Search Results

Search found 2736 results on 110 pages for 'semantic meaning'.

Page 93/110 | < Previous Page | 89 90 91 92 93 94 95 96 97 98 99 100  | Next Page >

  • gl_FragColor and glReadPixels

    - by chun0216
    I am still trying to read pixels from fragment shader and I have some questions. I know that gl_FragColor returns with vec4 meaning RGBA, 4 channels. After that, I am using glReadPixels to read FBO and write it in data GLubyte *pixels = new GLubyte[640*480*4]; glReadPixels(0, 0, 640,480, GL_RGBA, GL_UNSIGNED_BYTE, pixels); This works fine but it really has speed issue. Instead of this, I want to just read RGB so ignore alpha channels. I tried: GLubyte *pixels = new GLubyte[640*480*3]; glReadPixels(0, 0, 640,480, GL_RGB, GL_UNSIGNED_BYTE, pixels); instead and this didn't work though. I guess it's because gl_FragColor returns 4 channels and maybe I should do something before this? Actually, since my returned image (gl_FragColor) is grayscale, I did something like float gray = 0.5 //or some other values gl_FragColor = vec4(gray,gray,gray,1.0); So is there any efficient way to use glReadPixels instead of using the first 4 channels method? Any suggestion? By the way, this is on opengl es 2.0 code.

    Read the article

  • correct way of initializing variables

    - by OVERTONE
    ok this is just a shot in the dark but it may be the cause of most of the errors ive gotten. when your initializing something. lets say a smal swing program. would it go liek this variables here { private Jlist contactList; String [] contactArray; ArrayList <String> contactArrayList; ResultSet namesList constructor here public whatever() { GridLayout aGrid = new GridLayout(2,2,10,10); contact1 = new String(); contact2 = new String(); contact3 = new String(); contactArrayList = new ArrayList<String>(); // is something supposed too go in the () of this JList? contactList = new JList(); contactArray = new String[5]; from1 =new JLabel ("From: " + contactArray[1]); gridlayout.add(components)// theres too many components to write onto SO. } // methods here public void fillContactsGui() { createConnection(); ArrayList<String> contactsArrayList = new ArrayList<String>(); while (namesList.next()) { contactArrayList.add(namesList.getString(1)); ContactArray[1] = namesList[1]; } } i know this is probably a huge beginner question but this is the code ive gotten used too. im initializing thigns three and fours times without meaning too because im not sure where they gp. can anyone shed some light on this? p.s. sorry for the messy sample code. i done my best.

    Read the article

  • 2D platformer gravity physics with slow-motion

    - by DD
    Hi all, I fine tuned my 2d platformer physics and when I added slow-motion I realized that it is messed up. The problem I have is that for some reason the physics still depends on framerate. So when I scale down time elapsed, every force is scaled down as well. So the jump force is scaled down, meaning in slow-motion, character jumps vertically smaller height and gravity force is scaled down as well so the character goes further in the air without falling. I'm sending update function in hopes that someone can help me out here (I separated vertical (jump, gravity) and walking (arbitrary walking direction on a platform - platforms can be of any angle) vectors): characterUpdate:(float)dt { //Compute walking velocity walkingAcceleration = direction of platform * walking acceleration constant * dt; initialWalkingVelocity = walkingVelocity; if( isWalking ) { if( !isJumping ) walkingVelocity = walkingVelocity + walkingAcceleration; else walkingVelocity = walkingVelocity + Vector( walking acceleration constant * dt, 0 ); } // Compute jump/fall velocity if( !isOnPlatform ) { initialVerticalVelocity = verticalVelocity; verticalVelocity = verticalVelocity + verticalAcceleration * dt; } // Add walking velocity position = position + ( walkingVelocity + initialWalkingVelocity ) * 0.5 * dt; //Add jump/fall velocity if not on a platform if( !isOnPlatform ) position = position + ( verticalVelocity + initialVerticalVelocity ) * 0.5 * dt; verticalAcceleration.y = Gravity * dt; }

    Read the article

  • EditText items in a scrolling list lose their changes when scrolled off the screen

    - by ianww
    I have a long scrolling list of EditText items created by a SimpleCursorAdapter and prepopulated with values from an SQLite database. I make this by: cursor = db.rawQuery("SELECT _id, criterion, localweight, globalweight FROM " + dbTableName + " ORDER BY criterion", null); startManagingCursor(cursor); mAdapter = new SimpleCursorAdapter(this, R.layout.weight_edit_items, cursor, new String[]{"criterion","localweight","globalweight"}, new int[]{R.id.criterion_edit, R.id.localweight_edit, R.id.globalweight_edit}); this.setListAdapter(mAdapter); The scrolling list is several emulator screens long. The items display OK - scrolling through them shows that each has the correct value from the database. I can make an edit change to any of the EditTexts and the new text is accepted and displayed in the box. But...if I then scroll the list far enough to take the edited item off the screen, when I scroll back to look at it again its value has returned to what it was before I made the changes, ie. my edits have been lost. In trying to sort this out, I've done a getText to look at what's in the EditText after I've done my edits (and before a scroll) and getText returns the original text, even though the EditText is displaying my new text. It seems that the EditText has only accepted my edits superficially and they haven't been bound to the EditText, meaning they get dropped when scrolled off the screen. Can anyone please tell me what's going on here and what I need to do to force the EditText to retain its edits? Thanks Ian

    Read the article

  • How do I avoid having JSONP returns cached in an HTML5 offline application?

    - by Kent Brewster
    I had good luck with cached offline apps until I tried including data from JSONP endpoints. Here's a tiny example, which loads a single movie from the new Netflix widget API: <!DOCTYPE html> <html manifest="main.manifest"> <head> <title>Testing!</title> </head> <body> <p>Attempting to recover a title from Netflix now...</p> <script type="text/javascript"> function ping(r) { alert('API reply: ' + r.catalog_title.title.regular); } var cb = new Date().getTime(); var s = document.createElement('SCRIPT'); s.src = 'http://movi.es/7Soq?v=2.0&output=json&expand=widget&callback=ping&cacheBuster=' + cb; alert('SCRIPT src: ' + s.src); s.type = 'text/javascript'; document.getElementsByTagName('BODY')[0].appendChild(s); </script> </body> </html> ... and here's the contents of my manifest, main.manifest, which contains no files and is only there so my browser knows to cache the calling HTML file. CACHE MANIFEST Yes, I've confirmed that my server is sending the manifest down with the correct content type, text/cache-manifest. The app works fine--meaning both alerts show--the first time I run it, but subsequent runs, even with the attempt at cache-busting in line 10, seem to be attempting to load the script from cache no matter what the query string is. I see the alert showing the script source, but the callback never fires. If I remove the manifest link from line 2 and reset my browser--being Safari and the iPhone Simulator--to clear cache, it works every time. I've also tried alerting the number of SCRIPT tags in the page, and it's definitely seeing both the existing and dynamically-created tag in all cases.

    Read the article

  • Generic validate input data via regex. Input error when match.count == 0

    - by Valamas
    Hi, I have a number of types of data fields on an input form, for example, a web page. Some fields are like, must be an email address, must be a number, must be a number between, must have certain characters. Basically, the list is undefinable. I wish to come up with a generic way of validating the data inputed. I thought I would use regex to validate the data. The fields which need validation would be related to a "regex expression" and a "regex error message" stating what the field should contain. My current mock up has that when the match count is zero, that would signify an error and to display the message. While still a white belt regex designer I have come to understand that in certain situations that it is difficult to write a regex which results in a match count of zero for every case. A complex regex case I looked for help on was Link Here. The forum post was a disaster because I confused people helping me. But one of the statements said that it was difficult to make a regex with a match count of zero meaning the input data was invalid; that the regex was very difficult to write that for. Does anyone have comments or suggestions on this generic validation system I am trying to create? thanks

    Read the article

  • Spring MVC: How to get the remaining path after the controller path?

    - by Willis Blackburn
    I've spent over an hour trying to find the answer to this question, which seems like it should reflect a common use case, but I can't figure it out! Basically I am writing a file-serving controller using Spring MVC. The URLs are of the format http://www.bighost.com/serve/the/path/to/the/file.jpg, in which the part after "/serve" is the path to the requested file, which may have an arbitrary number of path segments. I have a controller like this: @Controller class ServerController { @RequestMapping(value = "/serve/???") public void serve(???) { } } What I am trying to figure out is: What do I use in place of "???" to make this work? I have two theories about how this should work. The first theory is that I could replace the first "???" in the RequestMapping with a path variable placeholder that has some special syntax meaning "capture to the end of the path." If a regular placeholder looks like "{path}" then maybe I could use "{path:**}" or "{path:/}" or something like that. Then I could use a @PathVariable annotation to refer to the path variable in the second "???". The other theory is that I could replace the first "???" with "**" (match anything) and that Spring would give me an API to obtain the remainder of the path (the part matching the "**"). But I can't find such an API. Thanks for any help you can provide!

    Read the article

  • Should we retire the term "Context"?

    - by MrGumbe
    I'm not sure if there is a more abused term in the world of programming than "Context." A word that has a very clear meaning in the English language has somehow morphed into a hot mess in software development, where the definition where the connotation can be completely different based on what library you happen to be developing in. Tomcat uses the word context to mean the configuration of a web application. Java applets, on the other hand, use an AppletContext to define attributes of the browser and HTML tag that launched it, but the BeanContext is defined as a container. ASP.NET uses the HttpContext object as a grab bag of state - containing information about the current request / response, session, user, server, and application objects. Context Oriented Programming defines the term as "Any information which is computationally accessible may form part of the context upon which behavioral variations depend," which I translate as "anything in the world." The innards of the Windows OS uses the CONTEXT structure to define properties about the hardware environment. The .NET installation classes, however, use the InstallContext property to represent the command line arguments entered to the installation class. The above doesn't even touch how all of us non-framework developers have used the term. I've seen plenty of developers fall into the subconscious trap of "I can't think of anything else to call this class, so I'll name it 'WidgetContext.'" Do you all agree that before naming our class a "Context," we may want to first consider some more descriptive terms? "Environment", "Configuraton", and "ExecutionState" come readily to mind.

    Read the article

  • MACRO compilation PROBLEM

    - by wildfly
    i was given a primitive task to find out (and to put in cl) how many nums in an array are bigger than the following ones, (meaning if (arr[i] arr[i+1]) count++;) but i've problems as it has to be a macro. i am getting errors from TASM. can someone give me a pointer? SortA macro a, l LOCAL noes irp reg, <si,di,bx> push reg endm xor bx,bx xor si,si rept l-1 ;;also tried rept 3 : wont' compile mov bl,a[si] inc si cmp bl,arr[si] jb noes inc di noes: add di,0 endm mov cx,di irp reg2, <bx,di,si> pop reg2 endm endm dseg segment arr db 10,9,8,7 len = 4 dseg ends sseg segment stack dw 100 dup (?) sseg ends cseg segment assume ds:dseg, ss:sseg, cs:cseg start: mov ax, dseg mov ds,ax sortA arr,len cseg ends end start errors: Assembling file: sorta.asm **Error** sorta.asm(51) REPT(4) Expecting pointer type **Error** sorta.asm(51) REPT(6) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(10) Expecting pointer type **Error** sorta.asm(51) REPT(12) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(16) Expecting pointer type **Error** sorta.asm(51) REPT(18) Symbol already different kind: NOES Error messages: 6

    Read the article

  • C++: defining maximum/minimum limits for a class

    - by Luis
    Basically what the title says... I have created a class that models time slots in a variable-granularity daily schedule (where for example the first time slot is 30 minutes, but the second time slot can be 40 minutes); the first available slot starts at (a value comparable to) 1. What I want to do now is to define somehow the maximum and minimum allowable values that this class takes and I have two practical questions in order to do so: 1.- does it make sense to define absolute minimum and maximum in such a way for a custom class? Or better, does it suffice that a value always compares as lower-than any other possible value of the type, given the class's defined relational operators, to be defined the min? (and analogusly for the max) 2.- assuming the previous question has an answer modeled after "yes" (or "yes but ..."), how do I define such max/min? I know that there is std::numeric_limits<> but from what I read it is intended for "numeric types". Do I interpret that as meaning "represented as a number" or can I make a broader assumption like "represented with numbers" or "having a correspondence to integers"? After all, it would make sense to define the minimum and maximum for a date class, and maybe for a dictionary class, but numeric_limits may not be intended for those uses (I don't have much experience with it). Plus, numeric_limits has a lot of extra members and information that I don't know what to make with. If I don't use numeric_limits, what other well-known / widely-used mechanism does C++ offer to indicate the available range of values for a class?

    Read the article

  • problem with two key ranges in couchdb

    - by Duasto
    I'm having problem getting the right results in my coordinate system. To explain my system, I have this simple database that have x_axis, y_axis and name columns. I don't need to get all the data, I just need to display some part of it. For example, I have a coordinate system that have 10:10(meaning from x_axis -10 to 10 and from y_axis -10 to 10) and I want to display only 49 coordinates. In sql query I can do it something like this: "select * from coordinate where x_axis = -3 and x_axis <= 3 and y_axis = -3 y_axis <= 3" I tried this function but no success: "by_range": { "map": "function(doc) { emit([doc.x_axis, doc.y_axis], doc) }" } by_range?startkey=[-3,-3]&endkey=[3,3] I got a wrong results of: -3x-3 -3x-2 -3x-1 -3x0 -3x1 -3x2 -3x3 <-- should not display this part -- -3x4 -3x5 -3x6 -3x7 -3x8 -3x9 -3x10 <-- end of should not display this part -- ..... up to 3x3 to give you a better understanding of my project here is the screenshot of that I want to be made: Oops they don't allowed new poster to post an image img96(dot)imageshack(dot)us/img96/5382/coordinates(dot)jpg <<< just change the "(dot)" to "."

    Read the article

  • How to refresh jQuery Selector Value after an execution?

    - by Devyn
    Hi, I have like this. $(document).ready(function() { var $clickable_pieces = $('.chess_piece').parent(); $($clickable_pieces).addClass('selectee'); // add selectee class var $selectee = $('.chess_square.selectee'); // wait for click $($selectee).bind('click',function(){ $('.chess_square.selected').removeClass('selected'); $(this).addClass('selected'); { ........... } }); I initially inject 'selectee' class to all div which has 'chess_piece' class then I select DIVs with that class $('.chess_square.selectee'). <div id="clickable"> <div id="div1" class="chess_square"> </div> <div id="div2" class="chess_square selectee"> <div id="sub1" class="chess_piece queen"></div> </div> <div id="div3" class="chess_square"> </div> </div> There are two type of DIV element with class named 'chess_square selectee' and 'chess_square' which doesn't meant to be clickable. I move around Sub DIV of 'rps_square selectee' from DIV2 to DIV1 and add and remove classes to be exactly same like this. The meaning is Queen Piece is moved from Div2 to Div1. <div id="div1" class="chess_square selectee"> <div id="sub1" class="chess_piece queen"></div> </div> <div id="div2" class="chess_square"> </div> <div id="div3" class="chess_square"> </div> However, the problem is jQuery doesn't update var $selectee = $('.rps_square.selectee');. Even though I changed class names, DIV1 is not clickable and DIV2 is still clickable. By the way, I've used jQuery UI selectable but doesn't refresh either.

    Read the article

  • Total Average Week using a Parameter

    - by Jose
    I have a crystal report that shows sales volumes called week to date volume. It shows current week, previous week, and average week. The report prompts for a date parameter and I extract the week number to get current week and previous week volumes. Did it this way because Mngmt wants to be able to run report whenever. My problem is for Average Week I cant figure out how to get the number of weeks to divide by for my average. Report originates from June 1st, 2010. Right now I have: DATEPART("ww", {?date}) - DATEPART("ww", DATE(2010, 6, 1)) This returns 2 right now which is perfect, so i divide my total by 2. This code will work until the end of the year then I'm hooped. Any idea how I can make this a little more dynamic. I was thinking a counter somehow, just can't get the logic down because the date parameter will keep changing, meaning I cant increase my counter by 1 after each week??? Cheers.

    Read the article

  • Command or tool to display list of connections to a Windows file share

    - by BizTalkMama
    Is there a Windows command or tool that can tell me what users or computers are connected to a Windows fileshare? Here's why I'm looking for this: I've run into issues in the past where our deployment team has deployed BizTalk applications to one of our environments using the wrong bindings, leaving us with two receive locations pointing to the same file share (i.e. both dev and test servers point to dev receive location uri). When this occurs, the two environments in question tend to take turns processing the files received (meaning if I am attempting to debug something in one environment and the other environment has picked the file up, it looks as if my test file has disappeared into thin air). We have several different environments, plus individual developer machines, and I'd rather not have to check each individually to find the culprit. I'm looking for a quick way to detect what locations are connected to the share once I notice my test files vanishing. If I can determine the connections that are invalid, I can go directly to the person responsible for that environment and avoid the time it takes to randomly ask around. Or if the connections appear to be correct, I can go directly to troubleshooting where in the process the message gets lost. Any suggestions?

    Read the article

  • .NET HttpModule does not send form variables to PHP file on RewritePath()

    - by jammus
    Hello friends. We have an application running on IIS 6 which uses a custom HttpModule to rewrite urls. This works great (well done us) except in the case where the Context.RewritePath destination is a .php file. The php file is executed as expected, however the $_POST collection is empty meaning it cannot access any forms which are submitted to rewritten urls. The problem does not exist when rewriting to .aspx files as the Request.Form collection is fine. My question therefore has two parts: Why is the $_POST collection not being populated? Is there a way to ensure that the .php $_POST collection is correctly populated after a rewrite? I don't have much to show in the way of code. There's just a simple: context.RewritePath(newPath); once the HttpModule has figured out where to send the request. Edit: Interestingly, if I do var_dump(file_get_contents('php://input')); in the PHP file (method described here) the contents of the form is displayed. So the data is reaching the PHP script but not the $_POST array.

    Read the article

  • How to check if a number is a power of 2

    - by configurator
    Today I needed a simple algorithm for checking if a number is a power of 2. The algorithm needs to be: Simple Correct for any ulong value. I came up with this simple algorithm: private bool IsPowerOfTwo(ulong number) { if (number == 0) return false; for (ulong power = 1; power > 0; power = power << 1) { // this for loop used shifting for powers of 2, meaning // that the value will become 0 after the last shift // (from binary 1000...0000 to 0000...0000) then, the for // loop will break out if (power == number) return true; if (power > number) return false; } return false; } But then I thought, how about checking if log2x is an exactly round number? But when I checked for 2^63+1, Math.Log returned exactly 63 because of rounding. So I checked if 2 to the power 63 is equal to the original number - and it is, because the calculation is done in doubles and not in exact numbers: private bool IsPowerOfTwo_2(ulong number) { double log = Math.Log(number, 2); double pow = Math.Pow(2, Math.Round(log)); return pow == number; } This returned true for the given wrong value: 9223372036854775809. Does anyone have any suggestion for a better algorithm?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Apache mod_rewrite - forward domain root to subdirectory

    - by DuFace
    I have what I originally assumed to be a simple problem. I am using shared hosting for my website (so I don't have access to the Apache configuration) and have only been given a single folder to store all my content in. This is all well and good but it means that all my subdomains must have their virtual document root's inside public_html, meaning they effectively become a folder on my main domain. What I'd like to do is organise my public_html something like this: public_html/ www/ index.php ... sub1/ index.php ... some_library/ ... This way, all my web content is still in public_html but only a small fraction of it will be served to the client. I can easily achieve this for all the subdomains, but it's the primary domain that I'm having issues with. I created a .htaccess file in public_html with the following: Options +SymLinksIfOwnerMatch # I'm not allowed to use FollowSymLinks RewriteEngine on RewriteBase / RewriteCond %{REQUEST_URI} !^/www [NC] RewriteRule ^(.*)$ /www/$1 [L] This works fairly well, but for some strange reason www.example.com/stuff is translated into a request for www.example.com/www/stuff and hence a 404 error is given. It was my understanding that unless an 'R' flag was specified, mod_rewrite was purely internal so I can't understand why the request is generated as that implies (to me at least) redirection. I assumed this would be a trivial problem to solve as all I actually want to do is forward all requests for the root of www.example.com to a subdirectory, but I've spent hours searching for answers and none are quite correct. I find it difficult to believe I'm the only person to have this issue. I apologise if this question has been answered on here before, I did search and trawl but couldn't find an appropriate answer. Please could someone shed some light on this?

    Read the article

  • What to call factory-like (java) methods used with immutable objects

    - by StaxMan
    When creating classes for "immutable objects" immutable meaning that state of instances can not be changed; all fields assigned in constructor) in Java (and similar languages), it is sometimes useful to still allow creation of modified instances. That is, using an instance as base, and creating a new instance that differs by just one property value; other values coming from the base instance. To give a simple example, one could have class like: public class Circle { final double x, y; // location final double radius; public Circle(double x, double y, double r) { this.x = x; this.y = y; this.r = r; } // method for creating a new instance, moved in x-axis by specified amount public Circle withOffset(double deltaX) { return new Circle(x+deltaX, y, radius); } } So: what should method "withOffset" be called? (note: NOT what its name ought to be -- but what is this class of methods called). Technically it is kind of a factory method, but somehow that does not seem quite right to me, since often factories are just given basic properties (and are either static methods, or are not members of the result type but factory type). So I am guessing there should be a better term for such methods. Since these methods can be used to implement "fluent interface", maybe they could be "fluent factory methods"? Better suggestions? EDIT: as suggested by one of answers, java.math.BigDecimal is a good example with its 'add', 'subtract' (etc) methods. Also: I noticed that there's this question (by Jon Skeet no less) that is sort of related (although it asks about specific name for method)

    Read the article

  • OOP design issue: Polymorphism

    - by Graham Phillips
    I'm trying to solve a design issue using inheritance based polymorphism and dynamic binding. I have an abstract superclass and two subclasses. The superclass contains common behaviour. SubClassA and SubClassB define some different methods: SubClassA defines a method performTransform(), but SubClassB does not. So the following example 1 var v:SuperClass; 2 var b:SubClassB = new SubClassB(); 3 v = b; 4 v.performTransform(); would cause a compile error on line 4 as performTransform() is not defined in the superclass. We can get it to compile by casting... (v as SubClassA).performTransform(); however, this will cause a runtime exception to be thrown as v is actually an instance of SubClassB, which also does not define performTransform() So we can get around that by testing the type of an object before casting it: if( typeof v == SubClassA) { (cast v to SubClassA).performTransform(); } That will ensure that we only call performTransform() on v's that are instances of SubClassA. That's a pretty inelegant solution to my eyes, but at least its safe. I have used interface based polymorphism (interface meaning a type that can't be instantiated and defines the API of classes that implement it) in the past, but that also feels clunky. For the above case, if SubClassA and SubClassB implemented ISuperClass that defined performTransform, then they would both have to implement performTransform(). If SubClassB had no real need for a performTransform() you would have to implement an empty function. There must be a design pattern out there that addresses the issue.

    Read the article

  • Ruby shortest way to write rnd hex

    - by Whirlwin
    Hi. What I have is a method used to generate random hex values. E.g 666 or FF7 However, I don't think it looks simple/elegant at all.. What I want is to make it more simple which perhaps will make my code shorter as well, but I don't know how. That is why I need tips or hints Here is my code so far: def random_values random_values = Array.new letters = ['A','B','C','D','E','F'] for i in 1..15 if i <= 9 random_values << i else random_values << letters[i-10] end end return random_values.shuffle[0].to_s + random_values.shuffle[0].to_s + random_values.shuffle[0].to_s end As you probably see, I do not generate random numbers. I just shuffle the array containing the values I want, meaning all the numbers in the array are unique, which is not needed, but was the easiest solution for me when I wrote the code. I am most concerned about the return line.. If only it was possible to write like: return 3.times { random_values.shuffle[0] } or return random_values.shuffle[0].to_s *3 Thanks in advance!

    Read the article

  • Easiest way to remove Keys from a 2D Array?

    - by dbemerlin
    Hi, I have an Array that looks like this: array( 0 => array( 'key1' => 'a', 'key2' => 'b', 'key3' => 'c' ), 1 => array( 'key1' => 'c', 'key2' => 'b', 'key3' => 'a' ), ... ) I need a function to get an array containing just a (variable) number of keys, i.e. reduce_array(array('key1', 'key3')); should return: array( 0 => array( 'key1' => 'a', 'key3' => 'c' ), 1 => array( 'key1' => 'c', 'key3' => 'a' ), ... ) What is the easiest way to do this? If possible without any additional helper function like array_filter or array_map as my coworkers already complain about me using too many functions. The source array will always have the given keys so it's not required to check for existance. Bonus points if the values are unique (the keys will always be related to each other, meaning that if key1 has value a then the other key(s) will always have value b). My current solution which works but is quite clumsy (even the name is horrible but can't find a better one): function get_unique_values_from_array_by_keys(array $array, array $keys) { $result = array(); $found = array(); if (count($keys) > 0) { foreach ($array as $item) { if (in_array($item[$keys[0]], $found)) continue; array_push($found, $item[$keys[0]]); $result_item = array(); foreach ($keys as $key) { $result_item[$key] = $item[$key]; } array_push($result, $result_item); } } return $result; } Addition: PHP Version is 5.1.6.

    Read the article

  • Starting a code library.

    - by Rob Stevenson-Leggett
    Hi, I've been meaning to start a library of reusable code snippets for a while and never seem to get round to it. I think my main problems are: Where to start. What structure should my library take? Should it be a compiled library (where appropriate or just classes I can drop into any project? Or a library project that can be included? In my experience, a built library will quickly become out of date and the source will get lost. So I'm leaning towards source libraries that I can export from SVN and include in any project. Intellectual property. I am employeed, so a lot of the code I write is not my IP. How can I ensure that I don't give my own IP away using it on projects in work and at home? I'm thinking the best way would be to licence my library with an open source licence and make sure I only add to it in my own time using my own equipment and therefore making sure that if I use it in a work project the same rules apply as if I was using a third party library. I write in many different languages and often would require two or more parts of this library. Should I look at implementing a few template projects and a core project for each of my chosen reusable components and languages? Has anyone else got this sort of library and how do you organise and update it?

    Read the article

  • Enforcing default time when only date in timestamptz provided

    - by Incognito
    Assume I have the table: postgres=# create table foo (datetimes timestamptz); CREATE TABLE postgres=# \d+ foo Table "public.foo" Column | Type | Modifiers | Storage | Description -----------+--------------------------+-----------+---------+------------- datetimes | timestamp with time zone | | plain | Has OIDs: no So lets insert some values into it... postgres=# insert into foo values ('2012-12-12'), --This is the value I want to catch for. (null), ('2012-12-12 12:12:12'), ('2012-12-12 12:12'); INSERT 0 4 And here's what we have: postgres=# select * from foo ; datetimes ------------------------ 2012-12-12 00:00:00+00 2012-12-12 12:12:12+00 2012-12-12 12:12:00+00 (4 rows) Ideally, I'd like to set up a default time-stamp value when a TIME is not provided with the input, rather than the de-facto time of 2012-12-12 being 00:00:00, I would like to set a default of 15:45:10. Meaning, my results should look like: postgres=# select * from foo ; datetimes ------------------------ 2012-12-12 15:45:10+00 --This one gets the default time. 2012-12-12 12:12:12+00 2012-12-12 12:12:00+00 (4 rows) I'm not really sure how to do this in postgres 8.4, I can't find anything in the datetime section of the manual or the sections regarding column default values.

    Read the article

  • C# Finding 2 positions 1-dimArray

    - by Chris
    Hello, In a method i am calculating the longest row of elements. The 1-dim array is filled up with random values (0 or 1). The method looks up the longest row (being 0 or 1, whatever is the longest). Meaning in for example: 1110100 --> the longest row would be 3 (3 * 1) 0110000 --> the longest row would be 4 (4 * 0) My problem is i am trying to perform some type of linear search to show the position of the row in the array. The first example has the longest row of 3 elements (3 times 1). For 1110100 the position in the array would be 0 - 2 (index) For 0110000 the position in the array would be 3 - 6 (index) I have been trying with foreaches, for loops etc..but i cannot seem to get the proper indexes of both. Cannot seem to display both positions properly. For the first example the correct output wouldbe: The largest row of same elements of the array consists of 3 elements on the position 0 - 2. The longest row of elements gets of same elements get calculated as the following: public int BerekenDeelrij (int [] table) ( int count = 0; final int value = 0; int largest = 0; foreach (int value in table) ( if (value == last value) counter + +; else ( largest = Math.Max largest (largest, counter); final value = value count = 1; ) ) Math.Max return (largest, counter); ) Best Regards.

    Read the article

< Previous Page | 89 90 91 92 93 94 95 96 97 98 99 100  | Next Page >