i have probably a simple question. I have created a namespace panel with categories controller. After creating or editing a category, rails redirects me to website.com/categories/:id instead of website.com/panel/categories/:id. I've noticed that in the _form view, the @panel_categories argument of form_for() function points to /categories nor /panel/categories and that's causing this behaviour. Offcourse i can add a :url => '/panel/categories' param but i feel that it's not the best solution... Can you provide me any better solution? Thanks in advance Files: routes.rb: Photowall::Application.routes.draw do resources :photos resources :categories resources :fields resources :users, :user_sessions match 'login' => 'user_sessions#new', :as => :login match 'logout' => 'user_sessions#destroy', :as => :logout namespace :panel do root :to => "photos#index" resources :users, :photos, :categories, :fields end namespace :admin do root :to => "users#index" resources :users, :photos, :categories, :fields end end categories_controller.rb: http://pastebin.com/rWJykCCF model is the default one form: http://pastebin.com/HGmkZZHM

    Read the article

  • custom helpers inside each block

    - by Unspecified
    myArray = [{name: "name1", age: 20}, {name: "name2", age:22}]; {{#each person in myArray}} {{#myHelper person}} Do something {{/myHelper}} {{/each}} Handlebars.registerHelper(function(context, options){ if(context.age > 18){ return options.fn(this); }else{ return options.inverse(this); } }) In the above code when I tried to debug my custom helper it shows the context="person" while I want the context to be the person object, what's wrong with my code ? I found a similar question here but did not get it either...

    Read the article

  • How to capture strings using * or ? with groups in python regular expressions

    - by user1334085
    When the regular expression has a capturing group followed by "*" or "?", there is no value captured. Instead if you use "+" for the same string, you can see the capture. I need to be able to capture the same value using "?" >>> str1='This string has 29 characters' >>> re.search(r'(\d+)*', str1).group(0) '' >>> re.search(r'(\d+)*', str1).group(1) >>> >>> re.search(r'(\d+)+', str1).group(0) '29' >>> re.search(r'(\d+)+', str1).group(1) '29' More specific question is added below for clarity: I have str1 and str2 below, and I want to use just one regexp which will match both. In case of str1, I also want to be able to capture the number of QSFP ports >>> str1='''4 48 48-port and 6 QSFP 10GigE Linecard 7548S-LC''' >>> str2='''4 48 48-port 10GigE Linecard 7548S-LC''' >>> When I do not use a metacharacter, the capture works: >>> re.search(r'^4\s+48\s+.*(?:(\d+)\s+QSFP).*-LC', str1, re.I|re.M).group(1) '6' >>> It works even when I use the "+" to indicate one occurrence: >>> re.search(r'^4\s+48\s+.*(?:(\d+)\s+QSFP)+.*-LC', str1, re.I|re.M).group(1) '6' >>> But when I use "?" to match for 0 or 1 occurrence, the capture fails even for str1: >>> re.search(r'^4\s+48\s+.*(?:(\d+)\s+QSFP)?.*-LC', str1, re.I|re.M).group(1) >>>

    Read the article

  • Filtering a select list via input box & jquery

    - by zSysop
    Hi all, I was wondering if i could get some help with filtering a select list using an input box via jquery. Here's what my js looks like, but it doesnt seem to work. I'm guessing this is because options within a select list are not hide-able. <script type="text/javascript"> $(document).ready(function() { $("#inputFilter").change(function() { var filter = $(this).val(); $("#selectList option").each(function() { var match = $(this).text().search(new RegExp(filter, "i")); if (match > 0) { $(this).show(); // Does not work } else $(this).hide(); }); }); }); </script> and here's my html <input id="inputFilter" /> <select id="selectList"> <option value="1111" text="1111 - London" /> <option value="1112" text="1111 - Paris" /> </select>

    Read the article

  • Recoverable error while running XSL

    - by Kate
    XSL: <?xml version="1.0" encoding="utf-8"?> <xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:ve="http://schemas.openxmlformats.org/markup-compatibility/2006" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:r="http://schemas.openxmlformats.org/officeDocument/2006/relationships" xmlns:m="http://schemas.openxmlformats.org/officeDocument/2006/math" xmlns:v="urn:schemas-microsoft-com:vml" xmlns:wp="http://schemas.openxmlformats.org/drawingml/2006/wordprocessingDrawing" xmlns:w10="urn:schemas-microsoft-com:office:word" xmlns:w="http://schemas.openxmlformats.org/wordprocessingml/2006/main" xmlns:wne="http://schemas.microsoft.com/office/word/2006/wordml" exclude-result-prefixes="wp wne w10 w ve o r m v" version="2.0"> <xsl:output method="text"/> <xsl:param name="styleName"/> <xsl:template match="w:p"> <xsl:apply-templates/><xsl:text>&#10;</xsl:text> </xsl:template> <xsl:template match="w:r[not ((parent::w:hyperlink[@w:anchor[matches(.,concat('^(',$styleName,')')),'i']]))]"> <xsl:value-of select="replace(., '.', '&#xFF00;')"/> </xsl:template> </xsl:stylesheet> While processing the above XSL, I am getting the below error, Recoverable Error: Recoverable error on line 11 FORG0006: An error occurred matching pattern {w:r[not ((parent::w:hyperlink[@w:anchor[matches(.,concat('^(',$styleName,')')),'i']]))]}: Effective boolean value is not defined for a sequence of two or more items starting with a boolean Please Help. I am not able to figure out this.

    Read the article

  • VST plugin : using FFT on audio input buffer with arbitrary size, how ?

    - by Led
    I'm getting interested in programming a VST plugin, and I have a basic knowledge of audio dsp's and FFT's. I'd like to use VST.Net, and I'm wondering how to implement an FFT-based effect. The process-code looks like public override void Process(VstAudioBuffer[] inChannels, VstAudioBuffer[] outChannels) If I'm correct, normally the FFT would be applied on the input, some processing would be done on the FFT'd data, and then an inverse-FFT would create the processed soundbuffer. But since the FFT works on a specified buffersize that will most probably be different then the (arbitrary) amount of input/output-samples, how would you handle this ?

    Read the article

  • Applying a function to a custom type in F#

    - by Frederik Wordenskjold
    On my journey to learning F#, I've run into a problem I cant solve. I have defined a custom type: type BinTree = | Node of int * BinTree * BinTree | Empty I have made a function which takes a tree, traverses it, and adds the elements it visits to a list, and returns it: let rec inOrder tree = seq{ match tree with | Node (data, left, right) -> yield! inOrder left yield data; yield! inOrder right | Empty -> () } |> Seq.to_list; Now I want to create a function, similar to this, which takes a tree and a function, traverses it and applies a function to each node, then returns the tree: mapInOrder : ('a -> 'b) -> 'a BinTree -> 'b BinTree This seems easy, and it probably is! But I'm not sure how to return the tree. I've tried this: let rec mapInOrder f tree = match tree with | Node(data, left, right) -> mapInOrder f left Node(f(data), left, right) mapInOrder f right | Empty -> () but this returns a unit. I havent worked with custom types before, so I'm probably missing something there!

    Read the article

  • Rounding a positive number to a power of another number

    - by Sagekilla
    I'm trying to round a number to the next smallest power of another number. The number I'm trying to round is always positive. I'm not particular on which direction it rounds, but I prefer downwards if possible. I would like to be able to round towards arbitrary bases, but the ones I'm most concerned with at the moment is base 2 and fractional powers of 2 like 2^(1/2), 2^(1/4), and so forth. Here's my current algorithm for base 2. The log2 I multiply by is actually the inverse of log2: double roundBaseTwo(double x) { return 1.0 / (1 << (int)((log(x) * log2)) } Any help would be appreciated!

    Read the article

  • Adding up fractions in PHP

    - by Gamemorize
    I would like to create a loop that keeps adding a set fraction, here in my example 1/3, and which later I can check against for matches with integer values. Obviously when php adds 1/3 + 1/3 + 1/3 the result is 0.9999999, so i thought I could use the occasional round to help me, but this isn't working either. The idea that I had would be that .333 + .333 becomes .666 and that if rounded that would become .667, then + .333 and the result is 1. However round only seems to work, for me, if the number of digits actually decreases. so round (0.666, 3) remains 0.666 <?php $denom = 3; $frac = 1/$denom; $frac = round($frac,3); $value = 0; $max =24; for($f = 1; $f <= $max; $f++){ echo "old value is now at ".$value.".<br/>"; $value = $value+$frac; echo "value is now at ".$value.".<br/>"; $value = round($value,3); echo "rounded value is now at ".$value.".<br/>"; $valueArray[$f] = $value; //and here for ease of testing.... if (($value==1)OR ($value==2)OR ($value==3)OR ($value==4)OR ($value==5)OR ($value==6)OR ($value==7)OR ($value==8)){ echo "match!<br/>"; }else{ echo "no match!<br/>"; } } ?> Am I going about this in a totally stupid way? Accuracy when the value is not an integer is not needed, just that it can == with integers.

    Read the article

  • Visual SourceSafe (VSS): "Access to file (filename) denied" error

    - by tk-421
    Hi, can anybody help with the above SourceSafe error? I've spent hours trying to find a fix. I've also Googled the heck out of it but couldn't find a scenario matching mine, because in my case only a few files (not all) are affected. Here's what I found: only a few files in my project generate this error other files in the same directory (for example, App_Code has one of the problem files) work fine I've tried checking out from both the VSS client and Visual Studio another developer can check out the main problem file without any problems This sounds like a permission issue for my user, right? However: I found the location of one of the problem files in VSS's data directory (using VSS's naming format, as in 'fddaaaaa.a') and checked its permissions; everything looks fine and its permissions match those of other files I can check out successfully I can see no differences in the file properties between working and non-working files What else can I check? Has anyone encountered this problem before and found a solution? Thanks. P.S.: SourceGear, svn or git are not options, unfortunately. P.P.S.: Tried unsuccessfully to add tag "sourcesafe." EDIT: Hey Paddy, I tried to click 'add comment' to respond to your comment, but I'm getting a javascript error when loading this page in IE8 ("jquery undefined," etc.) so this isn't working. This is when checking out files, and yes, I've obliterated my local copy more times than I can remember. ;) EDIT 2: Thanks for the responses, guys (again I can't 'add comment' due to jQuery not loading, maybe blocked as discussed in Meta). If the problem was caused by antivirus or a bad disk, would other users still be able to check out the file(s)? That's the case here, which makes me think it's a permission issue specific to my account. However I've looked at the permissions and they match both other users' settings and settings on other files which I can check out.

    Read the article

  • Help with a loop to return UIImage from possible matches

    - by Canada Dev
    I am parsing a list of locations and would like to return a UIImage with a flag based on these locations. I have a string with the location. This can be many different locations and I would like to search this string for possible matches in an NSArray, and when there's a match, it should find the appropriate filename in an NSDictionary. Here's an example of the NSDictionary and NSArray: NSDictionary *dict = [NSDictionary dictionaryWithObjectsAndKeys: @"franceFlag", @"france", @"greeceFlag", @"greece", @"spainFlag", @"spain", @"norwayFlag", @"norway", nil]; NSArray *array = [NSArray arrayWithObjects: @"france" @"greece" @"spain" @"portugal" @"ireland" @"norway", nil]; Obviously I'll have a lot more countries and flags in both. Here's what I have got to so far: -(UIImage *)flagFromOrigin:(NSString *)locationString { NSRange range; for (NSString *arrayString in countryArray) { range = [locationString rangeOfString:arrayString]; if (range.location != NSNotFound) { return [UIImage imageWithContentsOfFile:[[NSBundle mainBundle] pathForResource:[dictionary objectForKey: arrayString] ofType:@"png"]]; } } return nil; } Now, the above doesn't actually work. I am missing something (and perhaps not even doing it right in the first place) The issue is, the locationString could have several locations in the same country, described something like this "Barcelona, Spain", "Madrid, Spain", "North Spain", etc., but I just want to retrieve "Spain" in this case. (Also, notice caps for each country). Basically, I want to search the locationString I pass into the method for a possible match with one of the countries listed in the NSArray. If/When one is found, it should continue into the NSDictionary and grab the appropriate flag based on the correct matched string from the array. I believe the best way would then to take the string from the array, as this would be a stripped-out version of the location. Any help to point me in the right direction for the last bit is greatly appreciated.

    Read the article

< Previous Page | 88 89 90 91 92 93 94 95 96 97 98 99  | Next Page >