Search Results

Search found 2736 results on 110 pages for 'semantic meaning'.

Page 94/110 | < Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >

  • OOP design issue: Polymorphism

    - by Graham Phillips
    I'm trying to solve a design issue using inheritance based polymorphism and dynamic binding. I have an abstract superclass and two subclasses. The superclass contains common behaviour. SubClassA and SubClassB define some different methods: SubClassA defines a method performTransform(), but SubClassB does not. So the following example 1 var v:SuperClass; 2 var b:SubClassB = new SubClassB(); 3 v = b; 4 v.performTransform(); would cause a compile error on line 4 as performTransform() is not defined in the superclass. We can get it to compile by casting... (v as SubClassA).performTransform(); however, this will cause a runtime exception to be thrown as v is actually an instance of SubClassB, which also does not define performTransform() So we can get around that by testing the type of an object before casting it: if( typeof v == SubClassA) { (cast v to SubClassA).performTransform(); } That will ensure that we only call performTransform() on v's that are instances of SubClassA. That's a pretty inelegant solution to my eyes, but at least its safe. I have used interface based polymorphism (interface meaning a type that can't be instantiated and defines the API of classes that implement it) in the past, but that also feels clunky. For the above case, if SubClassA and SubClassB implemented ISuperClass that defined performTransform, then they would both have to implement performTransform(). If SubClassB had no real need for a performTransform() you would have to implement an empty function. There must be a design pattern out there that addresses the issue.

    Read the article

  • .NET HttpModule does not send form variables to PHP file on RewritePath()

    - by jammus
    Hello friends. We have an application running on IIS 6 which uses a custom HttpModule to rewrite urls. This works great (well done us) except in the case where the Context.RewritePath destination is a .php file. The php file is executed as expected, however the $_POST collection is empty meaning it cannot access any forms which are submitted to rewritten urls. The problem does not exist when rewriting to .aspx files as the Request.Form collection is fine. My question therefore has two parts: Why is the $_POST collection not being populated? Is there a way to ensure that the .php $_POST collection is correctly populated after a rewrite? I don't have much to show in the way of code. There's just a simple: context.RewritePath(newPath); once the HttpModule has figured out where to send the request. Edit: Interestingly, if I do var_dump(file_get_contents('php://input')); in the PHP file (method described here) the contents of the form is displayed. So the data is reaching the PHP script but not the $_POST array.

    Read the article

  • Could someone explain gtk2hs drag and drop to me, the listDND.hs demo just isn't doing it for me?

    - by Tom Carstens
    As the title says, I just don't get DND (or rather I understand the concept and I understand the order of callbacks, I just don't understand how to setup DND for actual usage.) I'd like to say that I've done DND stuff before in C, but considering I never really got that working... So I'm trying (and mostly succeeding, save DND) to write a text editor (using gtksourceview, because it has built in code highlighting.) Reasons are below if you want them. Anyways, there's not really a good DND demo or tutorial available for gtk2hs (listDND.hs just doesn't translate well in my head.) So what I'm asking is for code that demonstrates simple DND on a window widget (for example.) Ideally, it should accept drops from other windows (such as Thunar) and print out the information in string form. I think I can take it from there... Reasons: I'm running a fairly light weight setup, dwm and a few gtk+2 programs. I really don't want to have to pull in gtk+3 to get the current gedit from the repos (Arch Linux.) Currently, I'm using geany for all of my text editing needs, however, geany is a bit heavy for editing config files. Further, geany doesn't care for my terminal of choice (st;) so I don't even get the benefit of using it as an IDE. Meaning I'd like a lightweight text editor with syntax highlighting. I could configure emacs or vim or something, but that seems to me to be more of a hack then a proper solution. Thus my project was born. It's mostly working (aside from DND, all that's left is proper multi-tab support.) Admittedly, I could probably work this out if I wrote it in C, but there isn't that much state in a text editor so Haskell's been working fine with almost no need for mutable variables.

    Read the article

  • help on developing enterprise level software solutions

    - by wefwgeweg
    there is a specific niche which I would like to target by providing a complete enterprise level software solution.... the problem is, where do i begin ? meaning, i come from writing just desktop software on VB/ASP .net/PHP/mysql and suddenly unfamiliar terms popup like Oracle, SAP Business Information Warehouse, J2EE.... obviously, something is pointing towards Java, is it common for software suites, or solutions to be developed 100% on Java technology and standards? Are there any other platform to build enterprise level software on ? i am still lacking understanding what exactly is "Enterprise level" ? what is sufficient condition to call a software that sells for $199 and then suddenly it's $19,999 for "enterprise" package. I dont understand why there is such a huge discrepancy between "standard" and "enterprise" versions of software. Is it just attempting to bag large corporations on a spending spree ? so why does one choose to develop so called "enterprise" softwares ? is it because of the large inflated price tag you can justify with ? i would also like some more enterpreneural resources on starting your own enterprise software company in a niche.... Thank you for reading, i am still trying to find the right questions.

    Read the article

  • Should we retire the term "Context"?

    - by MrGumbe
    I'm not sure if there is a more abused term in the world of programming than "Context." A word that has a very clear meaning in the English language has somehow morphed into a hot mess in software development, where the definition where the connotation can be completely different based on what library you happen to be developing in. Tomcat uses the word context to mean the configuration of a web application. Java applets, on the other hand, use an AppletContext to define attributes of the browser and HTML tag that launched it, but the BeanContext is defined as a container. ASP.NET uses the HttpContext object as a grab bag of state - containing information about the current request / response, session, user, server, and application objects. Context Oriented Programming defines the term as "Any information which is computationally accessible may form part of the context upon which behavioral variations depend," which I translate as "anything in the world." The innards of the Windows OS uses the CONTEXT structure to define properties about the hardware environment. The .NET installation classes, however, use the InstallContext property to represent the command line arguments entered to the installation class. The above doesn't even touch how all of us non-framework developers have used the term. I've seen plenty of developers fall into the subconscious trap of "I can't think of anything else to call this class, so I'll name it 'WidgetContext.'" Do you all agree that before naming our class a "Context," we may want to first consider some more descriptive terms? "Environment", "Configuraton", and "ExecutionState" come readily to mind.

    Read the article

  • MACRO compilation PROBLEM

    - by wildfly
    i was given a primitive task to find out (and to put in cl) how many nums in an array are bigger than the following ones, (meaning if (arr[i] arr[i+1]) count++;) but i've problems as it has to be a macro. i am getting errors from TASM. can someone give me a pointer? SortA macro a, l LOCAL noes irp reg, <si,di,bx> push reg endm xor bx,bx xor si,si rept l-1 ;;also tried rept 3 : wont' compile mov bl,a[si] inc si cmp bl,arr[si] jb noes inc di noes: add di,0 endm mov cx,di irp reg2, <bx,di,si> pop reg2 endm endm dseg segment arr db 10,9,8,7 len = 4 dseg ends sseg segment stack dw 100 dup (?) sseg ends cseg segment assume ds:dseg, ss:sseg, cs:cseg start: mov ax, dseg mov ds,ax sortA arr,len cseg ends end start errors: Assembling file: sorta.asm **Error** sorta.asm(51) REPT(4) Expecting pointer type **Error** sorta.asm(51) REPT(6) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(10) Expecting pointer type **Error** sorta.asm(51) REPT(12) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(16) Expecting pointer type **Error** sorta.asm(51) REPT(18) Symbol already different kind: NOES Error messages: 6

    Read the article

  • which one of these is an example of coercion

    - by user1890210
    I have been pondering a multiple choice question on coercion. One of the 4 examples a,b,c or d is an example of coercion. I narrowed it down to A or B. But I am having a problem choosing between the two. Cane someone please explain why one is coercion and one isn't. A) string s="tomat"; char c='o'; s=s+c; I thought A could be correct because we have two different types, character and string, being added. Meaning that c is promoted to string, hence coercion. B) double x=1.0; double y=2.0; int i=(int)(x+y); I also thought B was the correct answer because the double (x+y) is being turned into a int to be placed in i. But I thought this could be wrong because its being done actively through use of (int) rather than passively such as "int i = x + y" I'll list the other two options, even though I believe that neither one is the correct answer C) char A=0x20; A = A << 1 | 0x01; cout << A << endl; D) double x=1.0; double y=x+1; return 0; I'm not just looking for an answer, but an explanation. I have read tons of things on coercion and A and B both look like the right answer. So why is one correct and the other not.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Building a survey to put in a WordPress website using Python/Django

    - by chiurox
    So I've been given a task to build a survey to get data regarding time slot preferences of prospective students for a particular course. I know there are really quick solutions to this like Google Forms, SurveyMonkey, but since it's not unusually hard, I want to implement the survey myself in a totally new language as an opportunity to get started with it and also be able to customize and provide dynamic info to the users who are voting. Although I have done some stuff in PHP, C++, javascript, etc, I'm pretty new to Python+Django framework but it's something I've been meaning to get into since a long time ago. Initially, what I want is to make a grid with the days of the week as columns and time-durations as rows. In each cell I want to provide users a way to choose how strong (high/medium/low) their preference for this particular day+time is. I also want to show how many "votes" have already been cast for this particular preference because this will influence a lot in their decisions and as a result make this process easier when we are going to define the classes. I'll probably store the data in MySQL. Could anyone point me to some really good Python+Django tutorials for my particular purpose? Does anyone think I'm wasting my time with this trivial task by choosing new tools and that I should just use something I already know (like PHP) or a free service or plugin for Wordpress? Thanks!

    Read the article

  • Question regarding parent/child relationships with dynamically generated checkboxes using jquery

    - by Jeff
    I have a form of checkboxes, that is dynamically generated based on the users content. Sections of checkboxes are broken up by categories, and each category has projects within. For database purposes, the category values have checkboxes, that are hidden. IF a category has sub items that have checkboxes that are checked, THEN the category checkbox is checked as well. I have gotten this working ok using the JQuery .click(), but I can't figure out how to do it when the page loads. Here is my code for when a checkbox is actually clicked: $(".project").click(function() { if($(this).is(":checked") && $(this).hasClass("project")) { $(this).parent().parent().children(':first').attr('checked', true); }else if(!$(this).parent().children('.project').is(":checked")){ $(this).parent().parent().children(':first').attr('checked', false); } }); Now when I am editing the status of these boxes (meaning after they have been saved to the db) the category boxes are not showing up as checked even though their children projects are checked. What can I do to make it so that my category box will be checked at load time if that category's child is checked? Part of the problem I think is with the dynamically changing parent child setup, how can I find the parent box in order to have it checked? Thanks!

    Read the article

  • Element not found blocks execution in Selenium

    - by Mariano
    In my test, I try to verify if certain text exists (after an action) using find_element_by_xpath. If I use the right expression and my test pass, the routine ends correctly in no time. However if I try a wrong text (meaning that the test will fail) it hangs forever and I have to kill the script otherwise it does not end. Here is my test (the expression Thx user, client or password you entered is incorrect does not exist in the system, no matter what the user does): # -*- coding: utf-8 -*- import gettext import unittest from selenium import webdriver class TestWrongLogin(unittest.TestCase): def setUp(self): self.driver = webdriver.Firefox() self.driver.get("http://10.23.1.104:8888/") # let's check the language try: self.lang = self.driver.execute_script("return navigator.language;") self.lang = self.lang("-")[0] except: self.lang = "en" language = gettext.translation('app', '/app/locale', [self.lang], fallback=True) language.install() self._ = gettext.gettext def tearDown(self): self.driver.quit() def test_wrong_client(self): # test wrong client inputElement = self.driver.find_element_by_name("login") inputElement.send_keys("root") inputElement = self.driver.find_element_by_name("client") inputElement.send_keys("Unleash") inputElement = self.driver.find_element_by_name("password") inputElement.send_keys("qwerty") self.driver.find_element_by_name("form.submitted").click() # wait for the db answer self.driver.implicitly_wait(10) ret = self.driver.find_element_by_xpath( "//*[contains(.,'{0}')]".\ format(self._(u"Thx user, client or password you entered is incorrect"))) self.assertTrue(isinstance(ret, webdriver.remote.webelement.WebElement)) if __name__ == '__main__': unittest.main() Why does it do that and how can I prevent it?

    Read the article

  • Rails: Obfuscating Image URLs on Amazon S3? (security concern)

    - by neezer
    To make a long explanation short, suffice it to say that my Rails app allows users to upload images to the app that they will want to keep in the app (meaning, no hotlinking). So I'm trying to come up with a way to obfuscate the image URLs so that the address of the image depends on whether or not that user is logged in to the site, so if anyone tried hotlinking to the image, they would get a 401 access denied error. I was thinking that if I could route the request through a controller, I could re-use a lot of the authorization I've already built into my app, but I'm stuck there. What I'd like is for my images to be accessible through a URL to one of my controllers, like: http://railsapp.com/images/obfuscated?member_id=1234&pic_id=7890 If the user where to right-click on the image displayed on the website and select "Copy Address", then past it in, it would be the SAME url (as in, wouldn't betray where the image is actually hosted). The actual image would be living on a URL like this: http://s3.amazonaws.com/s3username/assets/member_id/pic_id.extension Is this possible to accomplish? Perhaps using Rails' render method? Or something else? I know it's possible for PHP to return the correct headers to make the browser think it's an image, but I don't know how to do this in Rails... UPDATE: I want all users of the app to be able to view the images if and ONLY if they are currently logged on to the site. If the user does not have a currently active session on the site, accessing the images directly should yield a generic image, or an error message.

    Read the article

  • C# Finding 2 positions 1-dimArray

    - by Chris
    Hello, In a method i am calculating the longest row of elements. The 1-dim array is filled up with random values (0 or 1). The method looks up the longest row (being 0 or 1, whatever is the longest). Meaning in for example: 1110100 --> the longest row would be 3 (3 * 1) 0110000 --> the longest row would be 4 (4 * 0) My problem is i am trying to perform some type of linear search to show the position of the row in the array. The first example has the longest row of 3 elements (3 times 1). For 1110100 the position in the array would be 0 - 2 (index) For 0110000 the position in the array would be 3 - 6 (index) I have been trying with foreaches, for loops etc..but i cannot seem to get the proper indexes of both. Cannot seem to display both positions properly. For the first example the correct output wouldbe: The largest row of same elements of the array consists of 3 elements on the position 0 - 2. The longest row of elements gets of same elements get calculated as the following: public int BerekenDeelrij (int [] table) ( int count = 0; final int value = 0; int largest = 0; foreach (int value in table) ( if (value == last value) counter + +; else ( largest = Math.Max largest (largest, counter); final value = value count = 1; ) ) Math.Max return (largest, counter); ) Best Regards.

    Read the article

  • Strange data swapping error occurs when I attempt to update rows in my table from another table in m

    - by Wesley
    So I have a table of data that is 10,000 lines long. Several of the columns in the table simply describe information about one of the columns, meaning, that only one column has the content, and the rest of the columns describe the location of the content (its for a book). Right now, only 6,000 of the 10,000 rows' content column is filled with its content. Rows 6-10,000's content column simply says null. I have another table in the db that has the content for rows 6,000-10,000, with the correct corresponding primary key which would (seemingly) make it easy to update the 10,000 row table. I have been trying an update query such as the following: UPDATE table(10,000) SET content_column = (SELECT content FROM table(6,000-10,000) WHERE table(10,000).id = table(6-10,000.id) Which kind of works, the only problem is that it pulls in the data from the second table just fine, but it replaces the existing content column with null. So rows 1-6,000's content column become null, and rows 6-10,000's content column have the correct values...Pretty strange I thought anyway. Does anybody have any thoughts about where I am going wrong? If you could show me a better sql query, I would appreciate it! Thanks

    Read the article

  • In Java, is there a gain in using interfaces for complex models?

    - by Gnoupi
    The title is hardly understandable, but I'm not sure how to summarize that another way. Any edit to clarify is welcome. I have been told, and recommended to use interfaces to improve performances, even in a case which doesn't especially call for the regular "interface" role. In this case, the objects are big models (in a MVC meaning), with many methods and fields. The "good use" that has been recommended to me is to create an interface, with its unique implementation. There won't be any other class implementing this interface, for sure. I have been told that this is better to do so, because it "exposes less" (or something close) to the other classes which will use methods from this class, as these objects are referring to the object from its interface (all public method from the implementation being reproduced in the interface). This seems quite strange to me, as it seems like a C++ use to me (with header files). There I see the point, but in Java? Is there really a point in making an interface for such unique implementation? I would really appreciate some clarifications on the topic, so I could justify not following such kind of behavior, and the hassle it creates from duplicating all declarations.

    Read the article

  • What collection object is appropriate for fixed ordering of values?

    - by makerofthings7
    Scenario: I am tracking several performance counters and have a CounterDescription[] correlate to DataSnapshot[]... where CounterDescription[n] describes the data loaded within DataSnapshot[n]. I want to expose an easy to use API within C# that will allow for the easy and efficient expansion of the arrays. For example CounterDescription[0] = Humidity; DataSnapshot[0] = .9; CounterDescription[1] = Temp; DataSnapshot[1] = 63; My upload object is defined like this: Note how my intent is to correlate many Datasnapshots with a dattime reference, and using the offset of the data to refer to its meaning. This was determined to be the most efficient way to store the data on the back-end, and has now reflected itself into the following structure: public class myDataObject { [DataMember] public SortedDictionary<DateTime, float[]> Pages { get; set; } /// <summary> /// An array that identifies what each position in the array is supposed to be /// </summary> [DataMember] public CounterDescription[] Counters { get; set; } } I will need to expand each of these arrays (float[] and CounterDescription[] ), but whatever data already exists must stay in that relative offset. Which .NET objects support this? I think Array[] , LinkedList<t>, and List<t> Are able to keep the data fixed in the right locations. What do you think?

    Read the article

  • jquery : ul, li parent multiple child sub-child toggling

    - by user360826
    hello, my main question is as follows: how to show only the first subchild of a ul or li upon clicking the enclosing parent. eg: <ul> Grandparent <li> Child1 <li> Grandchild11</li></li> <li> Child2 <li>GrandChild21</li><li>grandchild22</li></li> </ul> so, for example I would like something to the effect of <script> $('ul').click(function(){ $('ul').children('first li').toggle() }); $('li').click(function(){ $('li').children('first li').toggle() }); </script> meaning: when i click ul, i only see the first child node (child1 and child2 will be shown, but not the grandchildren). when i click child1 or child2 i see the respective grandchild. grandchild is not shown upon clicking grandparent, only upon clicking child1 or child2. i know i am reinventing the wheel of some pre-coded solution, but any help would be largely appreciated!

    Read the article

  • Small Open source and free java applications

    - by user1089770
    I am a Perl Developer who has just stepped into the Java world and I want to be very proficient in Java EE development. However, I have found that, being a Perl guy, I have very high MTI(Mother Tongue Influence). Indians will know what MTI is. For others, it can be defined as an influence of your "main" language whenever you "speak" your new language. In other words, our mind converts/translates what we want to "say" in the new language based on the "main" language, which can be quite absurd or meaning less in the "new" language. Coming back to the point, as a result of this MTI, many lines of my code has this Perl influence and it is absurd and useless for production. Hence, I'd like to see or better do some research on existing small to medium open source java applications, so that I will know how I can "speak" in the native way of the "new" language. Some examples in PHP will be : WordPress, Zend etc. So I'd really appreciate if you guys could suggest any such apps. Apps that have a great commercial value are highly preferred

    Read the article

  • MATLAB: svds() not converging

    - by Paul
    So using MATLAB's svds() function on some input data as such: [U, S, V, flag] = svds(data, nSVDs, 'L') I noticed that from run to run with the same data, I'd get drastically different output SVD sizes from run to run. When I checked whether 'flag' was set, I found that it was, indicating that the SVDs had not converged. My normal system here would be that if it really needs to converge, I'd do something like this: flag = 1 svdOpts = struct('tol', 1e-10, 'maxit', 600, 'disp', 0); while flag: if svdOpts.maxit > 1e6 error('There''s a real problem here.') end [U, S, V, flag] = svds(data, nSVDs, 'L', svdOpts) svdOpts.maxit = svdOpts.maxit*2 end But from what I can tell, when you use 'L' as the third argument, the fourth argument is ignored, meaning I just have to deal with the fact that it's not converging? I'm not even really sure how to use the 'sigma' argument in place of the 'L' argument. I've also tried reducing the number of SVDs calculated to no avail. Any help on this matter would be much appreciated. EDIT While following up on the comments below, I found that the problem had to do with the way I was building my data matrices. Turned out I had accidentally inverted a matrix and had an input of size (4000x1) rather than (20x200), which was what was refusing to converge. I also did some more timing tets and found that the fourth argument was not, in fact, being ignored, so that's on me. Thanks for the help guys.

    Read the article

  • Catching exception in Main() method

    - by Corvin
    Consider the following simple application: a windows form created by a "new C# windows application" sequence in VS that was modified in a following way: public static void Main() { Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); try { Application.Run(new Form1()); } catch (Exception ex) { MessageBox.Show("An unexpected exception was caught."); } } Form1.cs contains the following modifications: private void Form1_Load(object sender, EventArgs e) { throw new Exception("Error"); } If I press F5 in IDE, then, as I expect, I see a message box saying that exception was caught and the application quits. If I go to Debug(or Release)/bin and launch the executable, I see the standard "Unhandled exception" window, meaning that my exception handler doesn't work. Obviously, that has something to do with exception being thrown from a different thread that Application.Run is called from. But the question remains - why the behavior differs depending on whether the application has been run from IDE or from command line? What is the best practice to ensure that no exceptions remain unhandled in the application?

    Read the article

  • Django Many-to-Many Question

    - by DZ
    My questions seems like a common problem that when I have seen any questions on it is never really asked right or not answered. So Im going to try to get the question right, and maybe someone knows how to resolve the issue, or correct my understanding. The problem: When you have a many-to-many relation ship (related_name not through) and you are trying to use the admin interface you are required to input one of the rleationships even though it does not have to exsist for you to create the first entry. Meaning you have to assign a group to an event to create the group. Wow that sounds complicated. So I can see why the question is not getting answered. Lets try the non code explanation example... First and important versions: Django 1.1.1 Phython 2.6 So I have a model where I created a many-to-many realtionship and Im using the related_name Im creating an app that is an event organizer, for simplicty lets say events although they could be anytype). For this first post Im going to stay away from the code and just try to explain. A few keys: (explaining comment) ** - many-to-many So in the model we have 1) The Main Event (this is main model) 2) Groups (link to events and their can be many events for a group) a) Events** I have simplified this example a little becuase I recognize that what does it matter. Just create the event first... But there are specific varations where that will not work. What the many-to-many related_name does it created another table with the indecies of the two other tables. Nothing says that this extra table HAS to be populated. Becuase if I look in the database and work within myPHPadmin I can create a group with out registering an event, since the connection between the two is a seperate table the DB does not care. How do I make the admin interface this realize it? Ok I know thats a lot so I hope I have explained it clearly. Thank you anyone for your comments/thoughts/advice

    Read the article

  • local vs core contoller

    - by latvian
    Hi, I am adding new column and action in the local admin app/code/local/Mage/Adminhtml/Block/Catalog/Product/Grid.php which works fine, however. The local controller/app/code/local/Mage/Adminhtml/Block/Catalog/Product.php is not being used or is not overloading the admin one /app/code/core/Mage/Adminhtml/Block/Catalog/Product.php. This is almost fresh install of Magento 1.4.0.1. I am the only one working, so i know it is not overloaded by some custom controller. I have disabled all custom modules. I have rolled back most of my changes. I have checked /etc/Modules/Mage_Catalog.xml. Refreshed cache all possible ways, loged in and out. Nothing....still using the core contoller copy. why? How do you troubleshoot, meaning, at what moment magento decides using between core or local copies? ...its even more strange because it does not parse local Adminhtml config.xml but uses local Adminthml copy of Blocks. Any pointer would help. I would like to keep everything in local code. Thank You, Margots

    Read the article

  • Extended slice that goes to beginning of sequence with negative stride

    - by recursive
    Bear with me while I explain my question. Skip down to the bold heading if you already understand extended slice list indexing. In python, you can index lists using slice notation. Here's an example: >>> A = list(range(10)) >>> A[0:5] [0, 1, 2, 3, 4] You can also include a stride, which acts like a "step": >>> A[0:5:2] [0, 2, 4] The stride is also allowed to be negative, meaning the elements are retrieved in reverse order: >>> A[5:0:-1] [5, 4, 3, 2, 1] But wait! I wanted to see [4, 3, 2, 1, 0]. Oh, I see, I need to decrement the start and end indices: >>> A[4:-1:-1] [] What happened? It's interpreting -1 as being at the end of the array, not the beginning. I know you can achieve this as follows: >>> A[4::-1] [4, 3, 2, 1, 0] But you can't use this in all cases. For example, in a method that's been passed indices. My question is: Is there any good pythonic way of using extended slices with negative strides and explicit start and end indices that include the first element of a sequence? This is what I've come up with so far, but it seems unsatisfying. >>> A[0:5][::-1] [4, 3, 2, 1, 0]

    Read the article

  • Change workarea size of Linux desktop

    - by nonoitall
    I'm trying to write a taskbar/panel for Linux (like fbpanel or pypanel) using GTK# and am a little hung up. I've created a Gtk.Window to act as the panel and positioned/resized it appropriately. I've also set its WindowTypeHint to Dock so that it remains on top of other windows. So far it 'looks' like a panel. However, if the panel is running and I maximize another window, that window fills the whole desktop - meaning the bottom portion of the window is covered up by my panel. I've gathered that I probably need to change the desktop's workarea. How can I go about doing this in C#? (Preferably using GTK#, but I don't mind using interop if it's necessary.) As a bit of a side point, I'm curious if anyone knows how I would go about 'informing' the window manager about where applications' taskbar buttons are. (For example, if the window manager wants to animate the minimize action so that the window shrinks down to its button on the taskbar, how do I let the window manager know where that button is on the taskbar?)

    Read the article

  • exit /B 0 does not work...

    - by murxx
    Hi, I have the following problem: I have created a batch script which calls itself in there (for being able to write a log in parallel). In the script I start another process (like start startServer.bat) which starts up a java process and keeps opened up all the time. In my original script I wait 30 seconds, check if the process is running and do an: exit /B 0 Unfortunately that does not work, the window shows that the exit /B 0 is being evaluated, but the window still keeps open. When I close the window with the other process (meaning the "child" processes started up in my .bat) my script continues its run. So: scriptA.bat - in there I call: start startServer.bat - wait 30 seconds - check is server is started - exit /B 0 Process hangs up! What's very odd, if I wrap another script around, like: scriptB.bat - call scriptA.bat ----- in there I call: start startServer.bat ----- wait 30 seconds ----- check is server is started ----- exit /B 0 - scriptA.bat continues without any hangup! I also tried the same with exit 0 (without /B) also, same result! In the first case it hangs up, in the second case my window closes as expected... Has anyone of you ever had such a problem before and knows what's wrong here? Process hangs up!

    Read the article

< Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >