Search Results

Search found 7034 results on 282 pages for 'inverse match'.

Page 92/282 | < Previous Page | 88 89 90 91 92 93 94 95 96 97 98 99 | Next Page >

figuring out which field to look for a value in with SQL and perl

- by Micah

I'm not too good with SQL and I know there's probably a much more efficient way to accomplish what I'm doing here, so any help would be much appreciated. Thanks in advance for your input! I'm writing a short program for the local school high school. At this school, juniors and seniors who have driver's licenses and cars can opt to drive to school rather than ride the bus. Each driver is assigned exactly one space, and their DLN is used as the primary key of the driver's table. Makes, models, and colors of cars are stored in a separate cars table, related to the drivers table by the License plate number field. My idea is to have a single search box on the main GUI of the program where the school secretary can type in who/what she's looking for and pull up a list of results. Thing is, she could be typing a license plate number, a car color, make, and model, someone driver's name, some student driver's DLN, or a space number. As the programmer, I don't know what exactly she's looking for, so a couple of options come to mind for me to build to be certain I check everywhere for a match: 1) preform a couple of SELECT * FROM [tablename] SQL statements, one per table and cram the results into arrays in my program, then search across the arrays one element at a time with regex, looking for a matched pattern similar to the search term, and if I find one, add the entire record that had a match in it to a results array to display on screen at the end of the search. 2) take whatever she's looking for into the program as a scaler and prepare multiple select statements around it, such as SELECT * FROM DRIVERS WHERE DLN = $Search_Variable SELECT * FROM DRIVERS WHERE First_Name = $Search_Variable SELECT * FROM CARS WHERE LICENSE = $Search_Variable and so on for each attribute of each table, sticking the results into a results array to show on screen when the search is done. Is there a cleaner way to go about this lookup without having to make her specify exactly what she's looking for? Possibly some kind of SQL statement I've never seen before?

Read the article
perl - converting a date into a string

- by Jason

I need to convert a date to a string, the date is entered as 07/04/2010 and should then read July 4th 2010. It should also be able to be entered using singe digits instead of double (7 instead of 07, and it needs to add the 20 to the year if the user enters only /10) This is what I have so far - #!/usr/bin/perl use CGI qw(:standard); use strict; #declare variables my ($date, $month, $day, $year); my @months = ("January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December"); #assign input item to variable $date = param('Date'); #break date apart $date =~ /([0-9]{1,2})\/([0-9]{1,2})\/([0-9]{2,2}|20[0-9]{2,2})/; $month = $1; $day = $2; $year = $3; unless($year =~ /20[0-9]{2,2}/){ $year = "20".$year; } $date = $months[int($1)]." ".$day.", ".$year; #display date print "<HTML><HEAD><TITLE>The Date</TITLE></HEAD>\n"; print "<BODY>\n"; print "The date is: $date\n"; print "</BODY></HTML>\n"; However I keep getting errors Use of uninitialized value in pattern match (m//) at c08ex6.cgi line 14. Use of uninitialized value in pattern match (m//) at c08ex6.cgi line 18. Use of uninitialized value in concatenation (.) or string at c08ex6.cgi line 19. Use of uninitialized value in int at c08ex6.cgi line 21. Use of uninitialized value in concatenation (.) or string at c08ex6.cgi line 21.

Read the article
How to speed-up python nested loop?

- by erich

I'm performing a nested loop in python that is included below. This serves as a basic way of searching through existing financial time series and looking for periods in the time series that match certain characteristics. In this case there are two separate, equally sized, arrays representing the 'close' (i.e. the price of an asset) and the 'volume' (i.e. the amount of the asset that was exchanged over the period). For each period in time I would like to look forward at all future intervals with lengths between 1 and INTERVAL_LENGTH and see if any of those intervals have characteristics that match my search (in this case the ratio of the close values is greater than 1.0001 and less than 1.5 and the summed volume is greater than 100). My understanding is that one of the major reasons for the speedup when using NumPy is that the interpreter doesn't need to type-check the operands each time it evaluates something so long as you're operating on the array as a whole (e.g. numpy_array * 2), but obviously the code below is not taking advantage of that. Is there a way to replace the internal loop with some kind of window function which could result in a speedup, or any other way using numpy/scipy to speed this up substantially in native python? Alternatively, is there a better way to do this in general (e.g. will it be much faster to write this loop in C++ and use weave)? ARRAY_LENGTH = 500000 INTERVAL_LENGTH = 15 close = np.array( xrange(ARRAY_LENGTH) ) volume = np.array( xrange(ARRAY_LENGTH) ) close, volume = close.astype('float64'), volume.astype('float64') results = [] for i in xrange(len(close) - INTERVAL_LENGTH): for j in xrange(i+1, i+INTERVAL_LENGTH): ret = close[j] / close[i] vol = sum( volume[i+1:j+1] ) if ret > 1.0001 and ret < 1.5 and vol > 100: results.append( [i, j, ret, vol] ) print results

Read the article
Hibernate without primary keys generated by db?

- by Michael Jones

I'm building a data warehouse and want to use InfiniDB as the storage engine. However, it doesn't allow primary keys or foreign key constraints (or any constraints for that matter). Hibernate complains "The database returned no natively generated identity value" when I perform an insert. Each table is relational, and contains a unique integer column that was previously used as the primary key - I want to keep that, but just not have the constraint in the db that the column is the primary key. I'm assuming the problem is that Hibernate expects the db to return a generated key. Is it possible to override this behaviour so I can set the primary key field's value myself and keep Hibernate happy? -- edit -- Two of the mappings are as follows: <?xml version="1.0"?> <!DOCTYPE hibernate-mapping PUBLIC "-//Hibernate/Hibernate Mapping DTD 3.0//EN" "http://hibernate.sourceforge.net/hibernate-mapping-3.0.dtd">  <hibernate-mapping> <class name="com.example.project.Visitor" table="visitor" catalog="orwell"> <id name="id" type="java.lang.Long"> <column name="id" /> <generator class="identity" /> </id> <property name="firstSeen" type="timestamp"> <column name="first_seen" length="19" /> </property> <property name="lastSeen" type="timestamp"> <column name="last_seen" length="19" /> </property> <property name="sessionId" type="string"> <column name="session_id" length="26" unique="true" /> </property> <property name="userId" type="java.lang.Long"> <column name="user_id" /> </property> <set name="visits" inverse="true"> <key> <column name="visitor_id" /> </key> <one-to-many class="com.example.project.Visit" /> </set> </class> </hibernate-mapping> and: <?xml version="1.0"?> <!DOCTYPE hibernate-mapping PUBLIC "-//Hibernate/Hibernate Mapping DTD 3.0//EN" "http://hibernate.sourceforge.net/hibernate-mapping-3.0.dtd">  <hibernate-mapping> <class name="com.example.project.Visit" table="visit" catalog="orwell"> <id name="id" type="java.lang.Long"> <column name="id" /> <generator class="identity" /> </id> <many-to-one name="visitor" class="com.example.project.Visitor" fetch="join" cascade="all"> <column name="visitor_id" /> </many-to-one> <property name="visitId" type="string"> <column name="visit_id" length="20" unique="true" /> </property> <property name="startTime" type="timestamp"> <column name="start_time" length="19" /> </property> <property name="endTime" type="timestamp"> <column name="end_time" length="19" /> </property> <property name="userAgent" type="string"> <column name="user_agent" length="65535" /> </property> <set name="pageViews" inverse="true"> <key> <column name="visit_id" /> </key> <one-to-many class="com.example.project.PageView" /> </set> </class> </hibernate-mapping>

Read the article
How to handle this type of model validation in Ruby on Rails

- by randombits

I have a controller/model hypothetically named Pets. Pets has the following declarations: :belongs_to owner :has_many dogs :has_many cats Not the best example, but again, it demonstrates what I'm trying to solve. Now when a request comes in as an HTTP POST to http://127.0.0.1/pets, I want to create an instance of Pets. The restriction here is, if the user doesn't submit at least one dog or one cat, it should fail validation. It can have both, but it can't be missing both. How does one handle this in Ruby on Rails? Dogs don't care if cats exists and the inverse is also true. Can anyone show some example code of what the Pets model would look like to ensure that one or the other exists, or fail otherwise? errors.add also takes an attribute, in this case, there is no particular attribute that's failing. It's almost a 'virtual' combination that's missing.

Read the article
Django: Extending User Model - Inline User fields in UserProfile

- by Jack Sparrow

Is there a way to display User fields under a form that adds/edits a UserProfile model? I am extending default Django User model like this: class UserProfile(models.Model): user = models.OneToOneField(User, unique=True) about = models.TextField(blank=True) I know that it is possible to make a: class UserProfileInlineAdmin(admin.TabularInline): and then inline this in User ModelAdmin but I want to achieve the opposite effect, something like inverse inlining, displaying the fields of the model pointed by the OneToOne Relationship (User) in the page of the model defining the relationship (UserProfile). I don't care if it would be in the admin or in a custom view/template. I just need to know how to achieve this. I've been struggling with ModelForms and Formsets, I know the answer is somewhere there, but my little experience in Django doesn't allow me to come up with the solution yet. A little example would be really helpful!

Read the article
Basic question in XSL regarding preceding text

- by Rachel

I am new to XSL and i have a basic question on the context of using preceding text. My template match is on the text node. I am iterating over an xml file and within my for loop i am trying to take the preceding text of the text node. Unfortunately preceding::text() is not working if i use it within a for loop. I want to use it within the for loop but how can do it? <xsl:template match="text()"> <xsl:variable name="this" as="text()" select="."/> <xsl:for-each select="$input[@id = generate-id(current())]"> <xsl:variable name="preText" as="xsd:integer" select="sum(preceding::text()[. >> //*[@id=@name]]/string-length(.))"/> ... ... </xsl:for-each> </xsl:template>

Read the article
PHP - dynamic page via subdomain

- by Phil Jackson

Hi, im creating profile pages based on a subdomains using the wildcard DNS setting. Problem being, if the subdomain is incorrect, I want it to redirect to the same page but without the subdomain infront ie; if ( preg_match('/^(www\.)?([^.]+)\.domainname\.co.uk$/', $_SERVER['HTTP_HOST'], $match)) { $DISPLAY_NAME = $match[2]; $query = "SELECT * FROM `" . ACCOUNT_TABLE . "` WHERE DISPLAY_NAME = '$DISPLAY_NAME' AND ACCOUNT_TYPE = 'premium_account'"; $q = mysql_query( $query, $CON ) or die( "_error_" . mysql_error() ); if( mysql_num_rows( $q ) != 0 ) { }else{ mysql_close( $CON ); header("location: http://www.domainname.co.uk"); exit; } } I get a browser error: Firefox has detected that the server is redirecting the request for this address in a way that will never complete. I think its because when using header("location: http://www.domainname.co.uk"); it still puts the sub domain infront i.e. ; header("location: http://www.sub.domainname.co.uk"); Does anyone know how to sort this and/or what is the problem. Regards, Phil

Read the article
How to implement a collection (list, map?) of complicated strings in Java?

- by Alex Cheng

Hi all. I'm new here. Problem -- I have something like the following entries, 1000 of them: args1=msg args2=flow args3=content args4=depth args6=within ==> args5=content args1=msg args2=flow args3=content args4=depth args6=within args7=distance ==> args5=content args1=msg args2=flow args3=content args6=within ==> args5=content args1=msg args2=flow args3=content args6=within args7=distance ==> args5=content args1=msg args2=flow args3=flow ==> args4=flowbits args1=msg args2=flow args3=flow args5=content ==> args4=flowbits args1=msg args2=flow args3=flow args6=depth ==> args4=flowbits args1=msg args2=flow args3=flow args6=depth ==> args5=content args1=msg args2=flow args4=depth ==> args3=content args1=msg args2=flow args4=depth args5=content ==> args3=content args1=msg args2=flow args4=depth args5=content args6=within ==> args3=content args1=msg args2=flow args4=depth args5=content args6=within args7=distance ==> args3=content I'm doing some sort of suggestion method. Say, args1=msg args2=flow args3=flow == args4=flowbits If the sentence contains msg, flow, and another flow, then I should return the suggestion of flowbits. How can I go around doing it? I know I should scan (whenever a character is pressed on the textarea) a list or array for a match and return the result, but, 1000 entries, how should I implement it? I'm thinking of HashMap, but can I do something like this? <"msg,flow,flow","flowbits" Also, in a sentence the arguments might not be in order, so assuming that it's flow,flow,msg then I can't match anything in the HashMap as the key is "msg,flow,flow". What should I do in this case? Please help. Thanks a million!

Read the article
HTML, CSS: overbar matching square root symbol

- by Pindatjuh

Is there a way in HTML and/or CSS to do the following, but then correctly: √¯¯¯¯¯¯φ·(2π−γ) Such that there is an overbar above the expression, which neatly aligns with the √? I know there is the Unicode ¯, that looks like the overbar I need (as used in the above example, though as you can see – it doesn't align well with the root symbol). The solution I'm looking for works at least for one standard font, on most sizes, and all modern browsers. I can't use images; I'd like to have a pure HTML4/CSS way, without client scripting. Here is my current code, thank you Matthew Jones (+1) for the text-decoration: overline! Still some problems <div style="font-family: Georgia; font-size: 200%"> <span style="vertical-align: -15%;">√</span><span style="text-decoration: overline;"> x + 1 </span> </div> The line doesn't match the √ because I lowered it with 15% baseline height. (Because the default placement is not nice) The line thickness doesn't match the thickness of the √. Thanks!

Read the article
string comparision and counting the key in target [closed]

- by mesun

Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

Read the article
Why this C# Regular Expression crashes my program?

- by robert_d

using System; using System.IO; using System.Net; using System.Text.RegularExpressions; namespace Working { class Program4 { static string errorurl = "http://www.realtor.ca/propertyDetails.aspx?propertyId=8692663"; static void Main(string[] args) { string s; s = getWebpageContent(errorurl); s = removeNewLineCharacters(s); getFields(s); Console.WriteLine("End"); } public static void getFields(string html) { Match m; string fsRE = @"ismeasurement.*?>.*?(\d+).*?sqft"; m = Regex.Match(html, fsRE, RegexOptions.IgnoreCase); } private static string removeNewLineCharacters(string str) { string[] charsToRemove = new string[] { "\n", "\r" }; foreach (string c in charsToRemove) { str = str.Replace(c, ""); } return str; } static string getWebpageContent(string url) { WebClient client = new WebClient(); client.Headers.Add("user-agent", "Mozilla/4.0 (compatible; MSIE 6.0; Windows NT 5.2; .NET CLR 1.0.3705;)"); Stream data = client.OpenRead(url); StreamReader reader = new StreamReader(data); string s = reader.ReadToEnd(); data.Close(); reader.Close(); return s; } } } This program hangs. It runs correctly when I remove RegexOptions.IgnoreCase option or when I remove call to removeNewLineCharacters() function. Could someone tell me what is going on, please?

Read the article
Is there a better way to change user password in cakephp using Auth?

- by sipiatti

Hi, I am learning cakephp by myself. I tried to create a user controller with a changepassword function. It works, but I am not sure if this is the best way, and I could not googled up useful tutorials on this. Here is my code: class UsersController extends AppController { var $name = 'Users'; function login() { } function logout() { $this->redirect($this->Auth->logout()); } function changepassword() { $session=$this->Session->read(); $id=$session['Auth']['User']['id']; $user=$this->User->find('first',array('conditions' => array('id' => $id))); $this->set('user',$user); if (!empty($this->data)) { if ($this->Auth->password($this->data['User']['password'])==$user['User']['password']) { if ($this->data['User']['passwordn']==$this->data['User']['password2']) { // Passwords match, continue processing $data=$this->data; $this->data=$user; $this->data['User']['password']=$this->Auth->password($data['User']['passwordn']); $this->User->id=$id; $this->User->save($this->data); $this->Session->setFlash('Password changed.'); $this->redirect(array('controller'=>'Toners','action' => 'index')); } else { $this->Session->setFlash('New passwords differ.'); } } else { $this->Session->setFlash('Typed passwords did not match.'); } } } } password is the old password, passwordn is the new one, password2 is the new one retyped. Is there any other, more coomon way to do it in cake?

Read the article
Uncommitted reads in SSIS

- by OldBoy

I'm trying to debug some legacy Integration Services code, and really want some confirmation on what I think the problem is: We have a very large data task inside a control flow container. This control flow container is set up with TransactionOption = supported - i.e. it will 'inherit' transactions from parent containers, but none are set up here. Inside the data flow there is a call to a stored proc that writes to a table with pseudo code something like: "If a record doesn't exist that matches these parameters then write it" Now, the issue is that there are three records being passed into this proc all with the same parameters, so logically the first record doesn't find a match and a record is created. The second record (with the same parameters) also doesn't find a match and another record is created. My understanding is that the first 'record' passed to the proc in the dataflow is uncommitted and therefore can't be 'read' by the second call. The upshot being that all three records create a row, when logically only the first should. In this scenario am I right in thinking that it is the uncommitted transaction that stops the second call from seeing the first? Even setting the isolation level on the container doesn't help because it's not being wrapped in a transaction anyway.... Hope that makes sense, and any advice gratefully received. Work-arounds confer god-like status on you.

Read the article
How to capture strings using * or ? with groups in python regular expressions

- by user1334085

When the regular expression has a capturing group followed by "*" or "?", there is no value captured. Instead if you use "+" for the same string, you can see the capture. I need to be able to capture the same value using "?" >>> str1='This string has 29 characters' >>> re.search(r'(\d+)*', str1).group(0) '' >>> re.search(r'(\d+)*', str1).group(1) >>> >>> re.search(r'(\d+)+', str1).group(0) '29' >>> re.search(r'(\d+)+', str1).group(1) '29' More specific question is added below for clarity: I have str1 and str2 below, and I want to use just one regexp which will match both. In case of str1, I also want to be able to capture the number of QSFP ports >>> str1='''4 48 48-port and 6 QSFP 10GigE Linecard 7548S-LC''' >>> str2='''4 48 48-port 10GigE Linecard 7548S-LC''' >>> When I do not use a metacharacter, the capture works: >>> re.search(r'^4\s+48\s+.*(?:(\d+)\s+QSFP).*-LC', str1, re.I|re.M).group(1) '6' >>> It works even when I use the "+" to indicate one occurrence: >>> re.search(r'^4\s+48\s+.*(?:(\d+)\s+QSFP)+.*-LC', str1, re.I|re.M).group(1) '6' >>> But when I use "?" to match for 0 or 1 occurrence, the capture fails even for str1: >>> re.search(r'^4\s+48\s+.*(?:(\d+)\s+QSFP)?.*-LC', str1, re.I|re.M).group(1) >>>

Read the article
Namespaced controller redirect urls

- by bajki

Hello, i have probably a simple question. I have created a namespace panel with categories controller. After creating or editing a category, rails redirects me to website.com/categories/:id instead of website.com/panel/categories/:id. I've noticed that in the _form view, the @panel_categories argument of form_for() function points to /categories nor /panel/categories and that's causing this behaviour. Offcourse i can add a :url => '/panel/categories' param but i feel that it's not the best solution... Can you provide me any better solution? Thanks in advance Files: routes.rb: Photowall::Application.routes.draw do resources :photos resources :categories resources :fields resources :users, :user_sessions match 'login' => 'user_sessions#new', :as => :login match 'logout' => 'user_sessions#destroy', :as => :logout namespace :panel do root :to => "photos#index" resources :users, :photos, :categories, :fields end namespace :admin do root :to => "users#index" resources :users, :photos, :categories, :fields end end categories_controller.rb: http://pastebin.com/rWJykCCF model is the default one form: http://pastebin.com/HGmkZZHM

Read the article
custom helpers inside each block

- by Unspecified

myArray = [{name: "name1", age: 20}, {name: "name2", age:22}]; {{#each person in myArray}} {{#myHelper person}} Do something {{/myHelper}} {{/each}} Handlebars.registerHelper(function(context, options){ if(context.age > 18){ return options.fn(this); }else{ return options.inverse(this); } }) In the above code when I tried to debug my custom helper it shows the context="person" while I want the context to be the person object, what's wrong with my code ? I found a similar question here but did not get it either...

Read the article
Filtering a select list via input box & jquery

- by zSysop

Hi all, I was wondering if i could get some help with filtering a select list using an input box via jquery. Here's what my js looks like, but it doesnt seem to work. I'm guessing this is because options within a select list are not hide-able. <script type="text/javascript"> $(document).ready(function() { $("#inputFilter").change(function() { var filter = $(this).val(); $("#selectList option").each(function() { var match = $(this).text().search(new RegExp(filter, "i")); if (match > 0) { $(this).show(); // Does not work } else $(this).hide(); }); }); }); </script> and here's my html <input id="inputFilter" /> <select id="selectList"> <option value="1111" text="1111 - London" /> <option value="1112" text="1111 - Paris" /> </select>

Read the article
VST plugin : using FFT on audio input buffer with arbitrary size, how ?

- by Led

I'm getting interested in programming a VST plugin, and I have a basic knowledge of audio dsp's and FFT's. I'd like to use VST.Net, and I'm wondering how to implement an FFT-based effect. The process-code looks like public override void Process(VstAudioBuffer[] inChannels, VstAudioBuffer[] outChannels) If I'm correct, normally the FFT would be applied on the input, some processing would be done on the FFT'd data, and then an inverse-FFT would create the processed soundbuffer. But since the FFT works on a specified buffersize that will most probably be different then the (arbitrary) amount of input/output-samples, how would you handle this ?

Read the article
Recoverable error while running XSL

- by Kate

XSL: <?xml version="1.0" encoding="utf-8"?> <xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:ve="http://schemas.openxmlformats.org/markup-compatibility/2006" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:r="http://schemas.openxmlformats.org/officeDocument/2006/relationships" xmlns:m="http://schemas.openxmlformats.org/officeDocument/2006/math" xmlns:v="urn:schemas-microsoft-com:vml" xmlns:wp="http://schemas.openxmlformats.org/drawingml/2006/wordprocessingDrawing" xmlns:w10="urn:schemas-microsoft-com:office:word" xmlns:w="http://schemas.openxmlformats.org/wordprocessingml/2006/main" xmlns:wne="http://schemas.microsoft.com/office/word/2006/wordml" exclude-result-prefixes="wp wne w10 w ve o r m v" version="2.0"> <xsl:output method="text"/> <xsl:param name="styleName"/> <xsl:template match="w:p"> <xsl:apply-templates/><xsl:text>
</xsl:text> </xsl:template> <xsl:template match="w:r[not ((parent::w:hyperlink[@w:anchor[matches(.,concat('^(',$styleName,')')),'i']]))]"> <xsl:value-of select="replace(., '.', '＀')"/> </xsl:template> </xsl:stylesheet> While processing the above XSL, I am getting the below error, Recoverable Error: Recoverable error on line 11 FORG0006: An error occurred matching pattern {w:r[not ((parent::w:hyperlink[@w:anchor[matches(.,concat('^(',$styleName,')')),'i']]))]}: Effective boolean value is not defined for a sequence of two or more items starting with a boolean Please Help. I am not able to figure out this.

Read the article
Visual SourceSafe (VSS): "Access to file (filename) denied" error

- by tk-421

Hi, can anybody help with the above SourceSafe error? I've spent hours trying to find a fix. I've also Googled the heck out of it but couldn't find a scenario matching mine, because in my case only a few files (not all) are affected. Here's what I found: only a few files in my project generate this error other files in the same directory (for example, App_Code has one of the problem files) work fine I've tried checking out from both the VSS client and Visual Studio another developer can check out the main problem file without any problems This sounds like a permission issue for my user, right? However: I found the location of one of the problem files in VSS's data directory (using VSS's naming format, as in 'fddaaaaa.a') and checked its permissions; everything looks fine and its permissions match those of other files I can check out successfully I can see no differences in the file properties between working and non-working files What else can I check? Has anyone encountered this problem before and found a solution? Thanks. P.S.: SourceGear, svn or git are not options, unfortunately. P.P.S.: Tried unsuccessfully to add tag "sourcesafe." EDIT: Hey Paddy, I tried to click 'add comment' to respond to your comment, but I'm getting a javascript error when loading this page in IE8 ("jquery undefined," etc.) so this isn't working. This is when checking out files, and yes, I've obliterated my local copy more times than I can remember. ;) EDIT 2: Thanks for the responses, guys (again I can't 'add comment' due to jQuery not loading, maybe blocked as discussed in Meta). If the problem was caused by antivirus or a bad disk, would other users still be able to check out the file(s)? That's the case here, which makes me think it's a permission issue specific to my account. However I've looked at the permissions and they match both other users' settings and settings on other files which I can check out.

Read the article
Rounding a positive number to a power of another number

- by Sagekilla

I'm trying to round a number to the next smallest power of another number. The number I'm trying to round is always positive. I'm not particular on which direction it rounds, but I prefer downwards if possible. I would like to be able to round towards arbitrary bases, but the ones I'm most concerned with at the moment is base 2 and fractional powers of 2 like 2^(1/2), 2^(1/4), and so forth. Here's my current algorithm for base 2. The log2 I multiply by is actually the inverse of log2: double roundBaseTwo(double x) { return 1.0 / (1 << (int)((log(x) * log2)) } Any help would be appreciated!

Read the article
C# comparing two files regex problem.

- by Mike

Hi everyone, what I'm trying to do is open a huge list of files (about 40k records, and match them on a line in a file that contains 2 millions records. And if my line from file A matches a line in file B write out that line. File A contains a bunch of files without extensions and file B contains full file paths including extensions. i'm using this but i cant get it to go... string alphaFilePath = (@"C:\Documents and Settings\g\Desktop\Arrp\Find\natst_ready.txt"); List<string> alphaFileContent = new List<string>(); using (FileStream fs = new FileStream(alphaFilePath, FileMode.Open)) using (StreamReader rdr = new StreamReader(fs)) { while (!rdr.EndOfStream) { alphaFileContent.Add(rdr.ReadLine()); } } string betaFilePath = @"C:\Documents and Settings\g\Desktop\Arryup\Find\eble.txt"; StringBuilder sb = new StringBuilder(); using (FileStream fs = new FileStream(betaFilePath, FileMode.Open)) using (StreamReader rdr = new StreamReader(fs)) { while (!rdr.EndOfStream) { string betaFileLine = rdr.ReadLine(); string matchup = Regex.Match(alphaFileContent, @"(\\)(\\)(\\)(\\)(\\)(\\)(\\)(\\)(.*)(\.)").Groups[9].Value; if (alphaFileContent.Equals(matchup)) { File.AppendAllText(@"C:\array_tech.txt", betaFileLine); } } } This doesnt work because the alphafilecontent is a single line only and i'm having a hard time figuring out how to get my regex to work on the file that contains all the file paths (Betafilepath) here is a sample of the beta file path. C:\arres_i\Grn\Ora\SEC\DBZ_EX1\Nes\001\DZO-EX00001.txt Here is the line i'm trying to compare from my alpha DZO-EX00001

Read the article
Applying a function to a custom type in F#

- by Frederik Wordenskjold

On my journey to learning F#, I've run into a problem I cant solve. I have defined a custom type: type BinTree = | Node of int * BinTree * BinTree | Empty I have made a function which takes a tree, traverses it, and adds the elements it visits to a list, and returns it: let rec inOrder tree = seq{ match tree with | Node (data, left, right) -> yield! inOrder left yield data; yield! inOrder right | Empty -> () } |> Seq.to_list; Now I want to create a function, similar to this, which takes a tree and a function, traverses it and applies a function to each node, then returns the tree: mapInOrder : ('a -> 'b) -> 'a BinTree -> 'b BinTree This seems easy, and it probably is! But I'm not sure how to return the tree. I've tried this: let rec mapInOrder f tree = match tree with | Node(data, left, right) -> mapInOrder f left Node(f(data), left, right) mapInOrder f right | Empty -> () but this returns a unit. I havent worked with custom types before, so I'm probably missing something there!

Read the article
compact XSLT code to drop N number of tags if all are null.

- by infant programmer

This is my input xml: <root> <node1/> <node2/> <node3/> <node4/> <othertags/> </root> The output must be: <root> <othertags/> </root> if any of the 4 nodes isn't null then none of the tags must be dropped. example: <root> <node1/> <node2/> <node3/> <node4>sample_text</node4> <othertags/> </root> Then the output must be same as input xml. <root> <node1/> <node2/> <node3/> <node4>sample_text</node4> <othertags/> </root> This is the XSL code I have designed :: <xsl:template match="@*|node()"> <xsl:copy> <xsl:apply-templates select="@*|node()"/> </xsl:copy> </xsl:template> <xsl:template match="/root/node1[.='' and ../node2/.='' and ../node3/.='' and ../node4/.=''] |/root/node2[.='' and ../node1/.='' and ../node3/.='' and ../node4/.=''] |/root/node3[.='' and ../node1/.='' and ../node2/.='' and ../node4/.=''] |/root/node4[.='' and ../node1/.='' and ../node2/.='' and ../node3/.='']"/> As you can see the code requires more effort and becomes more bulky as the number of nodes increase. Is there any alternative way to overcome this bottleneck?

Read the article

< Previous Page | 88 89 90 91 92 93 94 95 96 97 98 99 | Next Page >